Aller au contenu

Recherche:Les clusters de gènes tRNA et rRNA chez les procaryotes/Annexe/alpha

Une page de Wikiversité, la communauté pédagogique libre.
alpha
Image logo représentative de la faculté
Annexe 2
Recherche : Les clusters de gènes tRNA et rRNA chez les procaryotes
Précédent :gamma
Suivant :bacilli
En raison de limitations techniques, la typographie souhaitable du titre, « Annexe : alpha
Les clusters de gènes tRNA et rRNA chez les procaryotes/Annexe/alpha
 », n'a pu être restituée correctement ci-dessus.



Rickettsia typhi str. B9991CWPP[modifier | modifier le wikicode]

rtb opérons[modifier | modifier le wikicode]

  • Liens: gtRNAdb [1], NCBI [2], génome [3]
  • Lien tableur: rtb opérons
  • Phylogénie: Bacteria; Proteobacteria; Alphaproteobacteria; Rickettsiales; Rickettsiaceae; Rickettsieae; Rickettsia; typhus group.
  • Légende: cdsa: cds aas, cdsd: cds dirigé
A8. Rickettsia typhi str. B9991CWPP
29%GC 31.12.19 Paris  33   doubles intercal cds aa avec aa cdsa cdsd protéines
comp 7429..8469 cds 381 381 347 UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase
comp 8851..8926 ttc 368 368
9295..10278 cds 328 tRNA dihydrouridine synthase DusB
14663..18055 cds 108 108 1131 autotransporter outer membrane beta-barrel domain-containing protein
18164..18238 gaa 1394 1394
comp 19633..20106 cds 158 crossover junction endodeoxyribonuclease RuvC
comp 48065..48709 cds 278 278 215 YihA family ribosome biogenesis GTP-binding protein
comp 48988..49064 atgf 110 110
comp 49175..49411 cds 79 50S ribosomal protein L31
comp 73627..73929 cds 17 17 101 preprotein translocase subunit SecG
comp 73947..74021 acc 139 139
comp 74161..75417 cds 419 MFS transporter
155064..157163 cds 143 143 700 elongation factor G
157307..157382 tgg 167 167
157550..157750 cds 67 preprotein translocase subunit SecE
189197..189400 cds 889 889 68 DUF2674 domain-containing protein
comp 190290..190365 acg 142 142
comp 190508..192814 cds 769 outer membrane protein assembly factor BamA
255010..255921 cds 732 732 304 methionyl-tRNA formyltransferase
256654..259439 23s 206 2786
259646..259760 5s 173 173 115
comp 259934..261007 cds 358 cell division protein ZapE
291358..291843 cds 35 35 162 30S ribosomal protein S9
291879..291955 atgj 1364 1364
comp 293320..293805 cds 162 RNA pyrophosphohydrolase
335194..336996 cds 402 402 601 elongation factor 4
337399..337473 aac 633 633
comp 338107..338793 cds 229 hp
comp 440466..440933 cds 496 496 156 DUF2155 domain-containing protein
441430..441504 tgc 31 31
441536..442456 cds 307 site-specific tyrosine recombinase XerD
comp 469056..469781 cds 218 218 242 3-deoxy-manno-octulosonate cytidylyltransferase
470000..470075 aaa 15 15
470091..470167 atc 1922 1922
472090..472662 cds 191 GTP cyclohydrolase I FolE
comp 564534..565562 cds 1530 1530 343 type 2 isopentenyl-diphosphate Delta-isomerase
comp 567093..567180 tcc 218 218
comp 567399..568145 cds 249 NTP transferase domain-containing protein
583250..584149 cds 1278 1278 300 hydroxymethylbilane synthase
comp 585428..585518 tca 58 58
comp 585577..586569 cds 331 tryptophan--tRNA ligase
598723..599706 cds 26 26 328 polyprenyl synthetase family protein
599733..599809 cgg 60 60
comp 599870..599944 caa 62 62
comp 600007..601779 cds 591 aminopeptidase P family protein
comp 644357..644745 cds 499 499 130 p-ribosome-associated translation inhibitor RaiA
645245..645321 gac @1 1051 1051
comp 646373..646448 gcc 222 222
comp 646671..647276 cds 202 ATP-dependent Clp endopeptidase proteolytic subunit ClpP
comp 649389..650048 cds 452 452 220 (d)CMP kinase
650501..650577 gtc 1274 1274
comp 651852..652094 cds 81 HU family DNA-binding protein
comp 696163..697398 cds 1535 1535 412 tyrosine--tRNA ligase
698934..699010 cgt 1028 1028
700039..705720 cds 1894 alpha-2-macroglobulin family protein
comp 727560..728087 cds 1164 1164 176 copper chaperone Pcu(A)C
comp 729252..729326 gca 32 32
comp 729359..729574 cds 72 hp
739215..740075 cds 181 181 287 TIGR01459 family HAD-type hydrolase
740257..740343 ctc 246 246
740590..741960 cds 1199 1199 457 magnesium transporter
743160..743234 ggc 1090 1090
744325..744753 cds 143 preprotein translocase subunit YajC
comp 775944..777866 cds 2465 2465 641 hp
comp 780332..781831 16s 1854 1854 1500
comp 783686..785485 cds 600 PAS domain-containing sensor histidine kinase
comp 814590..814823 cds 349 349 78 hp
comp 815173..815248 gta 68 68
comp 815317..815589 cds 91 30S ribosomal protein S20
comp 829300..830484 cds 82 82 395 elongation factor Tu
comp 830567..830640 gga 95 95
comp 830736..830821 tac 183 183
831005..831733 cds 243 23s rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
839841..839969 cds 145 145 43 dimethyladenosine transferase
840115..840200 tta 2009 2009
842210..842446 cds 79 hp
comp 876906..877589 cds 401 401 228 7-cyano-7-deazaguanine synthase QueC
877991..878067 cac 145 145
878213..879943 cds 577 ATP-binding cassette domain-containing protein
918938..919882 cds 951 951 315 ACP S-malonyltransferase
920834..920925 agc 1945 1945
comp 922871..924049 cds 393 acetyl-CoA C-acetyltransferase
comp 961209..962297 cds 41 41 363 YjgP/YjgQ family permease
comp 962339..962415 atgi 390 390
comp 962806..963273 cds 156 peptidoglycan-associated lipoprotein Pal
1023375..1023626 cds 1585 1585 84 BolA family transcriptional regulator
1025212..1025288 cca 17 17
1025306..1025521 cds 72 translation initiation factor IF-1
1053321..1054139 cds 2191 2191 273 alpha/beta hydrolase
comp 1056331..1056407 aga 98 98
1056506..1056823 cds 106 DUF167 domain-containing protein
comp 1098776..1099240 cds 40 40 155 DNA polymerase III subunit chi
comp 1099281..1099365 cta 145 145
comp 1099511..1100662 cds 384 succinyl-diaminopimelate desuccinylase
comp 1102351..1102980 cds 475 475 210 lipoyl(octanoyl) transferase LipB
comp 1103456..1103530 aca 130 130
comp 1103661..1103996 cds 112 30S ribosomal protein S16

rtb cumuls[modifier | modifier le wikicode]

  • Lien tableur: rtb cumuls
  • Légende
  • Notes: moyenne et variance des intercalaires élevés des 21 cds : 1430 et 491
cumuls. rtb.
opérons Fréquences intercalaires tRNAs Fréquences intercalaires cds Fréquences aas cds chromosome
effectif gammes sans rRNAs avec rRNAs gammes cds gammes cdsd gammes cdsa gammes cdsa 300
avec rRNA opérons 2 1 - 1 0 1 100 11 30 0
23s5s 1 20 1 50 8 40 200 13 60 1
16s 1 40 100 5 80 300 12 90 9
16s23s 0 60 1 150 9 120 400 13 120 4
max a 0 80 200 4 160 500 3 150 2
a doubles 0 100 1 250 4 200 600 3 180 7
spéciaux 0 120 300 1 240 700 3 210 3
total aas 0 140 350 1 280 800 1 240 4
sans opérons 29 160 400 3 320 900 0 270 3
1 aa 25 180 450 2 360 1000 0 300 3
max a 2 200 500 4 400 1100 0 330 5
a doubles 0 1 21 2 20
total aas 33 4 0 62 0 61 61
total aas 33
remarques 1
avec jaune moyenne 612 310
variance 665 291
sans jaune moyenne 57 193 269 176
variance 40 148 176 86

rtb blocs[modifier | modifier le wikicode]

A8. rtb, blocs à rRNA.
cds 732 304 methionyl-tRNA formyltransferase
23s 206 2786
5s 173 115
cds 358 cell division protein ZapE
cds 2465 641 hp
16s 1854 1500
cds 600 PAS domain-containing sensor histidine kinase

rtb remarques[modifier | modifier le wikicode]

  • Remarques: Les rickettia, rtb et rpl, présentent de nombreux intercalaires très élevés. D’où cet intercalaire @1 entre 2 aas de 1051 pbs. Je détaille ici les intercalaires du tableau des cumuls.
    - Les intercalaires entre aas: Il y a quatre intercalaires de ce type, 1051 95 60 15. A part le 1er les 3 autres sont courants dans cette étude et seulement le dernier est le rprésentant de la moyenne dans cette étude.
    - Les intercalaires avec un cds. Les 31 blocs de ce génomes se répartissent en 3 groupes
    1. Les RNAs complètement isolés, les 2 intercalaires du bloc sont supérieurs à 400 pbs. Il y a 6 aas dont celui avec 1051, plus le 16s. Sur ces 14 intercalaires 10 sont supérieurs à 900 et 4 entre 400 et 600 pbs.
    2. Les tRNAs proches de leurs 2 cds. Il y a 6 aas dont les 2 intercalaires sont inférieurs à 300 pbs et 4 aas dont au moins un des 2 intercalaires est entre 300 et 400 pbs et l'autre inférieur à 300 pbs.
    3. Il reste 14 blocs dont le 23s5s, auxquels il faut ajouter l’aa gcc voisin du gac isolé par 1051. Ces blocs sont très polarisés, leurs 2 intercalaires sont très dissymétriques.
      - 11 aas ont leur intercalaire majeur supérieur à 900 et va jusqu’à 2465 pbs. Le 23s5s a un intercalaire majeur modéré et assez courant pour les blocs à rRNAs.
      - 3 aas ont leur intercalaire majeur de 450 pbs environ.
  • Les blocs isolés et les blocs entourés par 2 cds.
				
	Blocs à RNAs isolés par 2 intercalaires de plus de 400 pbs.					
	bloc	adresse			Blocs entourés par 2 intercalaires de 300 à 400 pbs	
	aac	337399			ttc	8851
	gac	645245			gta	815173
	gtc	650501			cac	877991
	cgt	698934			atgi	962339
	ggc	743160				
	16s	780332			Blocs entourés par 2 intercalaires inférieurs à 300 pbs	
	agc	920834			atgf	48988
	:	:			acc	73947
	:	:			tgg	157307
	:	:			cgg-caa	599733
	:	:			gga-tac	830567
	:	:			cta	1099281
  • Les séquences des doubles: Il n'y a aucun double dans ce génome

rtb distribution[modifier | modifier le wikicode]

Al1 rtb, Rickettsia typhi str. B9991CWPP. alpha.
g1    t1       
atgi 1 tct tat atgf 1
att act aat agt
ctt cct cat cgc
gtt gct gat ggt
ttc 1 tcc 1 tac 1 tgc 1
atc 1 acc 1 aac 1 agc 1
ctc 1 ccc cac 1 cgt 1
gtc 1 gcc 1 gac 1 ggc 1
tta 1 tca 1 taa tga
ata aca 1 aaa 1 aga 1
cta 1 cca 1 caa 1 cga
gta 1 gca 1 gaa 1 gga 1
ttg tcg tag tgg 1
atgj 1 acg 1 aag agg
ctg ccg cag cgg 1
gtg gcg gag ggg
alpha >1aa =1aa -5s +5s -16s +16s total
rtb 6 27 33

rtb. Intergen51[modifier | modifier le wikicode]

Intergen51. rtb. Le génome[modifier | modifier le wikicode]

  • rtb Le prélèvement: Artb
  • Le nom et le lien NCBI: rtb, Rickettsia typhi str. B9991CWPP, NCBI [4], date 7.12.20.
  • rtb La longueur totale des intercalaires, longueur du génome et taux intercalaires/génome:
Nom	intercals	génome		taux en %			
rtb	264,633		1,112,957	23.8	
rtb données intercalaires[modifier | modifier le wikicode]
rtb données intercalaires 200[modifier | modifier le wikicode]
rtb autres intercalaires aas[modifier | modifier le wikicode]

Intergen51. rtb. Les différents types d'intercalaires[modifier | modifier le wikicode]

  • Lien au tableur: Intergen51. rtb les différents types d'intercalaires.
  • Légende:
    - S pour intercalaire CDS-CDS et R pour tRNA-CDS,
    - c pour intercalaire continu (les 2 gènes sont sur le même brin) et x pour discontinu (les 2 gènes sont sur 2 brins différents, le brin et son complément)
    - %reste = 100*reste/total, le reste étant ce qui reste du total après la fin du diagramme, gamme.
    - %t30 = 100*t30/total, t30 étant le total des fréquences 10 20 30
    - %t5 = 100*t/total, t5 étant le total des fréquences de -1 à -5 dans le diagramme des S-.
Int51.2 rtb les différents types d'intercalaires entre gène
Int51.21 Les différents types
intercalaires CDS-CDS * autres intercalaires
continu S+ S- S0 total c/x RNA-RNA CDS-rRNA total
c 501 98 4 603 3.2 3 3 6
x 185 4 1 190 2 1 3
t 686 102 5 793 5 4 9
% 86.5 12.9 0.6
Int51.22 Détail des * autres intercalaires
intercalaires tRNA-CDS récapitulatif des * autres intercalaires
continu R+ R- R0 total c/x * autres total %
c 42 0 0 42 2.6 tRNA-CDS 58 77
x 16 0 0 16 RNA-RNA 5 7
t 58 0 0 58 CDS-rRNA 4 5
% 100.0 0.0 0.0 non RNA 8 11
- total 75 100
Int51.23 Les taux remarquables
taux %reste %t30 %t5 %0
type S+ R+ S- S+ R+ S- S+ R+
gamme 400 400 6-50 - - - - -
type S+ R+ S- S+ R+ S- S+ R+
c 19.8 28.6 0.0 23.4 7.1 44 0.7 0.0
x 35.5 75.0 0.0 3.2 0.0 25 0.5 0.0

Intergen51. rtb. Les diagrammes CDS-CDS positifs[modifier | modifier le wikicode]

  • Lien tableur: Les diagrammes
  • Diagrammes des gamma:  rtb présente 2 diagrammes
    - fc40, CDS-CDS continu, fréquence unitaire en abscisses et effectif en ordonnées
    - fx%, CDS-CDS discontinu, fréquences regroupées par 10 (freq10) en abscisses et pourcentage en ‰ par rapport au total, en ordonnées.
  • Équations des courbes de tendance en pour 1000: colonnes %fx %fc
Courbes de tendances pour les diagrammes en pour 1000			Calculs des f.41	rtb
R2	x3		x2		x		c		Inflexion poly3	x	c
0.496	2.82E-06	-2.09E-03	3.74E-01	7.33	fx1	abscisse	244.3	229.8
0.570	-2.82E-06	2.21E-03	-6.22E-01	72.4	fc1	ordonnée	15.1	14.8
								
0.551	8.35E-07	-6.12E-04	4.27E-02	29.0	fx41			
0.804	6.45E-06	-4.45E-03	8.03E-01	-13.2	fc41			
  • Moyennes glissantes fc+400, diagonale. Voir le détail des calculs dans abs.
données	rtb		calculs			poly3	rtb
effect	505		R2.21	617		abscis	400
xm	45		pte	0,06		flexa	224
ym	0,51		cste	1,01		flexo	1,49
x1m	205		r400l	195		xm	45
y1m	1		restp	299,01		sup4	250,4
rfin	198,02		%sd	71,04		sup4t	447,5
bornf	205		lond	160		%	56,0
supd	306,7		%sf	71,04		long	179
supdt	431,7		lonf	160			
xmp	269,31		sf/lf	1,92			
r400	100,99		sr/lr	0,00			
supf	306,7		sd/ld	1,92			
supft	431,7		i.r400	0,52						

Intergen51. rtb. Les CDS-CDS négatifs[modifier | modifier le wikicode]

Sous-totaux	rtb			totale	
fréquence	x-	c-		x-	c-
 - 1		0	10		4	4140
 - 2		1	0		85	11
 - 3		0	0		3	12
 - 4		0	33		717	10938
 - 5		0	0		5	19
sp6		3	55		1642	8424
total		4	98		2,456	23,544
reste		0	0		264	420
s6		0	0		361	41
s7		0	9		321	1438
s8		3	46		696	6525
rappot s1-5						
4/2/1		0	3.3		8.4	2.6
% / sp6						
s6/sp6		0.0	0.0		22.0	0.5
s7/sp6		0.0	16.4		19.5	17.1
s8/sp6		100.0	83.6		42.4	77.5
reste/sp6	0.0	0.0		16.1	5.0
						
total s1-5	1	43		814	15120
% / total						
%s1-5		25.0	43.9		33.1	64.2
%sp6		75.0	56.1		66.9	35.8

Intergen51. rtb. Les intercalaires des blocs[modifier | modifier le wikicode]

  • Le détail
RNA-RNA		c	x		CDS-RNA		c	x
23s 5s		1			CDS 16s		1	
16s 23s					5s CDS			
16s tRNA				16 CDS		1	1
tRNA 23s				CDS 5s			
5s tRNA					23s CDS			
tRNA in					CDS 23s		1	
tRNA contig				5s 16s			
tRNA hors	2	2		16s16s			
tRNA 16s								
23s tRNA								
tRNA 5s								
16s 5s								
5s 23s								
5s 5s								
total		3	2		total		3	1
  • Les rares voir gamma pour la longueur des intercalaires
  • Les tRNA-CDS compris, comparaison dans le clade et dans l'étude.

Intergen51. rtb. Les intercalaires tRNA-tRNA extra bloc[modifier | modifier le wikicode]

rtb intercalaires entre cds[modifier | modifier le wikicode]

  • Rickettsia typhi str. B9991CWPP, 7.12.2020, NCBI [5]
  • Note: Pour les génomes des annexes j'ai relevé les intercalaires entre tRNAs et entre ceux-ci et les cds qui leur sont adjacents. L'exemple est celui de rru du clade alpha. L'idée de départ de ces prélèvements est la recherche d'opérons formés de tRNA et de protéine comme dans le cas d'E.coli: l'intercalaire entre le tRNA et la protéine devrait être faible. Voir l'exemple d'eco (remarque @3) avec tac-tac-tpr et aca-tac-gga-acc-tufB.

rtb intercalaires positifs S+[modifier | modifier le wikicode]

rtb. Sx+ Sc+ Les diagrammes 400
rtb Sx+ Sc+
Poly3 -7 -5 -3 1 R2 flex x+ comment. -7 -5 -3 1 R2 flex c+ comment.
1 à 400 45 -332 590 12 496 246 max80 -36 279 -782 91 569 258 min50
31 à 400 70 -478 827 -4.5 788 228 2 parties
droite -a cste - R2 note R2’ -a cste - R2 note R2’
1 à 400 91 44 - 304 poly 191 tF 174 61 - 487 poly 82 Sm
31 à 400 -36 44 - 598 poly 190 tF
  • Légende du tableau corrélations et fréquences faibles
rtb. Sx+ Sc+ Les diagrammes 400. Corrélations et les fréquences faibles 1-30
effectifs diagramme corrélation x+ c+, 41-n corrélation x+ c+, 1-n
gen minima x+ c+ total 400 200 250 diff 200 250 400
bsu min10 1028 2444 3472 659 8 282 274 152 257 470
rtb min30 118 402 520 536 -105 148 253 -277 -165 202
afn min10 328 1323 1651 603 -26 101 127 -468 -407 -9
1-30 ‰ effectifs 0 ‰ <0 ‰ effectifs 1-40 corel
1-30 x+ 1-30 c+ x+/c+ x c x c x- c- x+ c+ x+/c+
140 333 0.42 1125 3091 2 8 31 186 302 936 -432
51 294 0.17 189 604 5 7 21 162 8 131 -81
46 402 0.11 350 1689 6 5 11 179 36 580 -369
  • Diagrammes 400:  rtb cvi,   diagramme 1-40: c+ rtb c+ cvi x+ cvi total,   texte: cvi.
  • Résumé: J’ai classé les 21 génomes suivant la forme des diagrammes x+ 1-400. J’ai obtenu 3 groupes,
    1. Les tildes au nombre de 5. Ils sont réguliers et forts, tF, avec un R2’ supérieur à 138 pour 4 d’entre eux et scc avec 71. Ce sont, cbei mba pmq et blo scc.
    2. Les formes S au nombre de 6. Leurs forces (R2’) sont variables, ade rru Sf 20-39, ant mja Sm 70-78, pmg pub SF 179-249.
    3. Les diagrammes à pyramide, c’est à dire présentant une bosse avec 4 ou 5 points contigus. Ils sont au nombre de 10 dont 9 sont des tildes et bsu est un Sf très faible (R2’18). abra rtb spl afn sont des tF avec plus de 96, ase cbn cvi sont des tf avec moins de 30, eco myr sont des tm 43 68.
    - rtb ressemble à cvi par la pyramide de x+ 1-400 avec un maximum à 80 pour rtb et 70 pour cvi et la forme de toutes les courbes ne diffèrent que par leur force. La différence entre les 2 génomes est due à la grande différence des effectifs, 520 pour rtb contre 3328 pour cvi, et des corrélations sur 41-250, de 148 pour rtb contre 891 pour cvi.
    - Les diagrammes 400
    • x+ 1-400:
      + Les 2 génomes ont une pyramide à 3 fréquences avec un maximum à 80 pour rtb et 70 pour cvi. Quand j’enlève les fréquences faibles pour ne laisser que la pyramide (6 pour rtb et 5 pour cvi), la courbe rtb devient une S faible, Sf, R2’ à 36 (662 625) et la courbe cvi devient une S moyenne, Sm, R2’ à 68 (794 726). Je n’ai pas représenté les courbes x+ 31-400 à cause des taux peu élevés des fréquences faibles 1-30, 51 pour rtb et 112 pour cvi.
      + Les fréquences faibles 1-30 sont en opposition avec celles des rtb c+1-400 et en parallèle avec cvi. Cette différence va impacter différemment les corrélations 1-n qu’on verra plus loin.
      + Les points d’inflexion sont normaux, 246 pour rtb contre 200 pour cvi.
    • c+ 1-400: Ce sont 2 courbes semblables de forme S, moyenne pour rtb avec un R2’ de 82 et forte pour cvi avec un R2’ de 203. Les 2 points d’inflexion normaux, 258 pour rtb et 282 pour cvi. Les fréquences faibles sont positionnées aux fréquences 10 et 20 pour les 2 génomes et les minima locaux sont identiques à la fréquence 50. La différence des effectifs, 402 pour rtb et 2320 pour cvi explique la différence de forme avec des R2 très différents, 569 pour rtb et 852 pour cvi
    • x+ 31-400: Je n’ai pas représenté les courbes x+ 31-400 à cause des taux peu élevés des fréquences faibles 1-30. Il faudrait les remplacer par les courbes avec pyramide seule sans les fréquences faibles 1-30, voir le paragraphe x+ 1-400 ci-dessus.
    • c+ 31-400: Les 2 formes sont 2 tildes très différents , tF pour rtb, avec un R2’ de 190 (788 598) et très faible pour cvi, tf, R2’ de 30 (525 808) plus proche d’une droite. La forme de rtb est bien différente de celle de cvi car les R2, polynome et droite, sont inversés dans le mauvais sens par rapport aux effectifs, 284 pour rtb et 1621 pour cvi. De même les points d’inflexion sont différents, il est normal pour rtb à la fréquence 228 et négatif pour cvi à -138.
    - Les corrélations:
    • Sur les plages 41-n: Les 2 corrélations sur 41-250 sont très dfiiérentes, 148 pour rtb contre 891 pour cvi.. Par contre rtb chute fortement sur 41-200, avec une différence de 253, alors que cvi se maintient avec une différence de 33.
    • Sur les plages 1-n: les 2 génomes chutent fortement, -165 pour rtb et 549 pour cvi, malgré le comportement des fréquences faibles que j’ai signalé au paragraphe x+ 1 -400, en opposition pour rtb et en parallèle avec cvi.
    - Les faibles fréquences: Les faibles fréquences 1-30 ne sont intéressantes à comparer que pour les génomes à courbes 1-400 semblables où le taux de ces fréquences sont élevés et évoluent en parallèle comme entre pmg et pub où le rapport x+/c+ passe de 0.78 à 0.51. rtb fait 0.17 et cvi 0.37 Les zéros sont à 7‰ pour cvi et 12‰ pour rtb et les négatifs sont 50% plus élevés chez cvi que chez rtb, 280 ‰ contre 183 ‰ pour rtb.
    - Les courbes 1-40:
    • c+ 1-40: La courbe cvi est semblale et très proche de celle du total des c+ 1-40; celle de rtb le devient aussi en omettant les fréquences 6 et 10.
    • x+ 1-40: Avec un effectif de 8 pour rtb la courbe ne peut être significative. Cvi avec 130 est différente du modèle c+ 1-40 avec un effectif aussi grand à la fréquence 6 et 9, un creux profond à la fréquence 11 et aussi à cause de la faible corrélation x+/c+ de 582.

rtb autres intercalaires[modifier | modifier le wikicode]

  • Lien tableur: rtb autres intercalaires aas
  • Légende:  
    - comp, le gène est sur le brin complement
    - deb, fin sont respectivement dans le sens des adresses croissantes, le cds avant le 1er tRNA et le cds après le dernier tRNA du bloc.
  • Totaux: 3 ncRNA 1 tmRNA
tRNA-cds		tRNA-tRNA		autres-cds		total
c+	x+	x-	c+	x+	c-	c+	x+	c-	
45	17		3	2		6	2		75
  • Méthode de calculs des intercalaires autres que les CDS-CDS voir le cas de amed.

Rickettsia prowazekii str. Breinl[modifier | modifier le wikicode]

rpl opérons[modifier | modifier le wikicode]

  • Lien tableur: rpl opérons
  • Liens: gtRNAdb [6], NCBI [7], génome [8]
  • Phylogénie: Bacteria; Proteobacteria; Alphaproteobacteria; Rickettsiales; Rickettsiaceae; Rickettsieae; Rickettsia; typhus group.
  • Légende: cdsa: cds aas, cdsd: cds dirigé
A7. Rickettsia prowazekii str. Breinl
29%GC 30.12.19 Paris  33   doubles intercal cds aa avec aa cdsa cdsd protéines
comp 31462..31892 cds 263 263 144 p-preprotein translocase subunit YajC
comp 32156..32181 rpr 870 870 26 tandem
comp 33052..33126 ggc 1253 1253
comp 34380..35750 cds 256 256 magnesium transporter
comp 36007..36093 ctc 190 190
comp 36284..37144 cds 287 TIGR01459 family HAD-type hydrolase
46825..47040 cds 31 31 72 hp
47072..47146 gca 1964 1964
49111..49650 cds 180 copper chaperone Pcu(A)C
comp 71150..76816 cds 933 933 1889 alpha-2-macroglobulin family protein
comp 77750..77826 cgt 1179 1179
79006..80241 cds 412 tyrosine--tRNA ligase
121704..121946 cds 984 984 81 HU family DNA-binding protein
comp 122931..123007 gtc 446 446
123454..124113 cds 220 (d)CMP kinase
126222..126827 cds 236 236 202 ATP-dependent Clp endopeptidase proteolytic subunit ClpP
127064..127139 gcc @1 830 830
comp 127970..128046 gac 365 365
128412..128843 cds 144 ribosome-associated translation inhibitor RaiA
171237..173012 cds 50 50 592 aminopeptidase P family protein
173063..173137 caa 49 49
comp 173187..173263 cgg 18 18
comp 173282..174265 cds 328 polyprenyl synthetase family protein
186344..187336 cds 58 58 331 tryptophan--tRNA ligase
187395..187484 tca 354 354
comp 187839..188738 cds 300 hydroxymethylbilane synthase
203097..203846 cds 219 219 250 bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase
204066..204153 tcc 1457 1457
205611..206639 cds 343 type 2 isopentenyl-diphosphate Delta-isomerase
comp 299321..300853 cds 419 419 511 hp
comp 301273..301349 atc 15 15
comp 301365..301440 aaa 219 219
301660..302400 cds 247 3-deoxy-manno-octulosonate cytidylyltransferase
comp 328700..329635 cds 22 22 312 site-specific tyrosine recombinase XerD
comp 329658..329732 tgc 499 499
330232..330699 cds 156 DUF2155 domain-containing protein
429121..429807 cds 723 723 229 hp
comp 430531..430605 aac 359 359
comp 430965..432767 cds 601 elongation factor 4
473867..474352 cds 928 928 162 RNA pyrophosphohydrolase
comp 475281..475357 atgj 40 40
comp 475398..475883 cds 162 30S ribosomal protein S9
506934..508007 cds 183 183 358 cell division protein ZapE
comp 508191..508305 5s 240 115
comp 508546..511330 23s 716 716 2785
comp 512047..512958 cds 304 methionyl-tRNA formyltransferase
577419..579725 cds 138 138 769 outer membrane protein assembly factor BamA
579864..579939 acg 1026 1179
comp 580966..581169 cds 68 DUF2674 domain-containing protein
comp 612439..612639 cds 143 143 67 preprotein translocase subunit SecE
comp 612783..612858 tgg 143 143
comp 613002..615101 cds 700 elongation factor G
comp 656226..656870 cds 296 296 215 YihA family ribosome biogenesis GTP-binding protein
comp 657167..657243 atgf 119 119
comp 657363..657599 cds 79 50S ribosomal protein L31
comp 678911..679213 cds 19 19 101 preprotein translocase subunit SecG
comp 679233..679307 acc 159 159
comp 679467..680723 cds 419 MFS transporter
comp 746326..746529 cds 1664 1664 68 hp
comp 748194..748268 gaa 109 109
comp 748378..749421 cds 348 autotransporter outer membrane beta-barrel domain-containing protein
comp 756703..757686 cds 363 363 328 tRNA dihydrouridine synthase DusB
758050..758125 ttc 564 564
758690..759730 cds 347 UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase
776202..776537 cds 154 154 112 30S ribosomal protein S16
776692..776766 aca 467 467
777234..777863 cds 210 lipoyl(octanoyl) transferase LipB
779197..780348 cds 140 140 384 succinyl-diaminopimelate desuccinylase
780489..780573 cta 37 37
780611..781075 cds 155 DNA polymerase III subunit chi
comp 823242..823559 cds 98 98 106 DUF167 domain-containing protein
823658..823734 aga 1364 1364
comp 825099..825230 cds 44 hp
comp 854241..854456 cds 17 17 72 translation initiation factor IF-1
comp 854474..854550 cca 1573 1573
comp 856124..856357 cds 78 BolA family transcriptional regulator
915034..915501 cds 391 391 156 peptidoglycan-associated lipoprotein Pal
915893..915969 atgi 41 41
916011..917099 cds 363 YjgP/YjgQ family permease
953564..954742 cds 696 696 393 acetyl-CoA C-acetyltransferase
comp 955439..955530 agc 898 898
comp 956429..957373 cds 315 ACP S-malonyltransferase
comp 1009435..1011165 cds 142 142 577 ATP-binding cassette domain-containing protein
comp 1011308..1011384 cac 346 346
1011731..1012414 cds 228 7-cyano-7-deazaguanine synthase QueC
comp 1045414..1045656 cds 2381 2381 81 hp
comp 1048038..1048123 tta 135 135
comp 1048259..1048387 cds 43 hp
comp 1056245..1056973 cds 188 188 243 23s rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
1057162..1057247 tac 105 105
1057353..1057426 gga 82 82
1057509..1058693 cds 395 elongation factor Tu
1072391..1072663 cds 62 62 91 30S ribosomal protein S20
1072726..1072801 gta 1181 1181
comp 1073983..1074648 cds 222 hp
1102136..1103935 cds 1458 1462 600 PAS domain-containing sensor histidine kinase
1105394..1106893 16s 1462 1462 1500
1108356..1109301,1..184 cds 377 P-hp

rpl cumuls[modifier | modifier le wikicode]

  • Lien tableur: rpl cumuls
  • Légende
  • Notes: moyenne et variance des intercalaires élevés des 21 cds : 1204 et 453
cumuls. rpl.
opérons Fréquences intercalaires tRNAs Fréquences intercalaires cds Fréquences aas cds chromosome
effectif gammes sans rRNAs avec rRNAs gammes cds gammes cdsd gammes cdsa gammes cdsa 300
avec rRNA opérons 2 1 - 1 0 1 100 12 30 0
23s5s 1 20 1 50 9 40 200 11 60 2
16s 1 40 100 4 80 300 12 90 9
16s23s 0 60 1 150 8 120 400 15 120 4
max a 0 80 200 5 160 500 2 150 2
a doubles 0 100 250 3 200 600 4 180 6
spéciaux 0 120 1 300 3 240 700 2 210 2
total aas 0 140 350 1 280 800 1 240 5
sans opérons 29 160 400 5 320 900 0 270 3
1 aa 25 180 450 2 360 1000 0 300 2
max a 2 200 500 2 400 1100 0 330 5
a doubles 0 1 21 1 20
total aas 33 4 0 63 0 60 60
total aas 33
remarques 1
avec jaune moyenne 528 293
variance 558 271
sans jaune moyenne 56 191 243 172
variance 45 140 145 89

rpl tRNA-cds[modifier | modifier le wikicode]

  • Note: intercalaires prélevés de la colonne cds de rpl opérons dans un bloc de tRNAs uniquement. Le début du bloc est dans l'ordre des adresses, deb intercalaire entre le cds et le 1er tRNA dd bloc, fin entre le dernier tRNA et le cds terminal. J'ai procédé, dans les colonnes petit et grand, à la réorientation des blocs d'après la constatation que les blocs à rRNA ont leurs cds de début et de fin sont orientés du cds-16s au 5s-tRNAs-cds, l'intercalaire cds-16s étant plus grands que l'intercalaire avec le cds terminal. En tête de colonne est le % du nombre des intercalaires inférieurs à 201 pbs.
rpl	50			36			18			68
deb	fin		deb	fin		grand	petit		grand	petit
17	1573		50	18		50	18		1573	17
19	159		140	37		140	37		50	18
22	499		928	40		143	143		159	19
31	1964		391	41		159	19		499	22
50	18		188	82		188	82		1964	31
58	354		1664	109		296	119		140	37
62	1181		296	119		346	142		928	40
98	1364		2381	135		354	58		391	41
138	1026		143	143		365	236		354	58
140	37		19	159		391	41		1181	62
142	346		419	219		419	219		188	82
143	143		142	346		467	154		1364	98
154	467		58	354		499	22		1664	109
188	82		723	359		564	363		296	119
219	1457		236	365		723	359		2381	135
236	365		984	446		898	696		1026	138
296	119		154	467		928	40		346	142
363	564		22	499		984	446		143	143
391	41		363	564		1026	138		467	154
419	219		696	898		1179	933		419	219
696	898		138	1026		1181	62		1457	219
723	359		933	1179		1253	870		365	236
870	1253		62	1181		1364	98		723	359
928	40		870	1253		1457	219		564	363
933	1179		98	1364		1573	17		984	446
984	446		219	1457		1664	109		898	696
1664	109		17	1573		1964	31		1253	870
2381	135		31	1964		2381	135		1179	933
  • Comparaison cds-cds tRNA-cds: deb fin, c'est l'ordre des adresses et grand petit l'ordre après réorientation. Leur pourcentage est calculé par rapport à la colonne, c'est à dire la moitié du total des tRNA-cds.
alpha	cds total	total	<0	0-200	201-370	371-600	>600	deb	fin	grand	petit
rpl	850		56		24	9	6	17	14	10	5	19
‰					429	161	107	304	500	357	179	679

rpl blocs[modifier | modifier le wikicode]

A7. rpl, blocs à rRNA.
cds 183 358 cell division protein ZapE
5s 240 115
23s 716 2785
cds 304 methionyl-tRNA formyltransferase
cds 1458 600 PAS domain-containing sensor histidine kinase
16s 1462 1500
cds 377 P-hp

rpl remarques[modifier | modifier le wikicode]

  • Remarques: Les rickettsia, rtb et rpl, présentent de nombreux intercalaires très élevés. D’où cet intercalaire entre 2 aas de 830 pbs. La phylogénie très forte entre ces 2 génomes donne des blocs analogues mais avec des intercalaires différents. Ici les intercalaires élevés sont atténués. Je détaille ici les intercalaires du tableau des cumuls.
    - Les intercalaires entre aas: Il y a quatre intercalaires de ce type, 830 105 49 15. A part le 1er les 3 autres sont courants dans cette étude et seulement le dernier est le représentant de la moyenne dans cette étude.
    - Les intercalaires avec un cds. Les 31 blocs de ce génomes se répartissent en 3 groupes
    1. Les RNAs complètement isolés, les 2 intercalaires du bloc sont supérieurs à 400 pbs. Il y a 7 aas dont celui avec 830, et le 16s. Ici aac, gac et ttc ont l’intercalaire mineur à peine inférieur à 400. Sur ces 16 intercalaires 9 sont supérieurs à 800 et 7 entre 360 et 700 pbs.
    2. Les tRNAs proches de leurs 2 cds. Il y a 6 aas dont les 2 intercalaires sont inférieurs à 300 pbs et 3 aas dont au moins un des 2 intercalaires est entre 300 et 400 pbs.
    3. Il reste 14 blocs dont le 23s5s, auxquels il faut ajouter l’aa gcc voisin du gac isolé par 830. Ces blocs sont très polarisés, leurs 2 intercalaires sont très dissymétriques.
      10 aas ont leur intercalaire majeur supérieur à 800 et va jusqu’à 2381 pbs. Le 23s5s a un intercalaire majeur modéré, 723, assez courant pour les blocs à rRNAs.
      3 aas ont leur intercalaire majeur de 450 pbs environ.
  • Les blocs isolés et les blocs entourés par 2 cds
	Blocs à RNAs isolés par 2 intercalaires de plus de 400 pbs.					
	bloc	adresse	intercalaire	Blocs entourés par 2 intercalaires de 300 à 400 pbs	
	aac	430531	723-359		cac	1011308
	gac	127064	830-365		atgi	915893
	gtc	122931			tca	187395
	cgt	77750				
	ggc	33052			Blocs entourés par 2 intercalaires inférieurs à 300 pbs	
	16s	1105394			atgf	657167
	agc	955439			acc	679233
	ttc	758050	564-363		tgg	612783
	:	:			cgg-caa	173063
	:	:			gga-tac	1057162
	:	:			cta	780489
  • Les séquences des doubles: Il n'y a aucun double dans ce génome

rpl distribution[modifier | modifier le wikicode]

Al2 rpl, Rickettsia prowazekii str. Breinl. alpha.
g1    t1       
atgi 1 tct tat atgf 1
att act aat agt
ctt cct cat cgc
gtt gct gat ggt
ttc 1 tcc 1 tac 1 tgc 1
atc 1 acc 1 aac 1 agc 1
ctc 1 ccc cac 1 cgt 1
gtc 1 gcc 1 gac 1 ggc 1
tta 1 tca 1 taa tga
ata aca 1 aaa 1 aga 1
cta 1 cca 1 caa 1 cga
gta 1 gca 1 gaa 1 gga 1
ttg tcg tag tgg 1
atgj 1 acg 1 aag agg
ctg ccg cag cgg 1
gtg gcg gag ggg
alpha >1aa =1aa -5s +5s -16s +16s total
rpl 8 25 33

rpl. Intergen51[modifier | modifier le wikicode]

Intergen51. rpl. Le génome[modifier | modifier le wikicode]

  • rpl Le prélèvement: Aalpha
  • Le nom et le lien NCBI: rpl, Rickettsia prowazekii str. Breinl, NCBI [9], date 20.01.22.
  • rpl La longueur totale des intercalaires, longueur du génome et taux intercalaires/génome:
Nom	intercals	génome		taux en %			
rpl	252,952		1,109,301	22.8
rpl données intercalaires[modifier | modifier le wikicode]
rpl données intercalaires 200[modifier | modifier le wikicode]
rpl autres intercalaires aas[modifier | modifier le wikicode]

Intergen51. rpl. Les différents types d'intercalaires[modifier | modifier le wikicode]

  • Lien au tableur: Intergen51. rpl les différents types d'intercalaires.
  • Légende:
    - S pour intercalaire CDS-CDS et R pour tRNA-CDS,
    - c pour intercalaire continu (les 2 gènes sont sur le même brin) et x pour discontinu (les 2 gènes sont sur 2 brins différents, le brin et son complément)
    - %reste = 100*reste/total, le reste étant ce qui reste du total après la fin du diagramme, gamme.
    - %t30 = 100*t30/total, t30 étant le total des fréquences 10 20 30
    - %t5 = 100*t/total, t5 étant le total des fréquences de -1 à -5 dans le diagramme des S-.
Int51.2 rpl les différents types d'intercalaires entre gène
Int51.21 Les différents types
intercalaires CDS-CDS * autres intercalaires
continu S+ S- S0 total c/x RNA-RNA CDS-rRNA total
c 522 103 5 630 3.4 3 3 6
x 183 5 0 188 2 1 3
t 705 108 5 818 5 4 9
% 86.2 13.2 0.6
Int51.22 Détail des * autres intercalaires
intercalaires tRNA-CDS récapitulatif des * autres intercalaires
continu R+ R- R0 total c/x * autres total %
c 39 0 0 39 2.1 tRNA-CDS 58 77
x 19 0 0 19 RNA-RNA 5 7
t 58 0 0 58 CDS-rRNA 4 5
% 100.0 0.0 0.0 non RNA 8 11
- total 75 100
Int51.23 Les taux remarquables
taux %reste %t30 %t5 %0
type S+ R+ S- S+ R+ S- S+ R+
gamme 400 400 6-50 - - - - -
type S+ R+ S- S+ R+ S- S+ R+
c 19.4 28.2 0.0 22.4 10.3 44 0.8 0.0
x 32.2 57.9 20.0 4.4 0.0 20 0.0 0.0

Intergen51. rpl. Les diagrammes CDS-CDS positifs[modifier | modifier le wikicode]

  • Lien tableur: Les diagrammes
  • Diagrammes des gamma:  rpl présente 2 diagrammes
    - fc40, CDS-CDS continu, fréquence unitaire en abscisses et effectif en ordonnées
    - fx%, CDS-CDS discontinu, fréquences regroupées par 10 (freq10) en abscisses et pourcentage en ‰ par rapport au total, en ordonnées.
  • Équations des courbes de tendance en pour 1000: colonnes %fx %fc
Courbes de tendances pour les diagrammes en pour 1000			Calculs des f.41	rpl
R2	x3		x2		x		c		Inflexion poly3	x	c
0.376	3.82E-06	-2.54E-03	4.15E-01	8.12	fx1	abscisse	221.3	229.1
0.589	-2.38E-06	1.88E-03	-5.50E-01	68.8	fc1	ordonnée	16.9	15.2
								
0.38	3.78E-06	-2.51E-03	4.07E-01	8.79	fx41			
0.822	5.82E-06	-4.00E-03	7.04E-01	5.99	fc41			
  • Moyennes glissantes fc+400, diagonale. Voir le détail des calculs dans abs.
données	rpl		calculs			poly3	rpl
effect	527		R2.21	608		abscis	400
xm	45		pte	0,04		flexa	224
ym	0,53		cste	1,01		flexo	1,53
x1m	178		r400l	222		xm	45
y1m	1		restp	345,35		sup4	263,9
rfin	193,55		%sd	73,90		sup4t	463,0
bornf	178		lond	133		%	57,0
supd	291,7		%sf	73,90		long	179
supdt	394,7		lonf	133			
xmp	259,96		sf/lf	2,19			
r400	151,80		sr/lr	0,00			
supf	291,7		sd/ld	2,19			
supft	394,7		i.r400	0,68								

Intergen51. rpl. Les CDS-CDS négatifs[modifier | modifier le wikicode]

Sous-totaux	rpl			totale	
fréquence	x-	c-		x-	c-
 - 1		0	10		4	4140
 - 2		1	0		85	11
 - 3		0	0		3	12
 - 4		0	35		717	10938
 - 5		0	0		5	19
sp6		4	58		1642	8424
total		5	103		2,456	23,544
reste		1	0		264	420
s6		0	0		361	41
s7		0	9		321	1438
s8		3	49		696	6525
rappot s1-5						
4/2/1		0.0	3.5		8.4	2.6
% / sp6						
s6/sp6		0.0	0.0		22.0	0.5
s7/sp6		0.0	15.5		19.5	17.1
s8/sp6		75.0	84.5		42.4	77.5
reste/sp6	25.0	0.0		16.1	5.0
						
total s1-5	1	45		814	15120
% / total						
%s1-5		20.0	43.7		33.1	64.2
%sp6		80.0	56.3		66.9	35.8

Intergen51. rpl. Les intercalaires des blocs[modifier | modifier le wikicode]

  • Le détail
RNA-RNA		c	x		CDS-RNA		c	x
23s 5s		1			CDS 16s		1	
16s 23s					5s CDS			1
16s tRNA				16 CDS		1	
tRNA 23s				CDS 5s			
5s tRNA					23s CDS			
tRNA in					CDS 23s		1	
tRNA contig				5s 16s			
tRNA hors	2	2		16s16s			
tRNA 16s								
23s tRNA								
tRNA 5s								
16s 5s								
5s 23s								
5s 5s								
total		3	2		total		3	1
  • Les rares voir gamma pour la longueur des intercalaires
  • Les tRNA-CDS compris, comparaison dans le clade et dans l'étude.

Intergen51. rpl. Les intercalaires tRNA-tRNA extra bloc[modifier | modifier le wikicode]

Rhodospirillum photometricum DSM 122[modifier | modifier le wikicode]

rpm opérons[modifier | modifier le wikicode]

  • Lien tableur: rpm opérons
  • Liens: gtRNAdb [10], NCBI [11], génome [12]
  • Phylogénie: Bacteria; Proteobacteria; Alphaproteobacteria; Rhodospirillales; Rhodospirillaceae; Pararhodospirillum.
  • Légende: cdsa: cds aas, cdsd: cds dirigé
A5. Rhodospirillum photometricum DSM 122
64.7%GC 26.12.19 Paris  95   doubles intercal cds aa avec aa cdsa cdsd protéines
comp 3322..4194 cds 30 30 291 LysM peptidoglycan-binding domain-containing protein
comp 4225..4821 23s° @1 196 595
comp 5018..5093 gca 182
comp 5276..5684 16s° 38 38 407
5723..6664 cds 314 SEL1-like repeat protein
comp < 12458..13198 cds 242 242 247 p-transposase
comp 13441..13555 5s @2 72 113
comp 13628..13880 23s° -7 -7 251
comp 13874..15127 cds 418 hp
21325..22362 cds 586 586 346 hp
22949..23237 16s° 85 85 287
comp 23323..23490 cds 56 hp
comp 24015..24287 cds 250 250 91 TraYdomain-containingprotein
comp 24538..24652 5s 71 113
comp 24724..27490 23s 212 2765
comp 27703..27779 atc 112
comp 27892..28378 16s° 18 18 485
<> 28397..29119 cds 241 p-EscV/YscV/HrcVfamilytypeIIIsecretionsystemexportapparatusprotein
comp 32782..33759 cds 190 190 326 glycosyltransferase
33950..34357 16s° 112 406
34470..34546 atc 216
34763..35591 23s° 44 827
comp 35636..35750 5s 72 113
comp 35823..38589 23s 215 2765
comp 38805..38881 atc 112
comp 38994..40502 16s 260 1507
comp 40763..42629 23s° -15 1865
42615..42903 16s° 112 287
43016..43092 atc 213
43306..44132 23s° -1 825
comp 44132..44835 23s° -5 -5 702
44831..45121 cds 97 hp
< 45496..45768 cds 553 553 91 p-glycosyl transferase family 1
46322..47040 16s° 0 0 717
comp 47041..47433 cds 131 winged helix-turn-helix domain-containing protein
comp 49761..51017 cds 128 128 419 glycosyltransferase
comp 51146..51221 23s° 214 74
comp 51436..51512 atc 112
comp 51625..52017 16s° -7 391
52011..52881 23s° 106 106 869
52988..53464 cds -37 -37 159 hp
> 53428..53694 cds 86 86 89 p-glycosyltransferase
comp 53781..54709 23s° 26 927
54736..54898 16s° 112 161
55011..55087 atc 216
55304..55741 23s° 438 438 436
56180..56440 cds 87 hp
comp 82891..83088 cds 116 116 66 preprotein translocase subunit SecE
comp 83205..83280 tgg 199 199
>comp 83480..84178 cds 233 p-elongation factor Tu
417242..417412 cds 142 142 57 tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase
417555..417631 atgj + 24 24
417656..417732 atgj 2 atgj 38 38
comp 417771..418796 cds 342 tRNA epoxyqueuosine(34) reductase QueG
434306..435142 cds 512 512 279 CDP-diacylglycerol--serine O-phosphatidyltransferase
435655..435842 16s° -6 186
435837..436075 23s° 72 237
436148..436262 5s 51 113
436314..436390 atgf 196 196
436587..436883 cds 99 hp
comp 467261..468370 cds 167 167 370 3-isopropylmalate dehydrogenase
468538..468667 23s° 72 128
468740..468854 5s 51 113
468906..468982 atgf 125 125
469108..469863 cds 252 SAM-dependent chlorinase/fluorinase
comp 534521..536161 cds 367 367 547 glucose-6-phosphate isomerase
536529..536603 acg 92 92
comp 536696..537778 cds 361 tyrosine-type recombinase/integrase
comp 658467..658931 cds 110 110 155 GNAT family N-acetyltransferase
comp 659042..659116 gtc 155 155
659272..660159 cds 106 106 296 N-formylglutamate amidohydrolase
660266..660340 gtc 648 648
comp 660989..661800 cds 271 p-N-formylglutamate amidohydrolase
comp 684188..685141 cds 323 323 318 cation transporter
comp 685465..685539 gtg + 25 25
comp 685565..685639 gtg 2 gtg 195 195
685835..686251 cds 139 NUDIX hydrolase
comp 691078..691773 cds 4 4 232 ComF family protein
691778..691897 23s° 72 118
691970..692084 5s 114 114 113
comp 692199..694505 cds 769 VWA domain-containing protein
750262..751398 cds 161 161 379 [FeFe] hydrogenase H-cluster radical SAM maturase HydE
comp 751560..751674 5s 72 113
comp 751747..752005 23s° 597 597 257
752603..752814 rpr @4 388 388 21 CRISPR
753203..753760 cds 186 hp
comp 839981..840214 cds 4 4 78 hp
comp 840219..840478 16s° 568 568 258
comp 841047..844388 cds 1114 response regulator
874585..875391 cds 88 88 269 phosphoadenylyl-sulfate reductase
875480..875556 cac 81 81
875638..876117 cds 160 CreA family protein
885688..886299 cds 176 176 204 LysE family translocator
886476..886552 ccc 144 144
comp 886697..887233 cds 179 helix-turn-helix transcriptional regulator
932708..934243 cds 93 93 512 Fic family protein
comp 934337..934413 cgt + 35 35
comp 934449..934525 cgt 3 cgt 44 44
comp 934570..934646 cgt 449 449
935096..936175 cds 360 hp
comp 978995..979396 cds 138 138 134 MFS transporter
comp 979535..979609 ggc + 23 23
comp 979633..979707 ggc 4 ggc 45 45
comp 979753..979827 ggc 29 29
comp 979857..979931 ggc 206 206
980138..981679 cds 514 murein biosynthesis integral membrane protein MurJ
997575..997898 cds 95 95 108 DUF1476 domain-containing protein
comp 997994..998067 cag + 54 54
comp 998122..998195 cag 2 cag 168 168
998364..999509 cds 382 Ppx/GppA family phosphatase
1050081..1051028 cds 60 60 316 NnrS family protein
comp 1051089..1051163 acc + 16 16
comp 1051180..1051254 acc 3 acc 18 18
comp 1051273..1051347 acc 170 170
comp 1051518..1053305 cds 596 EAL domain-containing protein
1197836..1199341 cds 197 197 502 aldehyde dehydrogenase
1199539..1199623 cta 126 126
1199750..1201090 cds 447 trigger factor
1206196..1206501 cds 93 93 102 HU family DNA-binding protein
1206595..1206670 gta 50 50
1206721..1207092 cds 124 hp
1213113..1214459 cds 210 210 449 acetyl-CoA carboxylase biotin carboxylase subunit
comp 1214670..1214874 16s° 600 600 203
comp 1215475..1216716 cds 414 polyphosphate kinase
comp 1349719..1350132 cds 109 109 138 NAD(P) transhydrogenase subunit alpha
comp 1350242..1350608 23s° 212 365
comp 1350821..1350897 atc 115
comp 1351013..1351438 16s° 23 23 424
< comp 1351462..1352160 cds 233 p-tetratricopeptide repeat protein
1359745..1360302 cds 176 176 186 hp
1360479..1360555 gac + 37 37
1360593..1360669 gac 2 gac 274 274
1360944..1361204 cds 87 hp
1416615..1417769 cds 214 214 385 glycosyltransferase family 61 protein
1417984..1418074 tcc 154 154
comp 1418229..1419095 cds 289 LysR family transcriptional regulator
comp 1472421..1473403 cds 250 250 328 biotin synthase BioB
comp 1473654..1473740 ttg 77 77
comp 1473818..1474678 cds 287 homocysteine S-methyltransferase family protein
comp 1735298..1736380 cds 209 209 361 DUF262 domain-containing protein
1736590..1736859 23s° 72 268
1736932..1737046 5s 52 113
1737099..1737175 atgf 93 93
comp 1737269..1737694 cds 142 type II toxin-antitoxin system VapC family toxin
comp 1812365..1813924 cds 894 894 520 peptidoglycan DD-metalloendopeptidase family protein
1814819..1815040 16s° -7 -7 222
<comp 1815034..1815837 cds 80 80 268 p-elongation factor Tu
comp 1815918..1815991 gga 34 34
comp 1816026..1816111 tac 144 144
1816256..1817143 cds 296 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
comp 1833109..1833603 cds 83 83 165 MBL fold metallo-hydrolase
comp 1833687..1833762 aag + 24 24
comp 1833787..1833862 aag 2 aag 198 198
comp 1834061..1835224 cds 388 rod shape-determining protein RodA
> 1941413..1943059 cds -30 -30 549 p-recombinase family protein
comp 1943030..1943121 agc 160 160
comp 1943282..1944133 cds 284 FAD-dependent thymidylate synthase
comp 2087696..2090938 cds 705 705 1081 PAS domain-containing protein
2091644..2091826 16s° 7 7 181
2091834..2092247 cds 138 hp
comp 2095044..2095490 cds 48 48 149 hp
comp 2095539..2095733 16s° 614 614 193
comp 2096348..2097337 cds 330 trypsin-like serine protease
comp 2113248..2114603 cds 219 219 452 hp
comp 2114823..2114899 aga 55 55
comp 2114955..2115251 cds 71 71 99 ETC complex I subunit
comp 2115323..2115399 cca 261 261
comp 2115661..2115960 cds 100 hp
comp 2144042..2146288 cds 308 308 749 HAMP domain-containing protein
2146597..2147256 23s° 72 658
2147329..2147443 5s 52 113
2147496..2147572 atgf 645 645
comp 2148218..2148664 cds 149 hp
2268003..2268461 cds 87 87 153 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
comp 2268549..2268625 ccg + 165 165
comp 2268791..2268867 ccg 2 ccg 56 56
comp 2268924..2269910 cds 329 farnesyltranstransferase
comp 2321621..2322145 cds 332 332 175 hp
2322478..2322554 ccc 225 225
2322780..2322974 cds 65 hp
comp 2393295..2396009 cds @3 1003 1003 905 CRISPR-associated helicase/endonuclease Cas3
2397013..2397919 16s° 2 2 905
2397922..2400888 cds 989 hp
comp 2517845..2520559 cds 229 229 905 phosphoenolpyruvate carboxylase
comp 2520789..2520903 5s 72 113
comp 2520976..2521339 23s° 189 189 362
comp 2521529..2522152 cds 208 3-isopropylmalate dehydratase small subunit
comp 2596508..2596738 cds 989 989 77 motility twitching protein PilT
comp 2597728..2597815 tca 194 194
2598010..2599204 cds 398 hp
comp 2621435..2622058 cds 106 106 208 helix-turn-helix transcriptional regulator
comp 2622165..2622251 ctc 202 202
2622454..2623107 cds 218 lipoyl(octanoyl) transferase LipB
2631201..2631554 cds 192 192 118 hp
2631747..2631822 gcc + 70 70
2631893..2631968 gcc 4 gcc 69 69
2632038..2632113 gcc 57 57
2632171..2632246 gcc 166 166
< 2632413..2632965 cds -41 -41 184 p-IS256 family transposase
2632925..2633473 cds 30 30 183 hp
comp 2633504..2633579 aca 93 93
comp 2633673..2634200 cds 271 271 176 N-acetyltransferase
comp 2634472..2634561 tcg 155 155
2634717..2635742 cds 342 hp
comp 2655872..2656489 cds 182 182 206 YitT family protein
comp 2656672..2656747 gag 141 141
comp 2656889..2657674 cds 262 MetQ/NlpA family ABC transporter substrate-binding protein
2758160..2758312 cds 110 110 51 light-harvesting protein
comp 2758423..2758509 tta 94 94
comp 2758604..2759899 cds 432 bifunctional folylpolyglutamate synthase/dihydrofolate synthase
> 2768823..2769518 cds -12 -12 232 methyltransferase
2769507..2769776 23s° 71 268
2769848..2769962 5s 118 118 113
comp 2770081..2771016 cds 312 tetratricopeptide repeat protein
2792922..2794778 cds 129 129 619 glutathione-regulated potassium-efflux system protein KefB
2794908..2794982 caa 92 92
comp 2795075..2795686 cds 204 hp
2862755..2862982 cds 123 123 76 hp
2863106..2863182 cca 117 117
2863300..2863374 atgi 373 373
2863748..2863823 gca 157 157
2863981..2864056 aca 15
2864072..2864317 cds 8 82 DUF2829 domain-containing protein
2864326..2864401 aaa 250 250
> 2864652..2865041 cds 130 p-hp
2867066..2868112 cds 76 76 349 tyrosine-type recombinase/integrase
comp 2868189..2868264 aaa 99 99
comp 2868364..2868870 cds 169 peptidylprolyl isomerase
2893891..2894430 cds 25 25 180 phage portal protein
2894456..2894570 5s 51 113
2894622..2894698 atgf 285 285
2894984..2895400 cds 139 p-hp
comp 3034652..3035092 cds 250 250 147 hp
comp 3035343..3035418 aaa 8 8
comp 3035427..3035986 cds 187 DUF2829 domain-containing protein
comp 3305068..3306534 cds 379 379 489 S8 family serine peptidase
comp 3306914..3306989 ttc + 29 29
comp 3307019..3307094 ttc 4 ttc 34 34
comp 3307129..3307204 ttc 33 33
comp 3307238..3307313 ttc 60 60
comp 3307374..3308864 cds 497 RimK family protein
comp 3332977..3334356 cds 54 54 460 type II secretion system protein
3334411..3334487 cgg 176 176
< comp 3334664..3335983 cds 440 p-hp
3408217..3409026 cds 91 91 270 hp
comp 3409118..3409232 5s 71 113
comp 3409304..3409410 23s° 1 1 105
< 3409412..3409711 cds 100 p-IS5/IS1182 family transposase
comp 3456276..3461666 cds 387 387 1797 alpha-2-macroglobulin family protein
3462054..3462130 agg 29 29
3462160..3462951 cds 264 amino acid ABC transporter substrate-binding protein
comp 3500025..3500675 cds 210 210 217 protein-L-isoaspartate O-methyltransferase
3500886..3500959 tgc + 27 27
3500987..3501061 aac 2 aac 31 31
3501093..3501167 aac 84 84
comp 3501252..3501659 cds 136 hp
3639978..3641276 cds 172 172 433 outer membrane efflux protein
3641449..3641525 gcg + 70 70
3641596..3641671 gcg 3 gcg 33 33
3641705..3641780 gcg 389 389
3642170..3644392 cds 741 sigma-54-dependent Fis family transcriptional regulator
3651524..3652711 cds 55 55 396 aminotransferase
3652767..3652843 cac 202 202
<comp 3653046..3653543 cds 166 arsenical-resistance protein
3710072..3710840 cds 126 126 256 TonB family protein
comp 3710967..3711042 gaa + 214 214
comp 3711257..3711332 gaa 2 gaa 125 125
comp 3711458..3711664 cds 69 cold-shock protein
comp 3727874..3729085 cds 828 828 404 hp
3729914..3730068 16s° 87 87 153
3730156..3730545 cds 130 hp
comp 3804728..3805231 cds 118 118 168 response regulator
comp 3805350..3805425 gag 241 241
comp 3805667..3806140 cds 158 transcription elongation factor GreA
3813820..3815895 cds 138 138 692 RNA polymerase sigma factor RpoD
3816034..3816109 atgi 94 94
3816204..3818993 cds 930 diguanylate cyclase
comp 3827982..3828878 cds 90 90 299 phosphoserine phosphatase SerB
comp 3828969..3829042 ggg @5 292 292
3829335..3830670 cds 445 chemotaxis protein
comp 3832305..3833264 cds 311 311 320 complex I NDUFA9 subunit family protein
3833576..3833662 ctg + 47 47
3833710..3833796 ctg 5 ctg 153 153
3833950..3834036 ctg 48 48
3834085..3834171 ctg 47 47
3834219..3834305 ctg 113 113
3834419..3835039 cds 207 ribonuclease D

rpm cumuls[modifier | modifier le wikicode]

cumuls. rpm.
opérons Fréquences intercalaires tRNAs Fréquences intercalaires cds Fréquences aas cds chromosome
effectif gammes sans rRNAs avec rRNAs gammes cds gammes cdsd gammes cdsa gammes cdsa 300
avec rRNA opérons 27 1 0 1 9 1 100 20 1 0
16s°atc23s° 7 20 2 50 15 40 200 35 30 0
16s°gca23s° 1 40 14 100 30 80 300 30 60 3
16s°23s° 1 60 7 150 24 120 400 23 90 10
max a 1 80 3 200 23 160 500 14 120 10
a doubles 0 100 0 250 16 200 600 7 150 14
spéciaux 18 120 1 300 5 240 700 2 180 13
total aas 13 140 0 350 4 280 800 3 210 11
sans opérons 47 160 2 400 5 320 900 0 240 6
1 aa 30 180 1 450 2 360 1000 4 270 9
max a 5 200 0 500 0 400 1100 1 300 9
a doubles 15 2 14 2 56
total aas 79 32 0 147 0 141 141
total aas 92
remarques 5
avec jaune moyenne 69 194 310
variance 75 197 248
sans jaune moyenne 39 147 252 170
variance 16 112 134 71

rpm tRNA-cds[modifier | modifier le wikicode]

  • Note: intercalaires prélevés de la colonne cds de rpm opérons dans un bloc de tRNAs uniquement. Le début du bloc est dans l'ordre des adresses, deb intercalaire entre le cds et le 1er tRNA dd bloc, fin entre le dernier tRNA et le cds terminal. J'ai procédé, dans les colonnes petit et grand, à la réorientation des blocs d'après la constatation que les blocs à rRNA ont leurs cds de début et de fin sont orientés du cds-16s au 5s-tRNAs-cds, l'intercalaire cds-16s étant plus grands que l'intercalaire avec le cds terminal. En tête de colonne est le % du nombre des intercalaires inférieurs à 201 pbs.
rpm	71			73			47			98
deb	fin		deb	fin		grand	petit		grand	petit
-30	160		250	8		87	56		160	-30
30	93		387	29		88	81		250	8
54	176		142	38		93	50		387	29
55	202		93	50		93	30		93	30
60	170		219	55		99	76		142	38
71	261		87	56		110	94		93	50
76	99		379	60		126	125		176	54
83	198		250	77		129	92		202	55
87	56		88	81		138	94		219	55
88	81		210	84		142	38		87	56
90	292		129	92		155	110		170	60
93	449		367	92		160	-30		379	60
93	50		30	93		168	95		261	71
95	168		110	94		170	60		99	76
106	648		138	94		176	144		250	77
106	202		76	99		176	54		88	81
110	155		311	113		182	141		198	83
110	94		126	125		192	166		210	84
116	199		197	126		197	126		292	90
118	241		182	141		198	83		129	92
123	250		176	144		199	116		367	92
126	125		214	154		202	55		449	93
129	92		110	155		202	106		110	94
138	206		271	155		206	138		138	94
138	94		-30	160		210	84		168	95
142	38		192	166		214	154		202	106
172	389		95	168		219	55		648	106
176	144		60	170		241	118		155	110
176	274		54	176		250	8		311	113
182	141		989	194		250	77		199	116
192	166		323	195		250	123		241	118
197	126		83	198		261	71		250	123
210	84		116	199		271	155		126	125
214	154		55	202		274	176		197	126
219	55		106	202		292	90		206	138
250	77		138	206		311	113		182	141
250	8		332	225		323	195		176	144
271	155		118	241		332	225		214	154
311	113		123	250		367	92		271	155
323	195		71	261		379	60		192	166
332	225		176	274		387	29		389	172
367	92		90	292		389	172		274	176
379	60		172	389		449	93		989	194
387	29		93	449		648	106		323	195
989	194		106	648		989	194		332	225
  • Comparaison cds-cds tRNA-cds: deb fin, c'est l'ordre des adresses et grand petit l'ordre après réorientation. Leur pourcentage est calculé par rapport à la colonne, c'est à dire la moitié du total des tRNA-cds.
alpha	cds total	total	<0	0-200	201-370	371-600	>600	deb	fin	grand	petit
rpm	3,484		90	1	64	19	4	2	31	33	21	43
rpm ‰				11	711	211	44	22	689	733	467	956

rpm blocs[modifier | modifier le wikicode]

rpm blocs protéines[modifier | modifier le wikicode]

  • Lien tableur: rpm blocs protéines
  • Note:
    - hp pour hypothetical protein
    - p- pour pseudo, par exemple p-elon en abrégé donne p-elongation factor Tu.
A5p. rpm, protéines.
abrégé nom
23s 23s rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
3-isop 3-isopropylmalate dehydrogenase
3-isop-sub 3-isopropylmalate dehydratase small subunit
acetyl acetyl-CoA carboxylase biotin carboxylase subunit
cas3 CRISPR-associated helicase/endonuclease Cas3
CDP CDP-diacylglycerol--serine O-phosphatidyltransferase
ComF ComF family protein
CRISPR CRISPR
DUF262 DUF262 domain-containing protein
FeFe [FeFe] hydrogenase H-cluster radical SAM maturase HydE
glyco glycosyltransferase
HAMP HAMP domain-containing protein
LysM LysM peptidoglycan-binding domain-containing protein
methyl methyltransferase
NAD NAD(P) transhydrogenase subunit alpha
p-elon p-elongation factor Tu
p-EscV p-EscV/YscV/HrcVfamilytypeIIIsecretionsystemexportapparatusprotein
p-glyco p-glycosyltransferase
P-glyco1 p-glycosyl transferase family 1
p-IS5 p-IS5/IS1182 family transposase
p-tetra p-tetratricopeptide repeat protein
p-trans p-transposase
PAS PAS domain-containing protein
peptido peptidoglycan DD-metalloendopeptidase family protein
phage phage portal protein
phospho phosphoenolpyruvate carboxylase
polypho polyphosphate kinase
respons response regulator
SAM SAM-dependent chlorinase/fluorinase
SEL1 SEL1-like repeat protein
tetra tetratricopeptide repeat protein
TraY TraY domain-containing protein
trypsin trypsin-like serine protease
type II type II toxin-antitoxin system VapC family toxin
VWA VWA domain-containing protein
winged winged helix-turn-helix domain-containing protein

rpm blocs construits[modifier | modifier le wikicode]

  • Lien tableur: rpm blocs construits
  • Légende: lien au tableau des protéines, abrégés
    - vert: la taille des rRNAs en pbs alors que les protéines (cdsa) sont en aas.
    - bleu: protéines bien caractérisées alors qu'en clair sont les protéines candidates à la création, hp pour hypothetical protein, p-protéine pour pseudo-protéine et les protéines caractérisées seulement par un domaine comme DUF262 par exemple.
    - cyan: Les intercalaires constantes vestiges des blocs complets représentés par l'unique bloc contenant le 16s avec les intercalaires 71 pour 5s-23s, 212 pour 23s-atc, 112 pour atc-16s et 52 dans le cas de 5s-atgf.
    - gris: Je ne considère ici que les protéines créées à l'intérieur d'un bloc rRNA. Les protéines non canditates à la création sont en bleu, voir ci-dessus le bleu, mais la reconstruction des blocs détruits m'a obligé à considérer des protéines internes au bloc, bien caractérisées non candiates à la création. Aussi je n'ai conservé que les plus petites, metyl adresse 2768823, 3-isop-sub adresse 2521529 et glyco adresse 49761. La reconstruction ne m'a pas permis de faire de grands blocs pour 4 clusters listés à la fin des 2 derniers tableaux en gris. Ces clusters sont restés parce qu'ils mettraient des protéines non candidates en intra bloc avec de grande taille.
  • Notes: Il faut noter que théoriquement, pour cet organisme où la destruction des blocs est spéctaculaire, les protéines créées pourraient être aussi grande que le 23s en paires de base, 2765 soit 900 aas à peu près. C'est ce que j'ai suggéré en plaçant le 16s° contenant 1 grosse protéine candidate pour la création parce qu'elle est hypothétique dans le reconstruction du bloc b10, cas3-16s°-hp, 905-16s°-989. La même situation est reproduite dans le bloc b9 avec PAS-16s°-hp, 1081-16s°-138.
    • @ Les blocs à rRNAs: texte de rpm remarques, remarque @3.
      - Les clusters de rpm tels qu’ils apparaissent dans la séquence des adresses sont présentés au chapitre rpm blocs construits, tableaux A5b1 et A5b2.
      + A5b1 rassemble 9 16s° solitaires suivis de longs clusters où on peut repérer les blocs d’origine altérés caractérisés par les intercalaires 16s-atc-23s, respectivement de 112 pbs et 216 pbs. Ainsi je suppose qu’il y a 5 blocs d’origine de type 16s-atc-23s-5s et un,isolé, de type 16s-gca-23s-5s. Dans ces grands clusters seul subsiste un seul 5s appartenant au bloc complet et intègre que j’ai nommé b0.
      + A5b2 rassemble 9 23s°5s solitaires et 3 blocs complets et un 5s solitaire. Les 23s°5s sont mis en face des 16s° du tableau A5b1. Les blocs complets contiennent un représentant de 16s, un de 23s et un 5s. Dans cette partie du tableau A5b2 j’ai ajouté le bloc b0 séparé de son cluster pour comparaison. Le bloc analogue au b0 est le bloc b1 qui est isolé et où seul le 16s est altéré. Le bloc b3 de cette partie du tableau apparaît comme un racollage d’un 16s° solitaire et d’un 23s°5s solitaire puisque l’intercalaire 16s°-23s° est négatif, c’est-à-dire qu’il y a recouvrement des 2 morceaux, ce qui ne serait pas le cas s’il y avait une délétion entre le 16s et le 23s d’origine.
      - Le parallélisme et l'égalité en nombres entre les 16s° et les 23s°5s solitaires, ainsi que l'analyse des intercalaires petits et négatifs de la remarque @2 m’ont poussé à reconstruire les blocs d’origines en rapprochant des 16s° solitaires à d’autres 16s° solitaires ou non tous 2 avec leurs cds, selon l’hypothèse que les 2 cds internes résultant font partie de l’altération ou de la délétion du 16s original et du coup ces cds seraient des candidats à la création de gènes nouveaux. Le même procédé et la même hypothèse sont appliqués pour un 23° et un 23s°5s.
      - Cette reconstruction se trouve dans les tableaux A5b3 et A5b4. Ainsi en optimisant les tailles des 16s et 23s reconstruits pour se rapprocher le plus aux tailles de ces rRNAs du bloc intègre b0, j’ai pu construire 11 blocs. J’ai séparé le 16s° du 23s°5s du bloc b3 du tableau A5b2. Il reste cependant un 16s°, un 23s° et un 5s-atgf que je n’ai pas pu réunir car leurs cds sont tous bien caractérisés et ne répondent aux critères des candidats à la création. L’hypothèse de 11 blocs ou 12 blocs à l’origine est tout à fait probable en comparaison des 9 blocs de abq.
      - Je n'ai pas pu faire une reconstruction analogue avec abs malgré la proximité phylogénique de abq car la complémentarité 16s° et 23s°5s n’existe pas comme si l’altération faisait disparaître une partie du rRNA, ceux qui restent indiquant la position des originaux. Cela indiquerait que ce sont 2 processus d’altération différents certainement reliés à la présence des tRNAs intra bloc, atc pour rpm et atc-gca pour abs.
      - Le génome analogue avec que des atc Tistrella mobilis KA081020-065, voir proteobacteria et Tistrella mobilis KA081020-065 [[13]]
A5b. rpm blocs et leur réorganisation.
A5b1. 9 blocs 16s° solitaires, 6 blocs atc gca
sens adresse bloc interca cdsa protéine rRNA° ordre
21325..22362 cds 586 346 hp 1493
22949..23237 16s° 85 287
comp 23323..23490 cds 56 hp b3
abrégés
< 45496..45768 cds 553 91 p-glyco1 1383
46322..47040 16s° 0 717
comp 47041..47433 cds 131 winged b4
abrégés
comp 839981..840214 cds 4 78 hp 492
comp 840219..840478 16s° 568 258
comp 841047..844388 cds 1114 respons b7
abrégés
1213113..1214459 cds 210 449 acetyl 1445
comp 1214670..1214874 16s° 600 203
comp 1215475..1216716 cds 414 polypho
abrégés
comp 1812365..1813924 cds 894 520 peptido 1026
1814819..1815040 16s° -7 222
<comp 1815034..1815837 cds 268 p-elon b5
abrégés
comp 2087696..2090938 cds 705 1081 PAS 595
2091644..2091826 16s° 7 181
2091834..2092247 cds 138 hp b9
abrégés
comp 2095044..2095490 cds 48 149 hp 640
comp 2095539..2095733 16s° 614 193
comp 2096348..2097337 cds 330 trypsin b8
abrégés
comp 2393295..2396009 cds 1003 905 cas3
2397013..2397919 16s° 2 905 905
2397922..2400888 cds 989 hp b10
abrégés
comp 3727874..3729085 cds 828 404 hp 1755
3729914..3730068 16s° 87 153
3730156..3730545 cds 130 hp b2
abrégés
434306..435142 cds 512 279 CDP
435655..435842 16s° -6 186 1023
abrégés
comp 3322..4194 cds 30 291 LysM
comp 4225..4821 23s° 196 595 1468
comp 5018..5093 gca 182
comp 5276..5684 16s° 38 407
5723..6664 cds 314 SEL1 b6
abrégés
comp 32782..33759 cds 190 326 glyco
33950..34357 16s° 112 406
34470..34546 atc 216
34763..35591 23s° 44 827 827 b7
comp 35636..35750 5s 72 113
comp 35823..38589 23s 215 2765
comp 38805..38881 atc 112
comp 38994..40502 16s 260 1507 b0
comp 40763..42629 23s° -15 1865 1865 b4
42615..42903 16s° 112 287
43016..43092 atc 213
43306..44132 23s° -1 825 825 b8
comp 44132..44835 23s° -5 702 993
44831..45121 cds 97 hp b5
abrégés
comp 49761..51017 cds 128 419 glyco 1331
comp 51146..51221 23s° 214 74
comp 51436..51512 atc 112
comp 51625..52017 16s° -7 391 b9
52011..52881 23s° 106 869 1346
52988..53464 cds -37 159 hp
> 53428..53694 cds 86 89 p-glyco
comp 53781..54709 23s° 26 927 1194 b3
54736..54898 16s° 112 161
55011..55087 atc 216 697
55304..55741 23s° 438 436
56180..56440 cds 87 hp b10
A5b2. 9 blocs 23s°5s, 3 blocs complets
sens adresse bloc interca cdsa protéine rRNA° ordre
comp 13874..15127 cds -7 418 hp 1505
comp 13628..13880 23s° 72 251
comp 13441..13555 5s 242 113
comp < 12458..13198 cds 247 p-trans b5
abrégés
comp 691078..691773 cds 4 232 ComF 814
691778..691897 23s° 72 118
691970..692084 5s 114 113
comp 692199..694505 cds 769 VWA b9
abrégés
753203..753760 cds 388 186 hp 1028
752603..752814 rpr 597 71 CRISPR
comp 751747..752005 23s° 72 257
comp 751560..751674 5s 161 113
750262..751398 cds 379 FeFe b8
abrégés
comp 2521529..2522152 cds 189 208 3-isop-sub 986
comp 2520976..2521339 23s° 72 362
comp 2520789..2520903 5s 229 113
comp 2517845..2520559 cds 905 phospho b7
abrégés
> 2768823..2769518 cds -12 232 methyl 964
2769507..2769776 23s° 71 268
2769848..2769962 5s 118 113
comp 2770081..2771016 cds 312 tetra b6
abrégés
< 3409412..3409711 cds 1 100 p-IS5 405
comp 3409304..3409410 23s° 71 105
comp 3409118..3409232 5s 91 113
3408217..3409026 cds 270 hp b4
abrégés
comp 467261..468370 cds 167 370 3-isop 1238
468538..468667 23s° 72 128
468740..468854 5s 51 113
468906..468982 atgf 125
469108..469863 cds 252 SAM
abrégés
comp 1735298..1736380 cds 209 361 DUF262 1351
1736590..1736859 23s° 72 268
1736932..1737046 5s 52 113
1737099..1737175 atgf 93
comp 1737269..1737694 cds 142 type II b10
abrégés
comp 2144042..2146288 cds 308 749 HAMP 2905
2146597..2147256 23s° 72 658
2147329..2147443 5s 52 113
2147496..2147572 atgf 645
comp 2148218..2148664 cds 149 hp b2
abrégés
comp 24015..24287 cds 250 91 TraY
comp 24538..24652 5s 71 113
comp 24724..27490 23s 212 2765
comp 27703..27779 atc 112
comp 27892..28378 16s° 18 485
<> 28397..29119 cds 241 p-EscV b1
abrégés
comp 35636..35750 5s 72 113
comp 35823..38589 23s 215 2765
comp 38805..38881 atc 112
comp 38994..40502 16s 260 1507 b0
abrégés
434306..435142 cds 512 279 CDP
435655..435842 16s° -6 186 1023
435837..436075 23s° 72 237
436148..436262 5s 51 113 237
436314..436390 atgf 196
436587..436883 cds 99 hp b3
abrégés
2893891..2894430 cds 25 180 phage
2894456..2894570 5s 51 113 540
2894622..2894698 atgf 285
2894984..2895400 cds 139 p-hp
A5b3. Fait: 4 blocs sans aas
sens adresse bloc interca cdsa protéine rRNA° ordre
comp 35636..35750 5s 72 113 b0
comp 35823..38589 23s 215 2765 2765
comp 38805..38881 atc 112
comp 38994..40502 16s 260 1507 1507
abrégés
comp 24015..24287 cds 250 91 TraY b1
comp 24538..24652 5s 71 113
comp 24724..27490 23s 212 2765 2765
comp 27703..27779 atc 112
comp 27892..28378 16s° 18 485 1208
<> 28397..29119 cds 241 p-EscV
abrégés
comp 3727874..3729085 cds 828 404 hp 1755 b2
3729914..3730068 16s° 87 153 1365
3730156..3730545 cds 130 hp
comp 2144042..2146288 cds 308 749 HAMP
2146597..2147256 23s° 72 658
2147329..2147443 5s 52 113
2147496..2147572 atgf 645
comp 2148218..2148664 cds 149 hp 2905
abrégés
21325..22362 cds 586 346 hp 1493 b3
22949..23237 16s° 85 287 1325
comp 23323..23490 cds 56 hp
52011..52881 23s° 106 869 1346
52988..53464 cds -37 159 hp
> 53428..53694 cds 86 89 p-glyco
comp 53781..54709 23s° 26 927 1194
435837..436075 23s° 72 237 237
436148..436262 5s 51 113
436314..436390 atgf 196
436587..436883 cds 99 hp 2777
abrégés
< 45496..45768 cds 553 91 p-glyco1 1383 b4
46322..47040 16s° 0 717
comp 47041..47433 cds 131 winged
comp 40763..42629 23s° -15 1865 1865
< 3409412..3409711 cds 1 100 p-IS5
comp 3409304..3409410 23s° 71 105 405
comp 3409118..3409232 5s 91 113
3408217..3409026 cds 270 hp 2270
abrégés
comp 1812365..1813924 cds 894 520 peptido b5
1814819..1815040 16s° -7 222 1026
<comp 1815034..1815837 cds 268 p-elon
comp 44132..44835 23s° -5 702 993
44831..45121 cds 97 hp
comp 13874..15127 cds -7 418 hp 1505
comp 13628..13880 23s° 72 251
comp 13441..13555 5s 242 113
comp < 12458..13198 cds 247 p-trans 2498
abrégés
2893891..2894430 cds 25 180 phage
2894456..2894570 5s 51 113 540
2894622..2894698 atgf 285
2894984..2895400 cds 139 p-hp
abrégés
1213113..1214459 cds 210 449 acetyl 1445
comp 1214670..1214874 16s° 600 203
comp 1215475..1216716 cds 414 polypho
abrégés
comp 467261..468370 cds 167 370 3-isop 1238
468538..468667 23s° 72 128
468740..468854 5s 51 113
468906..468982 atgf 125
469108..469863 cds 252 SAM
A5b4. Fait: 5 blocs atc, gca
sens adresse bloc interca cdsa protéine rRNA° ordre
5723..6664 cds 314 SEL1 1349 b6
comp 5276..5684 16s° 38 407
comp 5018..5093 gca 182
comp 4225..4821 23s° 196 595
comp 3322..4194 cds 30 291 LysM 1468
> 2768823..2769518 cds -12 232 methyl 964
2769507..2769776 23s° 71 268
2769848..2769962 5s 118 113
comp 2770081..2771016 cds 312 tetra 2432
abrégés
comp 841047..844388 cds 1114 respons 898 b7
comp 840219..840478 16s° 568 258 492
comp 839981..840214 cds 4 78 hp
comp 32782..33759 cds 190 326 glyco
33950..34357 16s° 112 406 406
34470..34546 atc 216
34763..35591 23s° 44 827 827
comp 2521529..2522152 cds 189 208 3-isop-sub 986
comp 2520976..2521339 23s° 72 362
comp 2520789..2520903 5s 229 113 1238
comp 2517845..2520559 cds 905 phospho 1813
abrégés
comp 2096348..2097337 cds 330 trypsin 927 b8
comp 2095539..2095733 16s° 614 193 640
comp 2095044..2095490 cds 48 149 hp
42615..42903 16s° 112 287 287
43016..43092 atc 213
43306..44132 23s° -1 825 825
753203..753760 cds 388 186 hp
752603..752814 rpr 597 71 CRISPR 1028
comp 751747..752005 23s° 72 257
comp 751560..751674 5s 161 113
750262..751398 cds 379 FeFe 1853
abrégés
comp 2087696..2090938 cds 705 1081 PAS 986 b9
2091644..2091826 16s° 7 181 595
2091834..2092247 cds 138 hp
comp 51625..52017 16s° -7 391 391
comp 51436..51512 atc 112
comp 51146..51221 23s° 214 74
comp 49761..51017 cds 128 419 glyco 1331
comp 691078..691773 cds 4 232 ComF
691778..691897 23s° 72 118 814
691970..692084 5s 114 113
comp 692199..694505 cds 769 VWA 2145
abrégés
comp 2393295..2396009 cds 1003 905 cas3 1066 b10
2397013..2397919 16s° 2 905 905
2397922..2400888 cds 989 hp
54736..54898 16s° 112 161 161
55011..55087 atc 216
55304..55741 23s° 438 436
56180..56440 cds 87 hp 697
comp 1735298..1736380 cds 209 361 DUF262 1351
1736590..1736859 23s° 72 268
1736932..1737046 5s 52 113
1737099..1737175 atgf 93
comp 1737269..1737694 cds 142 type II 2048
abrégés
434306..435142 cds 512 279 CDP
435655..435842 16s° -6 186 1023
435837..436075 23s° 72 237
436148..436262 5s 51 113 237
436314..436390 atgf 196
436587..436883 cds 99 hp

rpm remarques[modifier | modifier le wikicode]

rpm remarques texte[modifier | modifier le wikicode]

  • Remarques:
    1. @ Il y a 7 atc dans 7 blocs à rRNAs courts ou longs et il n’y a qu’un seul gca de ce type. Il y a un 2ème gca mais dans un bloc sans rRNAs. C’est un génome à 16satc23s5s comme Tistrella mobilis KA081020-065 [[14]]. Voir fiche alpha.
    2. @ Il y a 12 blocs à rRNAs courts ou complets et tous ont un intercalaire 23s-5s ou 23s°-5s de 72 ou 71. Les intercalaires avec cds et entre aas
      - Les intercalaires élevés: Ils sont peu nombreux et modérés.
      + Les cds avec les blocs à rRNAs sont en général élevés jusqu’à 600 pbs. Sur les 13 de rpm seulement 4 dépassent 700, 705 828 894 1003.
      + Il y a 3 intercalaires avec les tRNAs supérieurs à 400, 489 648 989. Le génome rpm n’échappe donc pas au comportement des alpha.Voir le tableau des spectres des intercalaires avec les cds. Bien que rpm présente un maximum élevé il affiche un minimum de 3 intercalaires avec les tRNAs, élevés, supérieurs à 400 contre un maximum de 24 pour rpl.
      - Les intercalaires négatifs et petits, voir le tableau des spectres et la liste de ces intercalaires.
      + Dans le tableau des spectres des intercalaires, rpm et aon sont les seuls à présenter une proportion significative de ces intercalaires négatifs avec 6% alors que les 7 autres alpha n’en présentent aucun.
      + Dans la liste de rpm sur 24 intercalaires inférieurs à 51, 7 sont négatifs un nul et un égale à l’unité. Six autres ont des intercalaires positifs inférieurs à 9. Cette liste laisse penser que ce comportement est très lié à l’altération des blocs à rRNAs. Puisque, 16 de ces intercalaires concernent les rRNAs altérés de même que les intercalaires élevés, supérieurs à 400, concernent 12 de ces RNAs.
      + C'est comme si l'altération des blocs à rRNAs se faisait à l'intérieur du bloc et épargnait son extérieur. D'où cette hypothèse que les cds à intercalaires petits ou négatifs collés aux rRNAs altérés seraient des candidats à la création de gènes, petits, hypothétiques et/ou pseudo.
      + Ces intercalaires ne seraient pas dus seulement au changement de brin lors de la recombinaison ou de la conversion, puisque les changements de brin (présentés ici par comp) ne représentent que le tiers, 6 sur 16.
      + Dans ce génome les intercalaires négatifs et petits existent entre 2 cds contigus et un cds et un tRNA (agc).Mais les intercalaires des 5 autres tRNAs sont assez élevés et correspondent à la dissymétrie, constatée chez beaucoup de génomes, entre les 2 cds encadrant un bloc sans rRNAs.
      - Spectre des intercalaires avec les cds: rapportés au total j’ai distingué 4 intervalles de ces intercalaires en pbs, inférieur à 51, de 51-200, de 201-400 et supérieur à 400. A part les génomes à phylogénie étroite, abq abs et rtb rpl, il y a 6 génomes différents.
      + rru et abq sont identiques
      + rpm et oan sont différents avec tous les autres à cause des négatifs et ils sont différents entre eux par l'intervalle 51-200, 0.52 contre 0.36.
      + agr a l'intervalle 201-400 le plus élevé de tous, 0.34 contre 0.15 à 0.28. Et le génome dont il se rapproche le plus, aua, diffère avec lui pour tous les autres intervalles.
      + rtb diffère de tous les autres par un intervalle > 400 élevé qui est de 0.44 contre moins de 0.20 pour tous les autres. En même temps ce génome est très dissymétrique puisqu’il a un intervalle < 51 aussi élevé que rpm et oan, 13 contre 16 et 19 respectivement, alors que les autres tournent autour de 0.05 jusqu’à 0.10 pour aua.
      - Les intercalaires entre tRNAs notés aussi aas, voir la liste entre aas.
      + Pour ces intercalaires, rpm se comporte comme les autres alpha et gamma (spl eco) avec 2 groupes, ceux supérieurs à 80 et pouvant atteindre des maxima élevés jusqu’à 1172 pour spl et 373 pour rpm, et le 2ème groupe ,le plus nombreux, aux intercalaires inférieurs à 81 avec une moyenne proche de 30 (variance inférieure à 20).
      + Le comportement des gamma et alpha est nettement différent de celui des firmicutes (ban lbu cbc) où le 2ème groupe fait à peine 5% du total (5 pour 113) mais avec des maxima aussi élevés que rpm. Le 2ème groupe des alpha dépasse les 50% ( 24 pour 45) et celui des gamma fait 25% ( 31 pour 129).
    3. @ Les blocs à rRNAs:
      - Les clusters de rpm tels qu’ils apparaissent dans la séquence des adresses sont présentés au chapitre rpm blocs construits, tableaux A5b1 et A5b2.
      + A5b1 rassemble 9 16s° solitaires suivis de longs clusters où on peut repérer les blocs d’origine altérés caractérisés par les intercalaires 16s-atc-23s, respectivement de 112 pbs et 216 pbs. Ainsi je suppose qu’il y a 5 blocs d’origine de type 16s-atc-23s-5s et un,isolé, de type 16s-gca-23s-5s. Dans ces grands clusters seul subsiste un seul 5s appartenant au bloc complet et intègre que j’ai nommé b0.
      + A5b2 rassemble 9 23s°5s solitaires et 3 blocs complets et un 5s solitaire. Les 23s°5s sont mis en face des 16s° du tableau A5b1. Les blocs complets contiennent un représentant de 16s, un de 23s et un 5s. Dans cette partie du tableau A5b2 j’ai ajouté le bloc b0 séparé de son cluster pour comparaison. Le bloc analogue au b0 est le bloc b1 qui est isolé et où seul le 16s est altéré. Le bloc b3 de cette partie du tableau apparaît comme un racollage d’un 16s° solitaire et d’un 23s°5s solitaire puisque l’intercalaire 16s°-23s° est négatif, c’est-à-dire qu’il y a recouvrement des 2 morceaux, ce qui ne serait pas le cas s’il y avait une délétion entre le 16s et le 23s d’origine.
      - Le parallélisme et l'égalité en nombres entre les 16s° et les 23s°5s solitaires, ainsi que l'analyse des intercalaires petits et négatifs de la remarque @2 m’ont poussé à reconstruire les blocs d’origines en rapprochant des 16s° solitaires à d’autres 16s° solitaires ou non tous 2 avec leurs cds, selon l’hypothèse que les 2 cds internes résultant font partie de l’altération ou de la délétion du 16s original et du coup ces cds seraient des candidats à la création de gènes nouveaux. Le même procédé et la même hypothèse sont appliqués pour un 23° et un 23s°5s.
      - Cette reconstruction se trouve dans les tableaux A5b3 et A5b4. Ainsi en optimisant les tailles des 16s et 23s reconstruits pour se rapprocher le plus aux tailles de ces rRNAs du bloc intègre b0, j’ai pu construire 11 blocs. J’ai séparé le 16s° du 23s°5s du bloc b3 du tableau A5b2. Il reste cependant un 16s°, un 23s° et un 5s-atgf que je n’ai pas pu réunir car leurs cds sont tous bien caractérisés et ne répondent aux critères des candidats à la création. L’hypothèse de 11 blocs ou 12 blocs à l’origine est tout à fait probable en comparaison des 9 blocs de abq.
      - Je n'ai pas pu faire une reconstruction analogue avec abs malgré la proximité phylogénique de abq car la complémentarité 16s° et 23s°5s n’existe pas comme si l’altération faisait disparaître une partie du rRNA, ceux qui restent indiquant la position des originaux. Cela indiquerait que ce sont 2 processus d’altération différents certainement reliés à la présence des tRNAs intra bloc, atc pour rpm et atc-gca pour abs.
      - Le génome analogue avec que des atc Tistrella mobilis KA081020-065, voir proteobacteria et Tistrella mobilis KA081020-065 [[15]]
    4. @ CRISPR, en relation avec la création des gènes et la conversion?
      Adresse 752603
      /rpt_family="CRISPR"
      /rpt_type=direct
      /rpt_unit_range=752664..752692
      /rpt_unit_seq="gggttcatccctgcgcatgcaggggatac"
    5. @ Les tRNAs rares : liens aux indices de l'ensemble des alpha, de l'ensemble des bacilli et de l'ensemble des gamma
      - Les 11 tRNAs se terminant par g, à part ttg agg tgg atg et tag, sont souvent les premiers absents chez certains génomes bactériens. A ceux-là il faut ajouter ccc et cga: ccc s’expliquerait par complémentarité avec ggg; cga est du au fait que chez les bactéries il y a bascule cgt/cgc et cgg/cga (cgc devenant rare comme pour tous les autres doublets xyt et de même cga par rapport à cgg). Chez les bacilli par exemple ces 13 tRNAs sont très rares alors que chez les alphaproteobacteria sont aussi abondants que les xyc et xya, à part cga est absent dans les 9 génomes étudiés ici.
      - Indices pour 100 génomes des aas les plus faibles, < 80: cgg et ttg soupçonnés ne présentent aucune faiblesse. Par contre je découvre 4 tRNAs présentant une seule faiblesse sur les 4 clades et seul le clade bacilli présente cette faiblesse, ce sont ctc gtc gcc ctg. Est-ce que ce foisonnement de doubles est en relation avec l'étendue des altérations des blocs à rRNAs?
génomes	354	1161	672	4032
clade	alpha	gamma	bacilli	bacteria
				
cga	8.5	13.4	5.4	22
ccc	78	87	5.7	68
				
gtc	101	176	47	110
gcc	94	170	26	103
ctc	110	104	67	95
				
gtg	55	8.4	0.7	33
gcg	55	7.1	7.9	30
gag	50	7.8	15	34
ggg	66	74	17	56
				
ctg	87	256	57	129
ccg	68	63	17	54
cag	62	104	16	59
cgg	101	102	99	83
				
acg	86	73	43	68
aag	74	24	67	60
agg	71	112	66	86
				
ttg	84	105	112	99
tcg	76	85	46	65

  • séquences des doubles: C'est le génome des 9 alpha étudiés qui présente le plus de doubles avec 15 contre 1 ou 2 cluster pour les autres présentant des doubles. En plus, même les tRNAs les plus faibles présentent des doublets, ccg aag cag gtg, et même un triplet gcg.
										
n aas	effectif	total		doubles						
1	30		30								
2	7		14		ccg	aag	gac	cag	gtg	atgi	gaa
3	4		12		gcgx3	cgtx3	accx3	tgc.aacx2			
4	4		16		ttcx4	gccx4	ggcx4	simplesx4			
5	1		5		ctgx5						
total	46		77								

rpm listes[modifier | modifier le wikicode]

rpm intercalaires entre aas[modifier | modifier le wikicode]
  • Tableau des intercalaires entre aas dans les blocs sans rRNAs
2863300	373	atgi-gca
3710967	214	gaa-gaa
2268549	165	ccg-ccg
2863748	157	gca-aca
3833710	153	ctg-ctg
2863106	117	cca-atgi
  • Comparaison avec les gamma et les firmicutes
clade		génome	< 80	> 80	moyenne	ecartype	maximum
alpha		rpm	26	6	39	16		373
		rru	1	3	-			202
		abq	11	6	-			220
		abs	11	6	-			219
		oan	1	2	-			245
		agr	2	2	-			793
		aua	4	9	-			404
		rtb	2	2	-			1051
		rpl	2	2	-			830
alpha total-rpm		34	32	-			-
alpha sans double	21	24	-			-
bacilli		ban	35	2	14	14		87
bacilli		lbu	46	2	14	12		258
clostridia	cbc	27	1	15	14		306
gama		spl	70	23	39	14		1172
gama		eco	28	8	28	18		209

rpm intercalaires avec les cds[modifier | modifier le wikicode]
	cds > 400	
adresse	intercalaire	RNA
435655		512	16s°
46322		553	16s°
840219		568	16s°
22949		586	16s°
1214670		600	16s°
2095539		614	16s°
2091644		705	16s° comp
3729914		828	16s° comp
1814819		894	16s° comp
2393295		1003	16s° comp
		
55304		438	23s°
751747		597	23s°  comp
		
2147496		645	atgf  comp
		
934570		449	cgt  comp
660266		648	gtc  comp
2597728		989	tca
  • Tableau des intercalaires négatifs ou petits avec les cds
	cds < 50	
adresse	intercalaire	RNA ou cds
1814819		-7	16s° comp
46322		0	16s°
2397013		2	16s°
840219		4	16s°
2091644		7	16s°
27892		18	16s° comp
1351013		23	16s°
5276		38	16s° comp
2095539		48	16s°
		
2769507		-12	23s°
13628		-7	23s°
44132		-5	23s°  comp
3409304		1	23s°  comp
691778		4	23s°  comp
4225		30	23s°
		
2894456		25	5s
		
52988		-37	cds
2632925		-41	cds
		
1814819		-30	agc  comp
3035343		8	aaa
3462054		29	agg
2633504		30	aca comp
417656		38	atgj comp
1206595		50	gta

intercalaires	rru	rpm	oan	abs	abq	agr	rtb	rpl	aua
< 2		0	0.06	0.05	0	0	0	0	0	0.01
< 51		0.07	0.16	0.19	0.04	0.06	0.03	0.13	0.14	0.10
51-200		0.53	0.52	0.36	0.55	0.54	0.53	0.29	0.27	0.40
201-400		0.25	0.20	0.28	0.26	0.24	0.34	0.15	0.19	0.30
> 400		0.15	0.11	0.17	0.14	0.17	0.10	0.44	0.40	0.20
total		88	147	107	125	121	97	62	63	80
Aas > 400	7	3	13	6	9	8	24	22	16
max  aas	1389	989	1650	746	688	660	2465	2381	3102

alpha codes[modifier | modifier le wikicode]

  • Lien tableur: alpha codes
  • Légende: prélèvement de la base gtRNAdb le 19/1/20 Paris
    - totaux en en-tête, exemple pour A5c, 25 98 95, 12 somme des tRNAs faibles ccc cga les jaunes et les 3 oranges de la colonne 6; 98 total de gtRNAdb contenant des pseudo et inconnus; 95 total du tableau.
    - ata très rare est remplacé par atgi (Ile2)
    - Met comprend atgf (Metf) et atgj (Met) sous la forme atgf/atgj, sauf pour A1c dont il faut les différencier.
    - Voir la légende des tris et couleurs, g1 t1.
Ac. Code génétique des 9 alpha
A1c. aua Aureimonas sp. AU20
g1    t1    12    55   55
ttt tct tat tgt
att act aat agt
ctt cct cat cgc
gtt gct gat ggt
ttc 1 tcc 1 tac 1 tgc 1
atc 1 acc 1 aac 2 agc 1
ctc 2 ccc 1 cac 1 cgt 2
gtc 3 gcc 1 gac 2 ggc 2
tta 1 tca 1 taa tga
ata 1 aca 1 aaa 1 aga 1
cta 1 cca 1 caa 1 cga 0
gta 1 gca 1 gaa 2 gga 1
ttg 1 tcg 1 tag tgg 1
atg 4 acg 1 aag 1 agg 1
ctg 1 ccg 1 cag 1 cgg 1
gtg 1 gcg 1 gag 1 ggg 1
A2c. abq Azospirillum brasilense strain Az39
g1    t1    20    88   87
ttt tct tat tgt
att act aat agt
ctt cct cat cgc
gtt gct gat ggt
ttc 2 tcc 1 tac 2 tgc 1
atc 8 acc 2 aac 3 agc 1
ctc 2 ccc 1 cac 2 cgt 2
gtc 2 gcc 3 gac 4 ggc 4
tta 1 tca 1 taa tga
ata 1 aca 1 aaa 1 aga 1
cta 1 cca 1 caa 1 cga 0
gta 1 gca 8 gaa 1 gga 1
ttg 1 tcg 1 tag tgg 2
atg 3/1 acg 1 aag 2 agg 1
ctg 3 ccg 2 cag 2 cgg 1
gtg 2 gcg 2 gag 2 ggg 1
A9c. abs Azospirillum brasilense strain Sp245
g1    t1    20    85   82
ttt tct tat tgt
att act aat agt
ctt cct cat cgc
gtt gct gat ggt
ttc 2 tcc 1 tac 2 tgc 1
atc 4 acc 2 aac 3 agc 1
ctc 2 ccc 1 cac 2 cgt 2
gtc 2 gcc 3 gac 4 ggc 4
tta 1 tca 1 taa tga
ata 1 aca 1 aaa 1 aga 1
cta 1 cca 1 caa 1 cga 0
gta 1 gca 4 gaa 1 gga 2
ttg 1 tcg 1 tag tgg 2
atg 5/1 acg 1 aag 2 agg 1
ctg 3 ccg 2 cag 2 cgg 1
gtg 2 gcg 2 gag 2 ggg 1
A3c. oan Ochrobactrum anthropi ATCC 49188
g1    t1    11    61   59
ttt tct tat tgt
att act aat agt
ctt cct cat cgc
gtt gct gat ggt
ttc 1 tcc 1 tac 1 tgc 1
atc 4 acc 1 aac 1 agc 1
ctc 1 ccc 1 cac 1 cgt 1
gtc 1 gcc 1 gac 2 ggc 2
tta 1 tca 1 taa tga 1
ata 1 aca 1 aaa 1 aga 1
cta 1 cca 1 caa 1 cga 0
gta 1 gca 4 gaa 2 gga 1
ttg 1 tcg 1 tag tgg 1
atg 5/2 acg 1 aag 1 agg 1
ctg 1 ccg 1 cag 1 cgg 1
gtg 1 gcg 0 gag 1 ggg 1
A4c. rru Rhodospirillum rubrum ATCC 11170
g1    t1    12    55   55
ttt tct tat tgt
att act aat agt
ctt cct cat cgc
gtt gct gat ggt
ttc 1 tcc 1 tac 1 tgc 1
atc 4 acc 2 aac 1 agc 1
ctc 1 ccc 1 cac 1 cgt 1
gtc 1 gcc 2 gac 1 ggc 1
tta 1 tca 1 taa tga
ata 1 aca 1 aaa 1 aga 1
cta 1 cca 1 caa 1 cga 0
gta 1 gca 4 gaa 1 gga 1
ttg 1 tcg 1 tag tgg 1
atg 3/1 acg 1 aag 1 agg 1
ctg 1 ccg 1 cag 1 cgg 1
gtg 1 gcg 1 gag 1 ggg 1
A5c. rpm Rhodospirillum photometricum
g1    t1    25    95   95
ttt tct tat tgt
att act aat agt
ctt cct cat cgc
gtt gct gat 1 ggt
ttc 4 tcc 1 tac 1 tgc 1
atc 7 acc 3 aac 2 agc 1
ctc 1 ccc 2 cac 2 cgt 3
gtc 2 gcc 4 gac 2 ggc 4
tta 1 tca 1 taa tga
ata 2 aca 2 aaa 4 aga 1
cta 1 cca 2 caa 1 cga 0
gta 1 gca 2 gaa 2 gga 1
ttg 1 tcg 1 tag tgg 1
atg 5/2 acg 1 aag 3 agg 1
ctg 5 ccg 2 cag 2 cgg 1
gtg 2 gcg 3 gag 2 ggg 1
A6c. agr Agrobacterium sp. H13-3
g1    t1    9    58   58
ttt tct tat tgt
att act aat agt
ctt 1 cct cat cgc
gtt gct gat ggt
ttc 1 tcc 1 tac 1 tgc 1
atc 5 acc 1 aac 1 agc 1
ctc 1 ccc 1 cac 1 cgt 1
gtc 1 gcc 1 gac 2 ggc 2
tta 1 tca 1 taa tga
ata 1 aca 1 aaa 1 aga 1
cta 1 cca 1 caa 1 cga 0
gta 1 gca 5 gaa 2 gga 1
ttg 1 tcg 1 tag tgg 1
atg 6/1 acg 1 aag 1 agg 0
ctg 1 ccg 1 cag 1 cgg 1
gtg 0 gcg 0 gag 0 ggg 1
A78c. rpl Rickettsia prowazekii et rtb typhi
g1    t1    2    33   33
ttt tct tat tgt
att act aat agt
ctt cct cat cgc
gtt gct gat ggt
ttc 1 tcc 1 tac 1 tgc 1
atc 1 acc 1 aac 1 agc 1
ctc 1 ccc 0 cac 1 cgt 1
gtc 1 gcc 1 gac 1 ggc 1
tta 1 tca 1 taa tga
ata 1 aca 1 aaa 1 aga 1
cta 1 cca 1 caa 1 cga 0
gta 1 gca 1 gaa 1 gga 1
ttg 0 tcg 0 tag tgg 1
atg 1/1 acg 1 aag 0 agg 0
ctg 0 ccg 0 cag 0 cgg 1
gtg 0 gcg 0 gag 0 ggg 0

gamma codes[modifier | modifier le wikicode]

  • Lien tableur: gamma codes
  • Légende: prélèvement de la base gtRNAdb le 19/1/20 Paris
    - totaux en en-tête, exemple pour G1c, 88642 86720, 88642 total de la requête pour tout gamma dans gtRNAdb, 86720 total du tableau.
    - Voir la légende des tris et couleurs, g1 t1.
  • Liens aux indices de l'ensemble des alpha et de l'ensemble des bacilli
Gc. Code génétique des gammaproteobacteria
G1c. Effectifs
g1    t1    1161    88462 86720
ttt 18 tct 20 tat 15 tgt 2
att 1 act 6 aat 2 agt 0
ctt 11 cct 1 cat 3 cgc 0
gtt 6 gct 0 gat 0 ggt 6
ttc 2075 tcc 1 795 tac 2 687 tgc 1345
atc 3369 acc 1 829 aac 3 679 agc 1256
ctc 1204 ccc 1 012 cac 1 369 cgt 3520
gtc 2046 gcc 1 973 gac 3 421 ggc 4151
tta 1422 tca 1 662 taa 12 tga 762
ata 10 aca 1 666 aaa 4 457 aga 1784
cta 1516 cca 1 671 caa 2 239 cga 156
gta 3798 gca 3 342 gaa 3 829 gga 1347
ttg 1214 tcg 984 tag 32 tgg 1340
atg 7009 acg 845 aag 282 agg 1298
ctg 2977 ccg 729 cag 1208 cgg 1182
gtg 98 gcg 82 gag 90 ggg 855
G2c. gamma indice pour 100 génomes
g1    t1    1161    88462 7469
ttt 1.55 tct 1.72 tat 1.29 tgt 0.17
att 0.09 act 0.52 aat 0.17 agt 0
ctt 0.95 cct 0.09 cat 0.26 cgc 0
gtt 0.52 gct 0 gat 0 ggt 0.52
ttc 179 tcc 155 tac 231 tgc 116
atc 290 acc 158 aac 317 agc 108
ctc 104 ccc 87 cac 118 cgt 303
gtc 176 gcc 170 gac 295 ggc 358
tta 122 tca 143 taa 1.03 tga 66
ata 0.86 aca 143 aaa 384 aga 154
cta 131 cca 144 caa 193 cga 13.4
gta 327 gca 288 gaa 330 gga 116
ttg 105 tcg 85 tag 2.76 tgg 115
atg 604 acg 73 aag 24.3 agg 112
ctg 256 ccg 63 cag 104 cgg 102
gtg 8.4 gcg 7.1 gag 7.8 ggg 74

rpm distribution[modifier | modifier le wikicode]

aac2 aag2 acc3 atgj2 cag2 ccg2 cgt3 ctg5 gaa2 gac2 gcc4 gcg3 ggc4 gtg2 ttc4
gca >1 16s
Al3 rpm, Rhodospirillum photometricum DSM 122. alpha.
g1    t1       
atgi 2 tct tat atgf 5
att act aat agt
ctt cct cat cgc
gtt gct gat ggt
ttc 4 tcc 1 tac 1 tgc 1
atc 7 acc 3 aac 2 agc 1
ctc 1 ccc 2 cac 2 cgt 3
gtc 2 gcc 4 gac 2 ggc 4
tta 1 tca 1 taa tga
ata aca 2 aaa 3 aga 1
cta 1 cca 2 caa 1 cga
gta 1 gca 2 gaa 2 gga 1
ttg 1 tcg 1 tag tgg 1
atgj 2 acg 1 aag 2 agg 1
ctg 5 ccg 2 cag 2 cgg 1
gtg 2 gcg 3 gag 2 ggg 1
alpha >1aa =1aa -5s +5s -16s +16s total
rpm 49 30 5 8 92

rpm. Intergen51[modifier | modifier le wikicode]

Intergen51. rpm. Le génome[modifier | modifier le wikicode]

  • rpm Le prélèvement: Aalpha
  • Le nom et le lien NCBI: rpm, Pararhodospirillum photometricum DSM 122 chromosome DSM 122, NCBI [16], date 12.3.21.
  • rpm La longueur totale des intercalaires, longueur du génome et taux intercalaires/génome:
Nom	intercals	génome		taux en %			
rpm	461,433		3,876,289	11.9
rpm données intercalaires[modifier | modifier le wikicode]
rpm données intercalaires 200[modifier | modifier le wikicode]
rpm autres intercalaires aas[modifier | modifier le wikicode]

Intergen51. rpm. Les différents types d'intercalaires[modifier | modifier le wikicode]

  • Lien au tableur: Intergen51. rpm les différents types d'intercalaires.
  • Légende:
    - S pour intercalaire CDS-CDS et R pour tRNA-CDS,
    - c pour intercalaire continu (les 2 gènes sont sur le même brin) et x pour discontinu (les 2 gènes sont sur 2 brins différents, le brin et son complément)
    - %reste = 100*reste/total, le reste étant ce qui reste du total après la fin du diagramme, gamme.
    - %t30 = 100*t30/total, t30 étant le total des fréquences 10 20 30
    - %t5 = 100*t/total, t5 étant le total des fréquences de -1 à -5 dans le diagramme des S-.
Int51.2 rpm les différents types d'intercalaires entre gène
Int51.21 Les différents types
intercalaires CDS-CDS * autres intercalaires
continu S+ S- S0 total c/x RNA-RNA CDS-rRNA total
c 1,838 603 9 2,450 2.6 41 5 46
x 902 46 4 952 0 5 5
t 2,740 649 13 3,402 41 10 51
% 80.5 19.1 0.4
Int51.22 Détail des * autres intercalaires
intercalaires tRNA-CDS récapitulatif des * autres intercalaires
continu R+ R- R0 total c/x * autres total %
c 65 0 0 65 1.9 tRNA-CDS 100 41
x 35 0 0 35 RNA-RNA 41 17
t 100 0 0 100 CDS-rRNA 10 4
% 100.0 0.0 0.0 non RNA 92 38
- total 243 100
Int51.23 Les taux remarquables
taux %reste %t30 %t5 %0
type S+ R+ S- S+ R+ S- S+ R+
gamme 400 400 6-50 - - - - -
type S+ R+ S- S+ R+ S- S+ R+
c 4.1 3.1 5.3 27.1 6.2 67 0.4 0.0
x 11.8 11.4 34.8 3.1 0.0 22 0.4 0.0

Intergen51. rpm. Les diagrammes CDS-CDS positifs[modifier | modifier le wikicode]

  • Lien tableur: Les diagrammes
  • Diagrammes des gamma:  rpm présente 2 diagrammes
    - fc40, CDS-CDS continu, fréquence unitaire en abscisses et effectif en ordonnées
    - fx%, CDS-CDS discontinu, fréquences regroupées par 10 (freq10) en abscisses et pourcentage en ‰ par rapport au total, en ordonnées.
  • Équations des courbes de tendance en pour 1000: colonnes %fx %fc
Courbes de tendances pour les diagrammes en pour 1000			Calculs des f.41	rpm
R2	x3		x2		x		c		Inflexion poly3	x	c
0.287	2.67E-06	-1.61E-03	1.76E-01	30.3	fx1	abscisse	256.4	194.4
0.846	-4.09E-06	3.19E-03	-8.62E-01	92.7	fc1	ordonnée	16.6	20.8
								
0.792	-9.05E-06	6.96E-03	-1.71E+00	150.0	fx41			
0.945	1,86E-06	-1,09E-03	5,46E-02	37.5	fc41			
  • Moyennes glissantes fc+400, diagonale. Voir le détail des calculs dans abs.
données	rpm		calculs			poly3	rpm
effect	1847		R2.21	820		abscis	400
xm	45		pte	8,21		flexa	188
ym	5		cste	3,08		flexo	2,10
x1m	253		r400l	147		xm	45
y1m	1		restp	119,11		sup4	159,3
rfin	41,15		%sd	35,03		sup4t	445,6
bornf	166		lond	208		%	35,8
supd	193,1		%sf	35,88		long	143
supdt	551,2		lonf	121			
xmp	329,72		sf/lf	1,19			
r400	77,96		sr/lr	0,56			
supf	144,1		sd/ld	0,93			
supft	401,7		i.r400	0,53						

Intergen51. rpm. Les CDS-CDS négatifs[modifier | modifier le wikicode]

Sous-totaux	rpm			totale	
fréquence	x-	c-		x-	c-
 - 1		0	65		4	4140
 - 2		3	1		85	11
 - 3		0	0		3	12
 - 4		7	338		717	10938
 - 5		0	0		5	19
sp6		36	199		1642	8424
total		46	603		2,456	23,544
reste		16	32		264	420
s6		5	0		361	41
s7		4	43		321	1438
s8		11	124		696	6525
rappot s1-5						
4/2/1		2.3	5.2		8.4	2.6
% / sp6						
s6/sp6		13.9	0.0		22.0	0.5
s7/sp6		11.1	21.6		19.5	17.1
s8/sp6		30.6	62.3		42.4	77.5
reste/sp6	44.4	16.1		16.1	5.0
						
total s1-5	10	404		814	15120
% / total						
%s1-5		21.7	67.0		33.1	64.2
%sp6		78.3	33.0		66.9	35.8

Intergen51. rpm. Les intercalaires des blocs[modifier | modifier le wikicode]

  • Le détail
RNA-RNA		c	x		CDS-RNA		c	x
23s 5s		1			CDS 16s			1
16s 23s					5s CDS		4	4
16s tRNA	1			16 CDS		1	
tRNA 23s	2			CDS 5s			
5s tRNA		5			23s CDS			
tRNA in					CDS 23s			
tRNA contig				5s 16s			
tRNA hors	32			16s16s			
tRNA 16s								
23s tRNA								
tRNA 5s								
16s 5s								
5s 23s								
5s 5s								
total		41	0		total		5	5
  • Les rares voir gamma pour la longueur des intercalaires
  • Les tRNA-CDS compris, comparaison dans le clade et dans l'étude.

Intergen51. rpm. Les intercalaires tRNA-tRNA extra bloc[modifier | modifier le wikicode]

Int51.31 alpha. Les intercalaires tRNA-tRNA hors blocs
abq    abs    absp    aua    agrc    pub    rpl    rpm1    rpm2    rpm3
inter aa inter aa inter aa inter aa inter aa inter aa inter aa inter aa inter aa inter aa
206 ccg 109 cac 30 ctg x404 ggc 41 gac 66 atgi x830 gcc 24 atgj 37 gac 29 ttc
** ccg ** cac ** gcc 44 atgf ** gac ** gtc ** gac ** atgj ** gac 34 ttc
60 tac 163 gta 1 acc ** atgf 452 gaa 13 gta x49 caa 25 gtg 34 gga 33 ttc
** gga ** gac 99 gcg 51 cgt ** gaa ** gac ** cgg ** gtg ** tac ** ttc
76 aag 219 aac 35 gac ** cgt 26 gga 52 aac 15 atc 35 cgt 24 aag 27 tgc
** aag ** tgc 1 gtc x161 ttc ** tac ** tgc ** aaa 44 cgt ** aag 31 aac
38 gag 132 gtg ** cag ** acc agrl 46 gga 105 tac ** cgt 165 ccg ** aac
** gag ** gtg 4 aac 128 gtc x793 ggc ** tac ** gga 23 ggc ** ccg 70 gcg
132 gtg 30 gcc ** gac 186 gtc ** atgj rru rtb 45 ggc 70 gcc 33 gcg
** gtg ** ctg abqp ** gtc oan1 202 gcc 15 aaa 29 ggc 69 gcc ** gcg
220 aac 38 gag 29 ctg 140 gaa 146 gaa ** gcc ** atc ** ggc 57 gcc 214 gaa
** tgc ** gag ** gcc ** gaa ** gaa 81 tgc x60 cgg 54 cag ** gcc ** gaa
164 gac 74 aag 4 aac 58 gac 24 tac ** aac ** caa ** cag 117 cca 47 ctg
** gta ** aag ** gac x270 gac ** gga 27 gga x1051 gac 16 acc 373 atgi 153 ctg
109 cac 60 gga 1 acc ** gta 245 gac ** tac ** gcc 18 acc 157 gca 48 ctg
** cac ** tac 99 gcg x173 ccg ** gac 165 acc 95 gga ** acc ** aca 47 ctg
205 ccg 44 gac ** caa ** acc ** tac ** ctg
** ccg 1 gtc 132 ctc
** cag ** ctc
24 gga
** tac
208 ggc
** ggg

Rhodospirillum rubrum ATCC 11170[modifier | modifier le wikicode]

rru opérons[modifier | modifier le wikicode]

  • Lien tableur: rru opérons
  • Liens: gtRNAdb [17], NCBI [18], génome [orgn]
  • Phylogénie: Bacteria; Proteobacteria; Alphaproteobacteria; Rhodospirillales; Rhodospirillaceae; Rhodospirillum.
  • Légende: cdsa: cds aas, cdsd: cds dirigé
A4. Rhodospirillum rubrum ATCC 11170
64.97%GC 26.12.19 Paris  55   doubles intercal cds aa avec aa cdsa cdsd protéines
chromosome
comp 16232..16852 cds 163 163 207 3'-5' exonuclease
comp 17016..17102 ctg 253 253
17356..18378 cds 341 3-beta-hydroxy-delta(5)-steroid dehydrogenase
117072..117287 cds 37 37 72 slyX
comp 117325..117401 agg 341 341
117743..123022 cds 1760 alpha-2-macroglobulin-like protein
comp 149921..151015 cds 225 225 365 hp
151241..151317 cgg 136 136
comp 151454..152929 cds 492 chemotaxis sensory transducer protein
189941..191668 cds 859 859 576 sulfate transporter/antisigma-factor antagonist
192528..194004 16s 184 1477
194189..194265 atc 66 66
194332..194407 gca 362
194770..197527 23s 119 2758
197647..197761 5s 96 115
197858..197934 atgf 287 287
comp 198222..198455 cds 78 hp
comp 305449..306648 cds 257 257 400 Ppx/GppA phosphatase
306906..306979 cag 319 319
comp 307299..308303 cds 335 LacI family transcriptional regulator
comp 322896..323807 cds 292 292 304 hp
comp 324100..324174 caa 98 98
comp 324273..325601 cds 443 chemotaxis sensory transducer protein
362552..362881 cds 224 224 110 hp
363106..363181 gcc + 202 202
363384..363459 gcc 2 gcc 43 43
comp 363503..364531 cds 343 esterase
407067..407606 cds 92 92 180 YbaK/prolyl-tRNA synthetase associated domain-containing protein
407699..407790 agc 141 141
407932..408774 cds 281 hp
466945..467925 cds 115 115 327 hp
comp 468041..468126 tta 83 83
comp 468210..468458 cds 83 hp
comp 559038..559610 cds 86 86 191 OsmC-like protein
559697..559772 aag 140 140
559913..560608 cds 232 hp
comp 794877..795188 cds -81 -81 104 hp
comp 795108..795188 Sig-pep 217 217 27 hp
795406..795496 tcc 44 44
795541..795846 cds 102 hp
comp 908584..910185 cds -102 -102 534 peptidase M23B
comp 910084..910185 Sig-pep @1 1212 1212 34 hp
911398..912874 16s 182 1477
913057..913133 atc 66 66
913200..913275 gca 361
913637..916394 23s 118 2758
916513..916627 5s 95 115
916723..916799 atgf 573 573
917373..921860 cds 1496 hp
1159249..1160091 cds 71 71 281 Linocin_M18 bacteriocin protein
1160163..1160238 gag 117 117
1160356..1160613 cds 86 prevent-host-death protein
comp 1464820..1465122 cds 283 283 101 50S ribosomal protein L21
1465406..1465495 tcg 139 139
comp 1465635..1466303 cds 223 cytochrome B561
1791953..1792159 cds 116 116 69 hp
comp 1792276..1792351 gaa 131 131
comp 1792483..1792689 cds 69 cold-shock DNA-binding protein family protein
1824302..1825738 cds 98 98 479 malonyl-CoA decarboxylase
1825837..1825921 cta 102 102
1826024..1827415 cds 464 trigger factor
1833133..1833408 cds 284 284 92 histone-like DNA-binding protein
1833693..1833768 gta 70 70
comp 1833839..1835326 cds 496 methyl-accepting chemotaxis sensory transducer
1933506..1934138 cds -633 -633 211 hp
1933506..1933652 Sig-pep 571 571 49 hp
1934224..1934300 cca 63 63
1934364..1934663 cds 12 12 100 ETC complex I subunit region
1934676..1934752 aga 396 396
1935149..1939624 cds 1492 hp
1959133..1959858 cds 175 175 242 MerR family transcriptional regulator
1960034..1960110 ccc @2 1062 1062
1961173..1961367 cds 65 hp
comp 1996760..1998124 cds -120 -120 455 lytic murein transglycosylase
comp 1998005..1998124 Sig-pep 119 119 40 hp
1998244..1998333 tca 927 927
comp 1999261..1999929 cds 223 hp
2032027..2032863 cds 123 123 279 phage integrase
comp 2032987..2033062 aaa 186 186
comp 2033249..2033755 cds 169 peptidyl-prolyl isomerase
comp 2093327..2093977 cds 295 295 217 protein-L-isoaspartate(D-aspartate) O-methyltransferase
2094273..2094346 tgc 81 81
2094428..2094502 aac 150 150
2094653..2094916 cds 88 prevent-host-death protein
comp 2304404..2305834 cds 89 89 477 divalent cation transporter
comp 2305924..2306010 ctc 178 178
2306189..2306839 cds 217 lipoate-protein ligase B
2331183..2331521 cds 73 73 113 hp
2331595..2331671 atgj 126 126
comp 2331798..2332040 cds 81 hp
comp 2411337..2411804 cds -72 -72 156 CreA
comp 2411733..2411804 Sig-pep 202 202 24 hp
comp 2412007..2412083 cac 75 75
comp 2412159..2413343 cds 395 hp
2729598..2731271 cds 449 449 558 macrocin-O-methyltransferase
comp 2731721..2731797 atgf 95
comp 2731893..2732007 5s 119 115
comp 2732127..2734884 23s 362 2758
comp 2735247..2735322 gca 66 66
comp 2735389..2735465 atc 184
comp 2735650..2737126 16s 606 606 1477
comp 2737733..2738110 cds 126 hp
comp 2959802..2961874 cds 354 354 691 chemotaxis sensory transducer protein
comp 2962229..2962303 gtc 123 123
2962427..2963359 cds 311 N-formylglutamate amidohydrolase
comp 3124836..3125033 cds 151 151 66 preprotein translocase subunit SecE
comp 3125185..3125260 tgg 343 343
comp 3125604..3126794 cds 93 93 397 elongation factor Tu
comp 3126888..3126961 gga 27 27
comp 3126989..3127074 tac 37 37
3127112..3128158 cds 57 57 349 23s rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
3128216..3128291 aca 127 127
3128419..3128652 cds 78 hp
comp 3193350..3194507 cds 430 430 386 acyltransferase
comp 3194938..3195013 ttc 103 103
comp 3195117..3195635 cds 173 hp
3320745..3322115 cds -1371 -1371 457 virulence protein
3320745..3320816 Sig-pep 1389 1389 24 hp
comp 3322206..3322281 atgi 60 60
comp 3322342..3324432 cds 697 RNA polymerase sigma factor RpoD
comp 3377932..3378114 cds 140 140 61 hp
3378255..3378329 acc + 165 165
3378495..3378569 acc 2 acc 237 237
3378807..3379370 cds 234 234 188 hp
3379605..3379681 gac 77 77
comp 3379759..3380517 cds 253 diguanylate phosphodiesterase
comp 3399207..3399494 cds 262 262 96 hp
comp 3399757..3399833 ccg 56 56
comp 3399890..3400972 cds 361 farnesyltranstransferase
3490378..3491148 cds 84 84 257 2-phosphoglycolate phosphatase
3491233..3491307 gtg 407 407
3491715..3492080 cds 122 hp
comp 3719367..3719753 cds 163 163 129 hp
comp 3719917..3719990 ggg 95 95
comp 3720086..3720859 cds 258 enoyl-ACP reductase
3805869..3806813 cds 130 130 315 inner-membrane translocator
comp 3806944..3807058 5s 116 115
comp 3807175..3809932 23s 362 2758
comp 3810295..3810370 gca 66 66
comp 3810437..3810513 atc 184
comp 3810698..3812174 16s 1227 1227 1477
3813402..3814118 cds 239 transposase
comp 3824154..3825854 cds 76 76 567 phage integrase
comp 3825931..3826007 cgt 387 387
3826395..3827531 cds 379 hp
4021982..4023163 cds 27 27 394 diguanylate phosphodiesterase
comp 4023191..4023277 ttg 224 224
4023502..4023855 cds 118 hp
comp 4058818..4059117 cds 187 187 100 hp
4059305..4059380 gcg 179 179
comp 4059560..4060126 cds 189 hp
comp 4105626..4107317 cds -114 -114 564 chemotaxis sensory transducer
comp 4107204..4107317 Sig-pep 721 721 38 hp
comp 4108039..4108113 acg 148 148
4108262..4108843 cds 194 D-alpha,beta-D-heptose 1,7-bisphosphate phosphatase
comp 4261100..4262038 cds 269 269 313 thioredoxin-like protein
4262308..4262382 ggc 118 118
4262501..4263136 cds 212 lysine exporter protein LysE/YggA

rru cumuls[modifier | modifier le wikicode]

cumuls. rru.
opérons Fréquences intercalaires tRNAs Fréquences intercalaires cds Fréquences aas cds chromosome
effectif gammes sans rRNAs avec rRNAs gammes cds gammes cdsd gammes cdsa gammes cdsa 300
avec rRNA opérons 4 1 1 7 1 100 23 1 0
16atcgca235 1 20 50 6 40 200 17 30 3
Id-atgf 3 40 1 100 19 80 300 16 60 4
- 60 150 20 120 400 17 90 12
max a 3 80 4 200 8 160 500 8 120 10
a doubles 0 100 1 250 7 200 600 5 150 3
spéciaux 0 120 300 9 240 700 2 180 4
total aas 11 140 350 3 280 800 0 210 5
sans opérons 40 160 400 3 320 900 0 240 8
1 aa 36 180 1 450 3 360 1000 0 270 4
max a 2 200 500 0 400 1100 0 300 3
a doubles 2 1 10 3 35
total aas 44 4 4 95 0 91 91
total aas 55
remarques
avec jaune moyenne 119 66 208 292
variance 79 0 333 187
sans jaune moyenne 148 237 140
variance 83 132 69

rru blocs[modifier | modifier le wikicode]

  • Lien tableur: rru blocs
  • Légende:
    sulfate sulfate transporter/antisigma-factor antagonist
    inner   inner-membrane translocator
    macrocin macrocin-O-methyltransferase
    peptidase peptidase M23B
    hp    Hypothetical protein
A4. rru, blocs à rRNA.
cds 859 576 sulfate cds 606 126 hp
16s 184 1477 16s 184 1477
atc 66 atc 66
gca 362 gca 362
23s 119 2758 23s 119 2758
5s 96 115 5s 95 115
atgf 287 atgf 449
cds 78 hp cds 558 macrocin
cds -102 534 peptidase
Sig-pep 1212 34 hp cds 1227 239 transposase
16s 182 1477 16s 184 1477
atc 66 atc 66
gca 361 gca 362
23s 118 2758 23s 116 2758
5s 95 115 5s 130 115
atgf 573 cds 315 inner
cds 1496 hp

rru remarques[modifier | modifier le wikicode]

  • Remarques: Par rapport aux rickettsia rtb et rpl, les intercalaires élevés sont rares.
    1. @ Les intercalaires élevés
      - il n’y a pas d’aas isolés et les mineurs des blocs à rRNAs sont normaux pour ces blocs, inférieurs à 573.
      - Pour les aas il n’y a que 5 intercalaires élevés entre 571-1389, et 2 dépassant à peine 400 pbs.
      - Pour les blocs à rRNAs il n’y a que 3 intercalaires franchement élevés, 1227 1212 859.
    2. @ Sig-pep, signal peptide.
      - Il y a 580 sig-peptide dans ce génome. Dans le tableau des opérons ce sont de petites séquences peptidiques de moins de 30 aas placsés au début du cds. D’où l’intercalaire négatif.
      - Dans le tableau sur les 7 seg-pep, 4 sont associés à des intercalaires élevés (voir tableau ci-dessous) et 3 à des intercalaires inférieurs à 219 pbs.
  • Note: Les 4 blocs à rRNAs sont tous complets ayant atcgca en interne dont 3 ont atgf qui suit 5s. Aucun bloc ne contient un cds en interne.
  • Séquences des doubles: Sur 40 blocs sans rRNAs seulement 4 ont 2 aas dont 2 ont un doublet, gcc et acc.
  • Tableau des intercalaires
16s			aas			Sig-pep
adresse	intercalaire	adresse	intercalaire	intercalaire
911398	1212-573	atgi	3322206	1389	1389
2735650	606-449		ccc	1960034	1062	1212
3810698	1227-130	tca	1998244	927	721
192528	859-257		acg	4108039	721	571
			cca	1934224	571	3 <219
			ttc	3194938	430	
			gtg	3491233	407	

rru distribution[modifier | modifier le wikicode]

Al4 rru, Rhodospirillum rubrum ATCC 11170. alpha.
g1    t1       
atgi 1 tct tat atgf 3
att act aat agt
ctt cct cat cgc
gtt gct gat ggt
ttc 1 tcc 1 tac 1 tgc 1
atc 4 acc 2 aac 1 agc 1
ctc 1 ccc 1 cac 1 cgt 1
gtc 1 gcc 2 gac 1 ggc 1
tta 1 tca 1 taa tga
ata aca 1 aaa 1 aga 1
cta 1 cca 1 caa 1 cga
gta 1 gca 4 gaa 1 gga 1
ttg 1 tcg 1 tag tgg 1
atgj 1 acg 1 aag 1 agg 1
ctg 1 ccg 1 cag 1 cgg 1
gtg 1 gcg 1 gag 1 ggg 1
alpha >1aa =1aa -5s +5s -16s +16s total
rru 8 36 3 8 55

rru. Intergen51[modifier | modifier le wikicode]

Intergen51. rru. Le génome[modifier | modifier le wikicode]

  • rru Le prélèvement: Acbn
  • Le nom et le lien NCBI: rru, Rhodospirillum rubrum ATCC 11170, NCBI [19], date 10.03.20.
  • rru La longueur totale des intercalaires, longueur du génome et taux intercalaires/génome:
Nom	intercals	génome		taux en %			
rru	461,427		4,352,825	10.6	
rru données intercalaires[modifier | modifier le wikicode]
rru données intercalaires 200[modifier | modifier le wikicode]
rru autres intercalaires aas[modifier | modifier le wikicode]

Intergen51. rru. Les différents types d'intercalaires[modifier | modifier le wikicode]

  • Lien au tableur: Intergen51. rru les différents types d'intercalaires.
  • Légende:
    - S pour intercalaire CDS-CDS et R pour tRNA-CDS,
    - c pour intercalaire continu (les 2 gènes sont sur le même brin) et x pour discontinu (les 2 gènes sont sur 2 brins différents, le brin et son complément)
    - %reste = 100*reste/total, le reste étant ce qui reste du total après la fin du diagramme, gamme.
    - %t30 = 100*t30/total, t30 étant le total des fréquences 10 20 30
    - %t5 = 100*t/total, t5 étant le total des fréquences de -1 à -5 dans le diagramme des S-.
Int51.2 rru les différents types d'intercalaires entre gène
Int51.21 Les différents types
intercalaires CDS-CDS * autres intercalaires
continu S+ S- S0 total c/x RNA-RNA CDS-rRNA total
c 2,124 609 12 2,745 2.6 23 2 25
x 966 74 1 1,041 0 3 3
t 3,090 683 13 3,786 23 5 28
% 81.6 18.0 0.3
Int51.22 Détail des * autres intercalaires
intercalaires tRNA-CDS récapitulatif des * autres intercalaires
continu R+ R- R0 total c/x * autres total %
c 48 0 0 48 1.4 tRNA-CDS 83 52
x 35 0 0 35 RNA-RNA 23 14
t 83 0 0 83 CDS-rRNA 5 3
% 100.0 0.0 0.0 non RNA 49 31
- total 160 100
Int51.23 Les taux remarquables
taux %reste %t30 %t5 %0
type S+ R+ S- S+ R+ S- S+ R+
gamme 400 400 6-50 - - - - -
type S+ R+ S- S+ R+ S- S+ R+
c 3.3 10.4 1.8 25.7 2.1 78 0.4 0.0
x 9.3 2.9 12.2 15.2 2.9 38 0.1 0.0

Intergen51. rru. Les diagrammes CDS-CDS positifs[modifier | modifier le wikicode]

  • Lien tableur: Les diagrammes
  • Diagrammes des gamma:  rru présente 2 diagrammes
    - fc40, CDS-CDS continu, fréquence unitaire en abscisses et effectif en ordonnées
    - fx%, CDS-CDS discontinu, fréquences regroupées par 10 (freq10) en abscisses et pourcentage en ‰ par rapport au total, en ordonnées.
  • Équations des courbes de tendance en pour 1000: colonnes %fx %fc
Courbes de tendances pour les diagrammes en pour 1000			Calculs des f.41	rru
R2	x3		x2		x		c		Inflexion poly3	x	c
0.814	-1.20E-06	8.00E-04	-2.40E-01	47.80	fx1	abscisse	268.5	152.0	
0.876	-3.23E-06	2.65E-03	-7.77E-01	90.9	fc1	ordonnée	17.1	27,6
								
0.831	9.36E-07	-7.54E-04	9.93E-02	26.7	fx41	
0.957	1,32E-06	-6,01E-04	-8,58E-02	49.9	fc31		
  • Moyennes glissantes fc+400, diagonale. Voir le détail des calculs dans abs.
données	rru		calculs			poly3	rru
effect	2136		R2.21	792		abscis	400
xm	35		pte	14,01		flexa	140
ym	8		cste	4,24		flexo	2,88
x1m	231		r400l	169		xm	35
y1m	1		restp	131,09		sup4	116,6
rfin	32,77		%sd	26,84		sup4t	402,6
bornf	106		lond	196		%	29,0
supd	158,2		%sf	26,00		long	105
supdt	589,4		lonf	71			
xmp	279,49		sf/lf	1,09			
r400	98,31		sr/lr	0,64			
supf	77,7		sd/ld	0,81			
supft	298,7		i.r400	0,58						

Intergen51. rru. Les CDS-CDS négatifs[modifier | modifier le wikicode]

Sous-totaux	rru			totale	
fréquence	x-	c-		x-	c-
 - 1		0	81		4	4140
 - 2		1	0		85	11
 - 3		0	0		3	12
 - 4		27	394		717	10938
 - 5		0	0		5	19
sp6		46	134		1642	8424
total		74	609		2,456	23,544
reste		9	11		264	420
s6		6	0		361	41
s7		10	26		321	1438
s8		21	97		696	6525
rappot s1-5						
4/2/1		27	4.9		8.4	2.6
% / sp6						
s6/sp6		13.0	0.0		22.0	0.5
s7/sp6		21.7	19.4		19.5	17.1
s8/sp6		45.7	72.4		42.4	77.5
reste/sp6	19.6	8.2		16.1	5.0
						
total s1-5	28	475		814	15120
% / total						
%s1-5		37.8	78.0		33.1	64.2
%sp6		62.2	22.0		66.9	35.8

Intergen51. rru. Les intercalaires des blocs[modifier | modifier le wikicode]

  • Le détail
RNA-RNA		c	x		CDS-RNA		c	x
23s 5s		4			CDS 16s		2	2
16s 23s					5s CDS			1
16s tRNA	4			16 CDS			
tRNA 23s	4			CDS 5s			
5s tRNA		3			23s CDS			
tRNA in		4			CDS 23s			
tRNA contig				5s 16s			
tRNA hors	4			16s16s			
tRNA 16s								
23s tRNA								
tRNA 5s								
16s 5s								
5s 23s								
5s 5s								
total		23	0		total		2	3
  • Les rares voir gamma pour la longueur des intercalaires
  • Les tRNA-CDS compris, comparaison dans le clade et dans l'étude.

Intergen51. rru. Les intercalaires tRNA-tRNA extra bloc[modifier | modifier le wikicode]

rru intercalaires entre cds[modifier | modifier le wikicode]

  • Rhodospirillum rubrum ATCC 11170, 10.3.2020, NCBI [20]
  • Note: Pour les génomes des annexes j'ai relevé les intercalaires entre tRNAs et entre ceux-ci et les cds qui leur sont adjacents. L'exemple est celui de rru du clade alpha. L'idée de départ de ces prélèvements est la recherche d'opérons formés de tRNA et de protéine comme dans le cas d'E.coli: l'intercalaire entre le tRNA et la protéine devrait être faible. Voir l'exemple d'eco (remarque @3) avec tac-tac-tpr et aca-tac-gga-acc-tufB.

rru intercalaires positifs S+[modifier | modifier le wikicode]

rru. Sx+ Sc+ Les diagrammes 400
rru Sx+ Sc+
Poly3 -7 -5 -3 1 R2 flex x+ comment. -7 -5 -3 1 R2 flex c+ comment.
1 à 400 -13 90 -272 53 818 231 min50 -34 275 -804 94 878 270 min40
31 à 400 12 -97 135 28 833 269 2 parties 13 -61 -91 52 957 156 2 parties
droite -a cste - R2 note R2’ -a cste - R2 note R2’
1 à 400 103 46 - 798 dte 20 Sf 181 62 - 739 poly 139 SF
31 à 400 86 41 - 797 dte 36 tf 137 50 - 916 dte 41 tf
  • Légende du tableau corrélations et fréquences faibles
rru. Sx+ Sc+ Les diagrammes 400. Corrélations et les fréquences faibles 1-30
effectifs diagramme corrélation x+ c+, 41-n corrélation x+ c+, 1-n
gen minima x+ c+ total 400 200 250 diff 200 250 400
spl min10 1071 2215 3286 884 735 784 49 -353 -202 172
rru min40 874 2056 2930 829 193 611 418 722 792 861
mja min30 406 1047 1453 776 326 571 245 844 857 881
1-30 ‰ effectifs 0 ‰ <0 ‰ effectifs 1-40 corel
1-30 x+ 1-30 c+ x+/c+ x c x c x- c- x+ c+ x+/c+
37 270 0.14 1313 2900 1 6 9 143 69 683 -342
169 266 0.64 1037 2749 1 4 71 222 175 630 17
239 405 0.59 495 1234 20 9 113 132 113 474 502
  • Diagrammes 400:  rru ade,   diagramme 1-40: c+ rruc+ adex+ rrux+ adetotal,   texte: ade.
  • Résumé: Ici je ne compare que les 2 génomes rru et ade en sachant que pmg est semblable à ade. Car rru et ade se ressemblent beaucoup avec des effectif des diagrammes 400 presque égaux, 2930 contre 3471, et un rapport des fréquences faibles c+/x+ aussi presque égaux, 0.64 contre 0.66. Par contre les corrélations à 41-250 sont très différentes, 611 contre 758.
    - La forme des courbes 400: Les 4 courbes de rru sont identiques une à une aux 4 courbes de ade, seules les forces des courbes tildes 31-400 diffèrent, elles sont fortes pour ade, tF, et faibles pour rru, tf.
    • Les 2 courbes, c+ 1-400 rru ade, sont SF avec R2’ 139 232.
    • Les 2 courbes, x+ 1-400 rru ade, sont Sf avec R2’ 20 39.
    • Les 2 courbes rru 31-400 sont tf avec R2’ x+ à 31 et c+ à 41. Les courbes sont presque des droites mais toujours avec des renflements en 1ère partie.
    • Les 2 courbes ade 31-400 sont tF avec R2’ x+ à 67 et c+ à 103 avec 2 parties nettes.
    • Les points d’inflexion sont compris entre 230 et 271 sauf pour rru c+ 31-400 avec 156 et ade c+ 31-400 avec -507.
    - Les corrélations des courbes 400: C’est la différence la plus importante entre les 2 génômes.
    • Chez ade la corrélation 41-250, de 758 chute à 624 pour 41-200 avec une différence de 134. Et rru en parallèle passe de 611 à 193 avec une différence de 418.
    • Les 3 corrélations 1-n de ade tournent autour de 900 alors que celles de rru sont plutôt négatives -353 -202 172.
    - Les fréquences faibles 1-30:
    • Elles sont du même ordre de grandeur et dans le même rapport x+/c+: 169/266 pour rru et 221/335 pour ade, donnant les rapports respectifs 0.66 0.64.
    • Elles sont réparties sur les 3 fréquences 10 20 30 dans les 2 génomes.
    • Les minima des fréquences faibles: elles sont bien prononcées mais plus chez ade que chez rru.
    • Les fréquences des zéros sont faibles mais plus élevées chez ade avec 14‰ que chez rr avec 5‰.
    • Les fréquences négatives sont réparties entre x- et c- de la même façon chez les 2 génômes: 72/234 pour ade et 71/222 pour rru
    - La forme des courbes 1-40:
    • La courbe c+1-40: avec un effectif élevé de 876 pour ade contre 630 pour rru, les 2 courbes sont très proches de la courbe du total. Cependant les sommets à 2 et 10 de rru sont déplacés à 4 et 12 chez ade.
    • La courbe x+1-40: Les 2 courbes diffèrent du modèle c+ 1-40 et entre elles:
    • + La courbe de rru, avec un effectif de 175, n’a pas le maximum à la fréquence 2 du modèle par contre elle a le minimum à 6 et la bosse à 10 comme lui. La bosse du 10 est suivie par un plateau et non par une pente comme le modèle.
    • + La courbe de ade, avec un effectif de 304, a le maximum à la fréquence 3 du modèle par contre le minimum à 6 devient une bosse et la bosse du 11 est un creux profond. La bosse du 11 du modèle est remplacée par une forte bosse à 17.
    - Les corrélations des courbes 1-40:
    • La corrélation x+/c+ de rru à 17 est quasiment nulle et va de pair avec les coorélations négatives des courbes 400 des 3 plages de fréquences 1-n.
    • La corrélation x+/c+ de ade à 459 est moyenne et va de pair avec les coorélations élevées des courbes 400 des 3 plages de fréquences 1-n.

rru autres intercalaires[modifier | modifier le wikicode]

  • Lien tableur: rru autres intercalaires aas
  • Légende:  
    - comp, le gène est sur le brin complement
    - deb, fin sont respectivement dans le sens des adresses croissantes, le cds avant le 1er tRNA et le cds après le dernier tRNA du bloc.
  • Totaux: 11 regulatory 2 ncRNA 1 tmRNA 11 repeat_region
tRNA-cds		tRNA-tRNA		autres-cds		total	160
c+	x+	x-	c+	x+	c-	c+	x+	c-		
50	38		23			28	20		159	1 ac+
  • Méthode de calculs des intercalaires autres que les CDS-CDS voir le cas de amed.

Ochrobactrum anthropi ATCC 49188[modifier | modifier le wikicode]

oan opérons[modifier | modifier le wikicode]

  • Lien tableur: oan opérons
  • Liens: gtRNAdb [21], NCBI [22], génome [orgn]
  • Phylogénie: Bacteria; Proteobacteria; Alphaproteobacteria; Rhizobiales; Brucellaceae; Ochrobactrum.
  • Légende: cdsa: cds aas, cdsd: cds dirigé
A3. Ochrobactrum anthropi ATCC 49188
56.1%GC 27.12.19 Paris  61   doubles intercal cds aa avec aa cdsa cdsd protéines
chromosom1
34057..34446 cds 224 224 130 TIGR02300 family protein
34671..34746 gcc @1 -40 -40
34707..35480 cds 258 glutathione S-transferase family protein
223549..224394 cds 164 164 282 3'(2'),5'-bisphosphate nucleotidase CysQ
224559..224635 ccg 109 109
comp 224745..225806 cds 354 site-specific integrase
comp 337757..338197 cds 158 158 147 DMT family transporter
comp 338356..338431 ttc 171 171
comp 338603..338818 cds 72 DNA gyrase inhibitor YacG
comp 344419..344598 cds 147 147 60 hp
344746..344820 acc 397 397
345218..346030 cds 271 DUF2189 domain-containing protein
comp 351922..353328 cds 167 167 469 deoxyribodipyrimidine photo-lyase
comp 353496..353572 cgt 159 159
comp 353732..355285 cds 518 HAMP domain-containing histidine kinase
comp 725472..726479 cds 219 219 336 glycosyltransferase family 4 protein
726699..726773 caa 61 61
comp 726835..727413 cds 193 hp
comp 934613..934987 cds 333 333 125 transposase
comp 935321..935397 agg 114 114
comp 935512..936675 cds 388 amidohydrolase
1049919..1051202 cds 24 24 428 cystathionine gamma-synthase family protein
comp 1051227..1051311 ttg @2 593 593
comp 1051905..1053539 cds 545 phosphoethanolamine transferase
comp 1081066..1083021 cds 998 998 652 M23 family metallopeptidase
1084020..1085508 16s 268 1489
1085777..1085853 atc 11 11
1085865..1085940 gca 39 39
>comp 1085980..1086168 cds @3 38 38 63 P-hp
1086207..1089125 23s 186 2919
1089312..1089426 5s 54 115
1089481..1089557 atgf 363 363
1089921..1090091 cds 57 LysR family transcriptional regulator
1096454..1096912 cds 7 7 153 hp
comp 1096920..1097009 tcg 352 352
1097362..1097751 cds 130 50S ribosomal protein L21
1311344..1311823 cds 211 211 160 hp
1312035..1312109 gag 88 88
1312198..1312467 cds 90 hp
1344750..1345565 cds 677 677 272 IclR family transcriptional regulator
1346243..1347731 16s 268 1489
1348000..1348076 atc 11 11
1348088..1348163 gca 39 39
>comp 1348203..1348391 cds 38 38 63 P-hp
1348430..1351348 23s 186 2919
1351535..1351649 5s 54 115
1351704..1351780 atgf 360 360
1352141..1353082 cds 314 LysR family transcriptional regulator
1354558..1355604 cds 85 85 349 polysaccharide deacetylase family protein
comp 1355690..1355764 ggc 136 136
comp 1355901..1357280 cds 460 MFS transporter
comp 1386666..1387982 cds 819 819 439 hp
comp 1388802..1388891 tcc 374 374
1389266..1389589 cds 108 hp
comp 1405236..1405859 cds 139 139 208 5,6-dimethylbenzimidazole synthase
comp 1405999..1406085 ctg 146 146
comp 1406232..1406852 cds 207 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase
comp 1604615..1604854 cds 26 26 80 hp
comp 1604881..1604958 atgj 10 10
comp 1604969..1605214 cds 82 hp
1639492..1640289 cds -44 -44 266 hp
comp 1640246..1640322 atgj 55 55
1640378..1640572 cds 65 hp
comp 1778816..1779571 cds 385 385 252 SIMPL domain-containing protein
1779957..1780033 atgi 265 265
1780299..1780844 cds 182 sigma-70 family RNA polymerase sigma factor
> 1945985..1946374 cds 721 721 130 P-hp
comp 1947096..1947171 aag -38 -38
comp 1947134..1947319 cds 62 hp
comp 2014813..2015097 cds 103 103 95 DUF2218 domain-containing protein
comp 2015201..2015275 gaa + 146 146
comp 2015422..2015496 gaa 2 gaa 200 200
comp 2015697..2016962 cds 422 DUF882 domain-containing protein
comp 2040234..2040453 cds 91 91 73 hp
2040545..2040629 tac 24 24
2040654..2040727 gga 6 6
comp 2040734..2040916 cds -50 -50 61 hp
2040867..2042042 cds 65 65 392 elongation factor Tu
2042108..2042183 tgg 420 420
2042604..2042804 cds 67 preprotein translocase subunit SecE
2168416..2168658 cds 28 28 81 PepSY domain-containing protein
comp 2168687..2168760 ggg 289 289
2169050..2169946 cds 299 lipid kinase
comp 2244184..2245050 cds 112 112 289 mechanosensitive ion channel
comp 2245163..2245248 tta 200 200
2245449..2246705 cds 419 threonine ammonia-lyase IlvA
2267888..2268835 cds 305 305 316 patatin family protein
2269141..2269225 ctc 66 66
comp 2269292..2270185 cds 298 tyrosine-type recombinase/integrase
2332394..2333530 cds 393 393 379 glycosyltransferase family 2 protein
comp 2333924..2334000 cgg 169 169
comp 2334170..2335792 cds 541 ABC-F family ATP-binding cassette domain-containing protein
comp 2339396..2340514 cds 1650 1650 373 porin
comp 2342165..2342239 gtg 178 178
comp 2342418..2344424 cds 669 murein L,D-transpeptidase
comp 2369668..2370441 cds 152 152 258 NAD kinase
2370594..2370669 aca 987 987
comp 2371657..2372076 cds 140 SUF system Fe-S cluster assembly protein
comp 2442729..2443145 cds 299 299 139 hp
comp 2443445..2443519 atgf 70 70
<comp 2443590..2443799 cds 70 helix-turn-helix domain-containing protein
comp 2449947..2451311 cds 156 156 455 tyrosine-type recombinase/integrase
comp 2451468..2451550 cta 236 236
comp 2451787..2452356 cds 190 hp
comp 2548914..2550098 cds 513 513 395 alpha/beta hydrolase
comp 2550612..2550688 gac + 245 245
comp 2550934..2551010 gac 2 gac 328 328
2551339..2551956 cds 206 TetR/AcrR family transcriptional regulator
2604616..2605908 cds 824 824 431 FAD-binding oxidoreductase
comp 2606733..2606808 gta 264 264
comp 2607073..2607996 cds 308 sugar kinase
2641040..2641360 cds 97 97 107 YnfA family protein
2641458..2641534 ccc 94 94
2641629..2642357 cds 243 SDR family oxidoreductase
2696299..2697183 cds 54 54 295 transcriptional regulator GcvA
comp 2697238..2697314 aga 123 123
comp 2697438..2697743 cds 156 156 102 ETC complex I subunit
comp 2697900..2697976 cca 186 186
2698163..2698309 cds 49 hp
comp 2771579..2772697 cds 584 584 373 porin
2773282..2773372 agc 203 203
2773576..2774643 cds 356 porin
chromosom2
149537..151504 cds 355 355 656 selenocysteine-specific translation elongation factor
151860..151955 tga 14 14
comp 151970..152605 cds 212 lipase
comp 298403..299422 cds 300 300 340 TerC family protein
comp 299723..299796 cag 361 361
comp 300158..300460 cds 101 DUF1127 domain-containing protein
455428..456111 cds 713 713 228 FkbM family methyltransferase
456825..458313 16s 268 1489
458582..458658 atc 11 11
458670..458745 gca 39 39
>comp 458785..458973 cds 38 38 63 P-hp
459012..461930 23s 186 2919
462117..462231 5s 54 115
462286..462362 atgf -44 -44
comp 462319..463974 cds 552 recombinase family protein
comp 572059..572721 cds 545 545 221 response regulator transcription factor
comp 573267..573357 other @4 620 620
comp 573978..575285 cds 436 SidA/IucD/PvdA family monooxygenase
comp 611464..611742 cds 88 88 93 hp
comp 611831..611905 ggc 387 387
612293..612814 cds 174 prolyl-tRNA synthetase associated domain-containing protein
991265..991999 cds 217 217 245 alpha/beta hydrolase
comp 992217..992306 tca 323 323
992630..992884 cds 85 DUF2171 domain-containing protein
comp 1031528..1032946 cds 607 607 473 PepSY domain-containing protein
comp 1033554..1033629 aaa 327 327
1033957..1035651 cds 565 membrane protein
1067405..1068742 cds 131 131 446 DNA polymerase IV
1068874..1068947 tgc 739 739
1069687..1069905 cds 73 hp
1081639..1082031 cds 103 103 131 hp
comp 1082135..1082209 aac 168 168
1082378..1082653 cds 92 hp
comp 1333375..1333587 cds 209 209 71 hp
comp 1333797..1333873 cac 352 352
1334226..1337393 cds 1056 PAS domain S-box protein
1473437..1474405 cds 269 269 323 nitronate monooxygenase
1474675..1474750 acg 156 156
>comp 1474907..1475239 cds 111 DNA adenine methylase
comp 1597496..1597666 cds 363 363 57 LysR family transcriptional regulator
comp 1598030..1598106 atgf 54
comp 1598161..1598275 5s 186 115
comp 1598462..1601380 23s 38 38 2919
< 1601419..1601607 cds 39 39 63 P-hp
comp 1601647..1601722 gca 11 11
comp 1601734..1601810 atc 268
comp 1602079..1603567 16s 743 743 1489
1604311..1605192 cds 294 ATPase
1720169..1720531 cds 113 113 121 response regulator
1720645..1720719 gtc 465 465
1721185..1721838 cds 218 protein-L-isoaspartate(D-aspartate) O-methyltransferase

oan cumuls[modifier | modifier le wikicode]

cumuls. oan.
opérons Fréquences intercalaires tRNAs Fréquences intercalaires cds Fréquences aas cds chromosome
effectif gammes sans rRNAs avec rRNAs gammes cds gammes cdsd gammes cdsa gammes cdsa 300
avec rRNA opérons 4 1 4 1 5 1 100 25 1 0
16atcgca-cds 4 20 50 15 40 200 20 30 0
- 40 1 100 12 80 300 21 60 4
- 60 150 12 120 400 15 90 18
max a 3 80 200 15 160 500 11 120 8
a doubles 0 100 250 7 200 600 5 150 9
spéciaux 0 120 300 6 240 700 3 180 3
total aas 12 140 350 5 280 800 0 210 6
sans opérons 45 160 1 400 12 320 900 0 240 4
1 aa 42 180 450 1 360 1000 0 270 6
max a 2 200 500 1 400 1100 1 300 8
a doubles 2 1 16 0 35
total aas 48 3 4 107 0 101 101
total aas 60
remarques 4
avec jaune moyenne 138 11 258 256
variance 111 0 268 180
sans jaune moyenne 174 218 150
variance 117 132 81

oan tRNA-cds[modifier | modifier le wikicode]

  • Note: intercalaires prélevés de la colonne cds de oan opérons dans un bloc de tRNAs uniquement. Le début du bloc est dans l'ordre des adresses, deb intercalaire entre le cds et le 1er tRNA dd bloc, fin entre le dernier tRNA et le cds terminal. J'ai procédé, dans les colonnes petit et grand, à la réorientation des blocs d'après la constatation que les blocs à rRNA ont leurs cds de début et de fin sont orientés du cds-16s au 5s-tRNAs-cds, l'intercalaire cds-16s étant plus grands que l'intercalaire avec le cds terminal. En tête de colonne est le % du nombre des intercalaires inférieurs à 201 pbs.
oan	53			56			31			78
deb	fin		deb	fin		grand	petit		grand	petit
-44	55		224	-40		26	10		55	-44
7	352		721	-38		55	-44		224	-40
24	593		91	6		91	6		721	-38
26	10		26	10		97	94		91	6
28	289		355	14		123	54		352	7
54	123		-44	55		136	85		26	10
65	420		219	61		146	139		355	14
85	136		305	66		164	109		593	24
88	387		299	70		167	159		289	28
91	6		211	88		168	103		123	54
97	94		97	94		171	158		219	61
103	200		164	109		186	156		420	65
103	168		333	114		200	103		305	66
112	200		54	123		200	112		299	70
113	465		85	136		211	88		136	85
131	739		139	146		219	61		211	88
139	146		269	156		224	-40		387	88
147	397		167	159		236	156		97	94
152	987		103	168		269	156		168	103
156	236		393	169		289	28		200	103
156	186		158	171		299	70		164	109
158	171		1650	178		305	66		200	112
164	109		156	186		323	217		465	113
167	159		103	200		333	114		333	114
209	352		112	200		352	7		739	131
211	88		584	203		352	209		146	139
217	323		156	236		355	14		397	147
219	61		824	264		361	300		987	152
224	-40		385	265		385	265		269	156
269	156		28	289		387	88		186	156
299	70		217	323		393	169		236	156
300	361		607	327		397	147		171	158
305	66		513	328		420	65		167	159
333	114		7	352		465	113		393	169
355	14		209	352		513	328		1650	178
385	265		300	361		584	203		584	203
393	169		819	374		593	24		352	209
513	328		88	387		607	327		323	217
545	620		147	397		620	545		824	264
584	203		65	420		721	-38		385	265
607	327		113	465		739	131		361	300
721	-38		24	593		819	374		607	327
819	374		545	620		824	264		513	328
824	264		131	739		987	152		819	374
1650	178		152	987		1650	178		620	545
  • Comparaison cds-cds tRNA-cds: deb fin, c'est l'ordre des adresses et grand petit l'ordre après réorientation. Leur pourcentage est calculé par rapport à la colonne, c'est à dire la moitié du total des tRNA-cds.
alpha	cds total	total	<0	0-200	201-370	371-600	>600	deb	fin	grand	petit
oan	4,900		90	3	46	22	11	8	23	23	14	32
‰				33	511	244	122	89	511	511	311	711

oan blocs[modifier | modifier le wikicode]

  • Lien tableur: oan blocs
  • Légende:
    p-hp   pseudo hypothetical protein
A3. oan, blocs à rRNA.
Constantes
cds intercal cdsa
16s 268 1489
atc 11
gca 39
cds 38 63 p-hp
23s 186 2919
5s 54 115
atgf
cds
Variations
bloc 16s intercal cdsa
1084020..1085508 998 652 M23 family metallopeptidase
363 57 LysR family transcriptional regulator
1346243..1347731 677 272 IclR family transcriptional regulator
360 314 LysR family transcriptional regulator
456825..458313 713 228 FkbM family methyltransferase
-44 552 recombinase family protein
1602079..1603567 743 294 ATPase
363 57 LysR family transcriptional regulator
  • Détails: tous les blocs sont identiques avec comp' pour le cds du mileieu (jaune). Comp' pour sens direct quand les autres sont complement et complement quand les autres sont directs. Trois cds externes sont comp' aussi. Les intercalaires entourant ces cds sont en gras et primés.
A3. oan, blocs à rRNA.
cds 743’ 713 677 998’
16s 268 268 268 268
atc 11 11 11 11
gca 39’ 39’ 39’ 39’
cds 38’ 38’ 38’ 38’
23s 186 186 186 186
5s 54 54 54 54
atgf 363 -44' 360 363
cds

oan remarques[modifier | modifier le wikicode]

  • Remarques: Par rapport aux rickettsia rtb et rpl, les intercalaires très élevés existent, 3 contre 10, 987 988 1650. Ce génome est analogue à agr pour les cds internes aux blocs à RNAs.
    1. @ Des intercalaires négatifs avec les cds, 5, de -40 à -50 même dans un bloc à rRNAs, -44.
    2. @ Les intercalaires avec les cds élevés supérieurs à 500, 16 dont 4 pour les blocs. Voir le tableau des intercalaires ci-dessous .
      - Par rapport à agr analogue de ce génome, il y a nettement plus d’intercalaires élevés. Sur 45 blocs à aas il y a 12 intercalaires supérieurs à 500, contre 6 pour 38 aas chez agr.
      - Un seul cas où les 2 intercailaires d’un cluster sont supérieurs à 500, other, voir @4 ici.
      - Tous les 11 autres paires sont très assymétriques.
      - 2 intercalaires sur 3 entre aas sont du même ordre que la moyenne de ceux des cds sans jaune, 245 et 146 contre 174 pour la moyenne de ceux des cds.
    3. @ Les blocs à rRNAs sont identiques et ne diffèrent que par l’intercalaire du cds.
      - Le cds intra blocs est une pseudo protéine hypothétique, de faible taille, 63aas.
      - Ses intercalaires avec gca et 23s sont quasi identiques, très faibles et se situent dans la 1ère gamme des intercalaires cds.
    4. @ other, cela doit être un tRNA incomplet comme ceux des mitochondries
  • Note: les cds intra bloc à rRNAs. Les 4 blocs sont identiques. Cela veut dire que le cds interne est bien du au processus de la création des blocs. Le fait que le cds soit un pseudo renforce encore l’hypothèse de la création de ce cds par le processus de création ou de conversion. Voir remarque @2 de agr remarques.
  • Note du 3.10.20: le contrôle des 4 cds montre qu'ils sont absents au 31.7.20, date du NCBI.
  • Séquences des doubles, quasiment pas de doubles, 42 solitaires sur 45 opérons et 2 doubles seulement, gac et gaa.
  • Tableau des intercalaires
						
Intercalaires élevés		Intercalaires moyens	
pbs	adresse	RNA		pbs	adresse	tRNA
1650	2342165	gtg		465	1720645	gtc
987	2370594	aca		420	2042108	tgg
824	2606733	gta		397	344746	acc
819	1096920	tcg		387	611831	ggc
739	1068874	tgc		385	1779957	atgi
721	1947096	aag		363	1089481	atgf
620	573267	other isolé	363	1598030	atgf
607	1033554	aaa		352	1333797	cac
593	1051227	ttg		333	935321	agg
584	2773282	agc		323	992217	tca
513	2550612	gac		305	2269141	ctc
						
998	1084020	16s				
743	1602079	16s				
713	456825	16s				
677	1346243	16s				

oan distribution[modifier | modifier le wikicode]

Al5 oan, Ochrobactrum anthropi ATCC 49188 . alpha.
g1    t1       
atgi 1 tct tat atgf 5
att act aat agt
ctt cct cat cgc
gtt gct gat ggt
ttc 1 tcc 1 tac 1 tgc 1
atc 4 acc 1 aac 1 agc 1
ctc 1 ccc 1 cac 1 cgt 1
gtc 1 gcc 1 gac 2 ggc 2
tta 1 tca 1 taa tga 1
ata aca 1 aaa 1 aga 1
cta 1 cca 1 caa 1 cga
gta 1 gca 4 gaa 2 gga 1
ttg 1 tcg 1 tag tgg 1
atgj 2 acg 1 aag 1 agg 1
ctg 1 ccg 1 cag 1 cgg 1
gtg 1 gcg gag 1 ggg 1
alpha >1aa =1aa -5s +5s -16s +16s total
oan 6 41 4 8 59

oan1. Intergen51[modifier | modifier le wikicode]

Intergen51. oan1. Le génome[modifier | modifier le wikicode]

  • oan1 Le prélèvement: Aalpha
  • Le nom et le lien NCBI: oan1, Brucella anthropi ATCC 49188 chromosome 1, NCBI [23], date 1.8.21.
  • oan1 La longueur totale des intercalaires, longueur du génome et taux intercalaires/génome:
Nom	intercals	génome		taux en %			
oan1	364,228		2,887,297	12.6	
oan1 données intercalaires[modifier | modifier le wikicode]
oan1 données intercalaires 200[modifier | modifier le wikicode]
oan1 autres intercalaires aas[modifier | modifier le wikicode]

Intergen51. oan1. Les différents types d'intercalaires[modifier | modifier le wikicode]

  • Lien au tableur: Intergen51. oan1 les différents types d'intercalaires.
  • Légende:
    - S pour intercalaire CDS-CDS et R pour tRNA-CDS,
    - c pour intercalaire continu (les 2 gènes sont sur le même brin) et x pour discontinu (les 2 gènes sont sur 2 brins différents, le brin et son complément)
    - %reste = 100*reste/total, le reste étant ce qui reste du total après la fin du diagramme, gamme.
    - %t30 = 100*t30/total, t30 étant le total des fréquences 10 20 30
    - %t5 = 100*t/total, t5 étant le total des fréquences de -1 à -5 dans le diagramme des S-.
Int51.2 oan1 les différents types d'intercalaires entre gène
Int51.21 Les différents types
intercalaires CDS-CDS * autres intercalaires
continu S+ S- S0 total c/x RNA-RNA CDS-rRNA total
c 1,508 402 9 1,919 2.3 13 1 14
x 759 55 12 826 0 1 1
t 2,267 457 21 2,745 13 2 15
% 82.6 16.6 0.8
Int51.22 Détail des * autres intercalaires
intercalaires tRNA-CDS récapitulatif des * autres intercalaires
continu R+ R- R0 total c/x * autres total %
c 44 0 0 44 1.7 tRNA-CDS 70 67
x 25 1 0 26 RNA-RNA 13 12
t 69 1 0 70 CDS-rRNA 2 2
% 98.6 1.4 0.0 non RNA 20 19
- total 105 100
Int51.23 Les taux remarquables
taux %reste %t30 %t5 %0
type S+ R+ S- S+ R+ S- S+ R+
gamme 400 400 6-50 - - - - -
type S+ R+ S- S+ R+ S- S+ R+
c 4.6 11.4 1.0 27.4 4.5 77 0.5 0.0
x 9.1 19.2 5.5 11.3 11.5 42 1.5 0.0

Intergen51. oan1. Les diagrammes CDS-CDS positifs[modifier | modifier le wikicode]

  • Lien tableur: Les diagrammes
  • Diagrammes des gamma:  oan1 présente 2 diagrammes
    - fc40, CDS-CDS continu, fréquence unitaire en abscisses et effectif en ordonnées
    - fx%, CDS-CDS discontinu, fréquences regroupées par 10 (freq10) en abscisses et pourcentage en ‰ par rapport au total, en ordonnées.
  • Équations des courbes de tendance en pour 1000: colonnes %fx %fc
Courbes de tendances pour les diagrammes en pour 1000			Calculs des f.41	oan1
R2	x3		x2		x		c		Inflexion poly3	x	c
0.686	-3.12E-08	8.32E-05	-1.21E-01	43.0	fx1	abscisse	269.0	188.1
0.707	-5.22E-06	3.95E-03	-9.93E-01	96.4	fc1	ordonnée	16.4	21.0
								
0.758	-1.45E-06	1.17E-03	-3.74E-01	60.6	fx41			
0.901	1.59E-06	-8.98E-04	3.01E-02	36.5	fc41			
  • Moyennes glissantes fc+400, diagonale. Voir le détail des calculs dans abs.
données	oan1		calculs			poly3	oan1
effect	1517		R2.21	779		abscis	400
xm	45		pte	7,98		flexa	184
ym	4		cste	3,00		flexo	2,09
x1m	250		r400l	150		xm	45
y1m	1		restp	154,25		sup4	155,7
rfin	46,14		%sd	36,50		sup4t	418,6
bornf	155		lond	205		%	37,2
supd	189,6		%sf	36,48		long	139
supdt	519,4		lonf	110			
xmp	326,30		sf/lf	1,17			
r400	108,11		sr/lr	0,64			
supf	128,4		sd/ld	0,92			
supft	352,0		i.r400	0,72							

Intergen51. oan1. Les CDS-CDS négatifs[modifier | modifier le wikicode]

Sous-totaux	oan1			totale	
fréquence	x-	c-		x-	c-
 - 1		0	93		4	4140
 - 2		1	0		85	11
 - 3		0	0		3	12
 - 4		22	215		717	10938
 - 5		0	0		5	19
sp6		32	94		1642	8424
total		55	402		2,456	23,544
reste		3	4		264	420
s6		9	2		361	41
s7		10	13		321	1438
s8		10	75		696	6525
rappot s1-5						
4/2/1		22.0	2.3		8.4	2.6
% / sp6						
s6/sp6		28.1	2.1		22.0	0.5
s7/sp6		31.3	13.8		19.5	17.1
s8/sp6		31.3	79.8		42.4	77.5
reste/sp6	9.4	4.3		16.1	5.0
						
total s1-5	23	308		814	15120
% / total						
%s1-5		41.8	76.6		33.1	64.2
%sp6		58.2	23.4		66.9	35.8

Intergen51. oan1. Les intercalaires des blocs[modifier | modifier le wikicode]

  • Le détail
RNA-RNA		c	x		CDS-RNA		c	x
23s 5s		2			CDS 16s		1	1
16s 23s					5s CDS			
16s tRNA	2			16 CDS			
tRNA 23s	2			CDS 5s			
5s tRNA		2			23s CDS			
tRNA in		2			CDS 23s			
tRNA contig				5s 16s			
tRNA hors	3			16s16s			
tRNA 16s								
23s tRNA								
tRNA 5s								
16s 5s								
5s 23s								
5s 5s								
total		13	0		total		1	1
  • Les rares voir gamma pour la longueur des intercalaires
  • Les tRNA-CDS compris, comparaison dans le clade et dans l'étude.

Intergen51. oan1. Les intercalaires tRNA-tRNA extra bloc[modifier | modifier le wikicode]

oan2. Intergen51[modifier | modifier le wikicode]

Intergen51. oan2. Le génome[modifier | modifier le wikicode]

  • oan2 Le prélèvement: Aalpha
  • Le nom et le lien NCBI: oan2, Brucella anthropi ATCC 49188 chromosome 2, NCBI [24], date 1.8.21.
  • oan2 La longueur totale des intercalaires, longueur du génome et taux intercalaires/génome:
Nom	intercals	génome		taux en %			
oan2	199,249		1,895,911	10.5	
oan2 données intercalaires[modifier | modifier le wikicode]
oan2 données intercalaires 200[modifier | modifier le wikicode]
oan2 autres intercalaires aas[modifier | modifier le wikicode]

Intergen51. oan2. Les différents types d'intercalaires[modifier | modifier le wikicode]

  • Lien au tableur: Intergen51. oan2 les différents types d'intercalaires.
  • Légende:
    - S pour intercalaire CDS-CDS et R pour tRNA-CDS,
    - c pour intercalaire continu (les 2 gènes sont sur le même brin) et x pour discontinu (les 2 gènes sont sur 2 brins différents, le brin et son complément)
    - %reste = 100*reste/total, le reste étant ce qui reste du total après la fin du diagramme, gamme.
    - %t30 = 100*t30/total, t30 étant le total des fréquences 10 20 30
    - %t5 = 100*t/total, t5 étant le total des fréquences de -1 à -5 dans le diagramme des S-.
Int51.2 oan2 les différents types d'intercalaires entre gène
Int51.21 Les différents types
intercalaires CDS-CDS * autres intercalaires
continu S+ S- S0 total c/x RNA-RNA CDS-rRNA total
c 913 292 1 1,206 2.5 10 1 11
x 458 28 2 488 0 1 1
t 1,371 320 3 1,694 10 2 12
% 80.9 18.9 0.2
Int51.22 Détail des * autres intercalaires
intercalaires tRNA-CDS récapitulatif des * autres intercalaires
continu R+ R- R0 total c/x * autres total %
c 14 0 0 14 1.4 tRNA-CDS 24 52
x 9 1 0 10 RNA-RNA 10 22
t 23 1 0 24 CDS-rRNA 2 4
% 95.8 4.2 0.0 non RNA 10 22
- total 46 100
Int51.23 Les taux remarquables
taux %reste %t30 %t5 %0
type S+ R+ S- S+ R+ S- S+ R+
gamme 400 400 6-50 - - - - -
type S+ R+ S- S+ R+ S- S+ R+
c 3.5 35.7 0.7 34.1 0.0 83 0.1 0.0
x 8.7 0.0 7.1 13.7 10.0 50 0.4 0.0

Intergen51. oan2. Les diagrammes CDS-CDS positifs[modifier | modifier le wikicode]

  • Lien tableur: Les diagrammes
  • Diagrammes des gamma:  oan2 présente 2 diagrammes
    - fc40, CDS-CDS continu, fréquence unitaire en abscisses et effectif en ordonnées
    - fx%, CDS-CDS discontinu, fréquences regroupées par 10 (freq10) en abscisses et pourcentage en ‰ par rapport au total, en ordonnées.
  • Équations des courbes de tendance en pour 1000: colonnes %fx %fc
Courbes de tendances pour les diagrammes en pour 1000			Calculs des f.41	oan2
R2	x3		x2		x		c		Inflexion poly3	x	c
0.685	-1.69E-07	3.15E-04	-2.02E-01	49.5	fx1	abscisse	202.3	129.8
0.772	-7.79E-06	5.93E-03	-1.46E+00	126.0	fc1	ordonnée	21.4	26.7
								
0.678	1.73E-06	-1.05E-03	8.71E-02	32.4	fx41			
0.863	1.04E-06	-4.05E-04	-1.06E-01	45.0	fc41			
  • Moyennes glissantes fc+400, diagonale. Voir le détail des calculs dans abs.
données	oan2		calculs			poly3	oan2
effect	914		R2.21	749		abscis	250
xm	45		pte	7,52		flexa	144
ym	2		cste	2,53		flexo	2,39
x1m	203		r400l	197		xm	45
y1m	1		restp	166,30		sup4	133,7
rfin	35,01		%sd	49,97		sup4t	330,4
bornf	171		lond	158		%	40,5
supd	213,2		%sf	51,30		long	99
supdt	426,7		lonf	126			
xmp	407,00		sf/lf	1,55			
r400	131,29		sr/lr	0,54			
supf	195,9		sd/ld	1,35			
supft	381,8		i.r400	0,67								

Intergen51. oan2. Les CDS-CDS négatifs[modifier | modifier le wikicode]

Sous-totaux	oan2			totale	
fréquence	x-	c-		x-	c-
 - 1		0	48		4	4140
 - 2		1	0		85	11
 - 3		1	0		3	12
 - 4		12	195		717	10938
 - 5		0	0		5	19
sp6		14	49		1642	8424
total		28	292		2,456	23,544
reste		2	2		264	420
s6		4	0		361	41
s7		4	6		321	1438
s8		4	41		696	6525
rappot s1-5						
4/2/1		12.0	4.1		8.4	2.6
% / sp6						
s6/sp6		28.6	0.0		22.0	0.5
s7/sp6		28.6	12.2		19.5	17.1
s8/sp6		28.6	83.7		42.4	77.5
reste/sp6	14.3	4.1		16.1	5.0
						
total s1-5	14	243		814	15120
% / total						
%s1-5		50.0	83.2		33.1	64.2
%sp6		50.0	16.8		66.9	35.8

Intergen51. oan2. Les intercalaires des blocs[modifier | modifier le wikicode]

  • Le détail
RNA-RNA		c	x		CDS-RNA		c	x
23s 5s		2			CDS 16s		1	1
16s 23s					5s CDS			
16s tRNA	2			16 CDS			
tRNA 23s	2			CDS 5s			
5s tRNA		2			23s CDS			
tRNA in		2			CDS 23s			
tRNA contig				5s 16s			
tRNA hors				16s16s			
tRNA 16s								
23s tRNA								
tRNA 5s								
16s 5s								
5s 23s								
5s 5s								
total		10	0		total		1	1
  • Les rares voir gamma pour la longueur des intercalaires
  • Les tRNA-CDS compris, comparaison dans le clade et dans l'étude.

Intergen51. oan2. Les intercalaires tRNA-tRNA extra bloc[modifier | modifier le wikicode]

Azospirillum brasilense Az39[modifier | modifier le wikicode]

abq opérons[modifier | modifier le wikicode]

  • Lien tableur: abq opérons
  • Liens: gtRNAdb [25], NCBI [26], génome [27]
  • Phylogénie: Bacteria; Proteobacteria; Alphaproteobacteria; Rhodospirillales; Rhodospirillaceae; Azospirillum.
  • Légende: cdsa: cds aas, cdsd: cds dirigé
A2. Azospirillum brasilense strain Az39
68.45%GC 29.12.19 Paris  88   doubles intercal cds aa avec aa cdsa cdsd protéines
chromosome
125527..126444 cds 127 127 306 restriction endonuclease
comp 126572..126647 gcg 206 206
126854..127138 cds 95 YggT family protein
comp 163237..164982 cds 175 175 582 hydrogenase maturation nickel metallochaperone HypA
165158..165234 agg 59 59
165294..166022 cds 243 SDR family NAD(P)-dependent oxidoreductase
comp 188235..189860 cds 42 42 542 glycosyltransferase
comp 189903..189977 acg 81 81
comp 190059..191987 cds 643 DNA helicase RecQ
comp 250833..251111 cds 169 169 93 hp
comp 251281..251356 gcc 141 141
comp 251498..251893 cds 132 TIGR02300 family protein
comp 458142..458459 cds 209 209 106 50S ribosomal protein L21
458669..458758 tcg 63 63
comp 458822..459664 cds 281 alpha/beta hydrolase fold domain-containing protein
comp 496776..497171 cds 162 162 132 cupin domain-containing protein
comp 497334..497420 ttg 137 137
497558..498085 cds 176 disulfide bond formation protein B
comp 615937..616350 cds 121 121 138 hp
comp 616472..616548 ccg + 206 206
comp 616755..616831 ccg 2 ccg 109 109
comp 616941..617957 cds 339 farnesyltranstransferase
comp 748703..749161 cds 38 38 153 hp
comp 749200..749275 aca 91 91
comp 749367..750221 cds 144 144 285 23s rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
750366..750451 tac 60 60
750512..750585 gga 81 81
750667..751857 cds 153 153 397 elongation factor Tu
752011..752086 tgg 69 69
752156..752353 cds 66 preprotein translocase subunit SecE
comp 794457..795983 cds 296 296 509 methyltransferase domain-containing protein
796280..796355 aag + 76 76
796432..796507 aag 2 aag 109 109
comp 796617..797057 cds 147 MaoC family dehydratase
870412..872373 cds 159 159 654 RNA polymerase sigma factor RpoD
872533..872608 atgi 5 5
comp 872614..873093 cds 134 134 160 GNAT family N-acetyltransferase
comp 873228..873304 cgt 212 212
873517..874023 cds 169 hp
931962..933011 cds 68 68 350 low specificity L-threonine aldolase
933080..933155 gag + 38 38
933194..933269 gag 2 gag 72 72
comp 933342..934340 cds 333 transglycosylase SLT domain-containing protein
997881..998357 cds 246 246 159 peptidoglycan-associated lipoprotein Pal
comp 998604..998678 acc 175 175
comp 998854..1000815 cds 654 polysaccharide biosynthesis protein
comp 1164137..1165048 cds 159 159 304 DUF3108 domain-containing protein
1165208..1165282 gtg + 132 132
1165415..1165489 gtg 2 gtg 231 231
1165721..1165885 cds 55 hp
1242416..1242919 cds 85 85 168 MerR family transcriptional regulator
1243005..1243081 ccc 139 139
comp 1243221..1244999 cds 593 cyclic nucleotide-binding domain-containing protein
comp 1353398..1353895 cds 118 118 166 hp
1354014..1354091 cca 49 49
1354141..1354437 cds 10 10 99 ETC complex I subunit
1354448..1354524 aga 443 443
1354968..1355213 cds 82 hp
comp 1370270..1370500 cds 196 196 77 hp
comp 1370697..1370772 aac @2 220 220
comp 1370993..1371066 tgc 218 218
1371285..1371941 cds 219 protein-L-isoaspartate O-methyltransferase
comp 1427443..1427733 cds 236 236 97 YkgJ family cysteine cluster protein
comp 1427970..1428085 5s 129 116
comp 1428215..1430967 23s 266 2753
comp 1431234..1431309 gca 30 30
comp 1431340..1431416 atc 108
comp 1431525..1433015 16s 779 779 1491
1433795..1437778 cds 1328 non-ribosomal peptide synthetase
comp 1576457..1577296 cds 243 243 280 aldo/keto reductase
comp 1577540..1577615 gaa 123 123
comp 1577739..1579538 cds 600 single-stranded-DNA-specific exonuclease RecJ
comp 1723089..1723457 cds 344 344 123 NADH-quinone oxidoreductase subunit A
comp 1723802..1723878 gac 164 164
comp 1724043..1724117 gta 106 106
comp 1724224..1724496 cds 91 HU family DNA-binding protein
comp 1730385..1731719 cds 91 91 445 trigger factor
comp 1731811..1731895 cta 173 173
comp 1732069..1733634 cds 522 malonyl-CoA decarboxylase
comp 1733741..1735207 cds 129 129 489 bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase
comp 1735337..1735412 cac + 109 109
comp 1735522..1735597 cac 2 cac 337 337
1735935..1736273 cds 113 P-II family nitrogen regulator
1951126..1951752 cds 149 149 209 nitrogen fixation protein NifQ
1951902..1951987 tac 74 74
comp 1952062..1952424 cds 121 hp
1996903..1997244 cds 595 595 114 hp
comp 1997840..1997914 atgj 131 131
comp 1998046..1999179 cds 378 tRNA 2-thiouridine(34) synthase MnmA
2086487..2088658 cds 156 156 724 malate synthase G
comp 2088815..2088889 gtc 234 234
2089124..2090002 cds 293 N-formylglutamate amidohydrolase
comp 2303404..2303880 cds 414 414 159 bacterioferritin
comp 2304295..2304377 tta 406 406
comp 2304784..2305029 cds 82 hp
2482875..2484518 cds 365 365 548 recombinase family protein
comp 2484884..2484974 tcc 120 120
comp 2485095..2485898 cds 268 alpha/beta hydrolase
comp 2640759..2641325 cds 149 149 189 prolyl-tRNA synthetase associated domain-containing protein
2641475..2641549 ggc 688 688
2642238..2642915 cds 226 dimethylmenaquinone methyltransferase
comp 2764482..2765567 cds 659 659 362 hp
comp 2766227..2766300 ggg 35 35
comp 2766336..2766995 cds 220 N-acetyltransferase
2781933..2783774 cds 187 187 614 EAL and GGDEF domain-containing protein
comp 2783962..2784077 5s 129 116
comp 2784207..2786959 23s 255 2753
comp 2787215..2787290 gca 30 30
comp 2787321..2787397 atc 108
comp 2787506..2789006 16s 496 496 1501
comp 2789503..2790207 cds 235 phosphatase PAP2 family protein
2843264..2843443 cds 77 77 60 hp
comp 2843521..2843597 cgt 170 170
2843768..2844268 cds 167 xanthine phosphoribosyltransferase
plasmide2
comp 51090..51836 cds 481 481 249 sigma-70 family RNA polymerase sigma factor
comp 52318..52393 tgg 363 363
52757..53587 cds 277 hp
comp 809229..810019 cds 870 870 264 IS5 family transposase
comp 810890..810966 atgf 96
comp 811063..811178 5s 127 116
comp 811306..814058 23s 266 2753
comp 814325..814400 gca 30 30
comp 814431..814507 atc 108
comp 814616..816106 16s 452 452 1491
comp 816559..817443 cds 295 helix-turn-helix domain-containing protein
plasmide4
196992..199346 cds 148 148 785 mechanosensitive ion channel
199495..199581 ctg 30 30
199612..199687 gcc 188 188
199876..201333 cds 486 hp
237538..238578 cds 92 92 347 response regulator
comp 238671..238747 cgg 96 96
comp 238844..239821 cds 326 alpha/beta hydrolase
comp 257739..258470 cds 125 125 244 lipoyl(octanoyl) transferase LipB
258596..258682 ctc 123 123
comp 258806..259108 cds 101 STAS domain-containing protein
comp 399367..400527 cds 278 278 387 PQQ-dependent sugar dehydrogenase
comp 400806..400921 5s 129 116
comp 401051..403803 23s 255 2753
comp 404059..404134 gca 30 30
comp 404165..404241 atc 108
comp 404350..405850 16s 502 502 1501
comp 406353..406547 cds 65 hp
504531..504893 cds 82 82 121 response regulator
504976..505051 aac 3 3
505055..505131 gac 4 4
505136..505210 ggc 102 102
comp 505313..506080 cds 83 83 256 helix-turn-helix transcriptional regulator
506164..506790 cds 202 202 209 pyridoxamine 5'-phosphate oxidase
comp 506993..507108 5s 127 116
comp 507236..509988 23s 266 2753
comp 510255..510330 gca 30 30
comp 510361..510437 atc 110
comp 510548..512038 16s 615 615 1491
512654..513568 cds 305 lytic transglycosylase domain-containing protein
comp 588108..590768 cds 340 340 887 bifunctional acetaldehyde-CoA/alcohol dehydrogenase
591109..591184 ttc 286 286
591471..592979 cds 503 FAD-binding oxidoreductase
plasmide5
86421..87089 cds 455 455 223 RraA family protein
87545..87619 ggc 193 193
87813..88865 cds 351 UDP-N-acetylglucosamine 4,6-dehydratase (inverting)
plasmide1 @3
>comp 115594..115896 cds 394 394 101 P-IS5/IS1182 family transposase
comp 116291..116367 atgf 96
comp 116464..116579 5s 129 116
comp 116709..119461 23s 255 2753
comp 119717..119792 gca 30 30
comp 119823..119899 atc 108
comp 120008..121498 16s 740 740 1491
122239..123597 cds 453 peptidoglycan DD-metalloendopeptidase family protein
comp 217550..218176 cds 123 123 209 ribonuclease D
comp 218300..218386 ctg 228 228
218615..219604 cds 330 complex I NDUFA9 subunit family protein
comp 300477..301733 cds 472 472 419 exonuclease subunit SbcD
302206..303696 16s 108 1491
303805..303881 atc 30 30
303912..303987 gca 255
304243..306995 23s 129 2753
307125..307240 5s 96 116
307337..307413 atgf 161 161
<comp 307575..307805 cds 77 p-ATP-binding protein
comp 466493..467710 cds 231 231 406 site-specific integrase
comp 467942..468031 tca 205 205
comp 468237..468809 cds 191 hp
512242..512790 cds 136 136 183 pantetheine-phosphate adenylyltransferase
512927..513002 aaa 209 209
513212..514036 cds 275 DUF3618 domain-containing protein
931813..933912 cds 79 79 700 membrane protein
933992..934066 caa 382 382
comp 934449..935270 cds 274 hp
comp 948715..949743 cds 199 199 343 Ppx/GppA family phosphatase
949943..950016 cag 246 246
comp 950263..950829 cds 189 IS3 family transposase
> 971260..971532 cds 493 493 91 P-hp
comp 972026..972119 agc 197 197
972317..972550 cds 78 hp
comp 1302373..1303350 cds 166 166 326 alpha-1,3-fucosyltransferase
comp 1303517..1303592 ttc 98 98
comp 1303691..1303876 cds 62 DNA gyrase inhibitor YacG
1349823..1350929 cds 145 145 369 GNAT family N-acetyltransferase
comp 1351075..1353828 23s 262 2754
comp 1354091..1355591 16s @1 676 676 1501
1356268..1356726 cds 153 MarR family transcriptional regulator
comp 1441708..1443066 cds 153 153 453 hp
1443220..1443294 acc 1 1
1443296..1443371 gcg 99 99
1443471..1443547 gac 44 44
1443592..1443666 gtc 1 1
1443668..1443741 cag 137 137
comp 1443879..1446428 cds 850 dipeptide ABC transporter ATP-binding protein
1566394..1566612 cds 193 193 73 hp
comp 1566806..1566921 5s 128 116
comp 1567050..1569802 23s 254 2753
comp 1570057..1570132 gca 30 30
comp 1570163..1570239 atc 94
comp 1570334..1571834 16s 444 444 1501
comp 1572279..1572707 cds 143 DUF1489 domain-containing protein
1723583..1724962 cds 94 94 460 hp
comp 1725057..1725143 ctc 475 475
1725619..1726311 cds 231 FadR family transcriptional regulator
1757680..1760568 cds 308 308 963 PAS domain-containing protein
1760877..1760963 ctg 29 29
1760993..1761068 gcc 247 247
comp 1761316..1761840 cds 175 helix-turn-helix transcriptional regulator
1854042..1855049 cds 135 135 336 inorganic phosphate transporter
comp 1855185..1855259 ggc 243 243
1855503..1858685 cds 1061 AAA family ATPase
>comp 1883235..1883816 cds 210 210 194 P-hp
1884027..1884102 aac 4 4
1884107..1884183 gac 32 32
comp 1884216..1884821 cds 202 hp

abq cumuls[modifier | modifier le wikicode]

cumuls. abq.
opérons Fréquences intercalaires tRNAs Fréquences intercalaires cds Fréquences aas cds chromosome
effectif gammes sans rRNAs avec rRNAs gammes cds gammes cdsd gammes cdsa gammes cdsa 300
avec rRNA opérons 9 1 2 1 0 1 100 17 1 0
16atcgca235 5 20 3 50 7 40 200 29 30 0
Id-atgf 3 40 3 8 100 19 80 300 24 60 2
16s23s 1 60 2 150 26 120 400 18 90 9
max a 3 80 1 200 20 160 500 8 120 11
a doubles 0 100 1 250 18 200 600 8 150 8
spéciaux 0 120 1 300 3 240 700 5 180 11
total aas 19 140 1 350 4 280 800 2 210 9
sans opérons 51 160 0 400 4 320 900 2 240 6
1 aa 38 180 1 450 4 360 1000 1 270 6
max a 5 200 0 500 7 400 1100 1 300 8
a doubles 5 2 9 1 46
total aas 68 17 8 121 0 116 116
total aas 87
remarques 3
avec jaune moyenne 72 30 227 308
variance 72 0 175 230
sans jaune moyenne 153 249 166
variance 74 142 71

abq tRNA-cds[modifier | modifier le wikicode]

  • Note: intercalaires prélevés de la colonne cds de abq opérons dans un bloc de tRNAs uniquement. Le début du bloc est dans l'ordre des adresses, deb intercalaire entre le cds et le 1er tRNA dd bloc, fin entre le dernier tRNA et le cds terminal. J'ai procédé, dans les colonnes petit et grand, à la réorientation des blocs d'après la constatation que les blocs à rRNA ont leurs cds de début et de fin sont orientés du cds-16s au 5s-tRNAs-cds, l'intercalaire cds-16s étant plus grands que l'intercalaire avec le cds terminal. En tête de colonne est le % du nombre des intercalaires inférieurs à 201 pbs.
abq	67			60			38			90
deb	fin		deb	fin		grand	petit		grand	petit
38	91		159	5		72	68		159	5
42	81		210	32		81	42		210	32
68	72		659	35		91	38		659	35
77	170		175	59		96	92		91	38
79	382		209	63		125	123		81	42
85	139		153	69		139	85		175	59
91	173		68	72		144	81		209	63
92	96		149	74		149	74		72	68
94	475		42	81		153	69		153	69
118	443		144	81		153	137		149	74
123	228		38	91		159	5		170	77
125	123		92	96		162	137		382	79
127	206		166	98		166	98		144	81
129	337		344	106		169	141		139	85
134	212		296	109		170	77		173	91
135	243		365	120		173	91		96	92
136	209		125	123		175	59		475	94
144	81		243	123		188	148		166	98
148	188		595	131		206	127		344	106
149	74		153	137		209	63		296	109
149	688		162	137		209	136		443	118
153	69		85	139		210	32		365	120
153	137		169	141		212	134		125	123
156	234		77	170		218	196		243	123
159	5		91	173		228	123		228	123
159	231		246	175		231	205		206	127
162	137		148	188		231	159		337	129
166	98		455	193		234	156		595	131
169	141		493	197		243	123		212	134
175	59		231	205		243	135		243	135
196	218		127	206		246	175		209	136
199	246		136	209		246	199		153	137
209	63		134	212		296	109		162	137
210	32		196	218		308	247		169	141
231	205		123	228		337	129		188	148
243	123		159	231		340	286		688	149
246	175		156	234		344	106		234	156
296	109		135	243		365	120		231	159
308	247		199	246		382	79		246	175
340	286		308	247		414	406		455	193
344	106		340	286		443	118		218	196
365	120		129	337		455	193		493	197
414	406		481	363		475	94		246	199
455	193		79	382		481	363		231	205
481	363		414	406		493	197		308	247
493	197		118	443		595	131		340	286
595	131		94	475		659	35		481	363
659	35		149	688		688	149		414	406
  • Comparaison cds-cds tRNA-cds: deb fin, c'est l'ordre des adresses et grand petit l'ordre après réorientation. Leur pourcentage est calculé par rapport à la colonne, c'est à dire la moitié du total des tRNA-cds.
alpha	cds total	total	<0	0-200	201-370	371-600	>600	deb	fin	grand	petit
abq	6,576		96		61	24	9	2	32	29	18	43
‰					635	250	94	21	667	604	375	896

abq blocs[modifier | modifier le wikicode]

  • Lien tableur: abq blocs
  • Légende: lien au tableau des protéines, abrégé
    - vert: la taille des rRNAs en pbs alors que les protéines (cds) sont en aas.
A2. abq, blocs à rRNA.
bloc intercal cdsa intercal cdsa intercal cdsa intercal cdsa intercal cdsa
cds 779 1328 non ribosom 496 235 PAP2 fam 502 65 hp 615 305 lytic dom 444 143 DUF1489
16s 108 1491 108 1501 108 1501 110 1491 94 1501
atc 30 30 30 30 30
gca 266 255 255 266 254
23s 129 2753 129 2753 129 2753 127 2753 128 2753
5s 236 116 187 116 278 116 202 116 193 116
cds 97 YkgJ fam 614 EAL & GGDEF 387 PQQ 209 pyridoxamine 73 hp
cds 452 295 Hx-t-Hx 740 453 peptido fam 472 419 exo SbcD
16s 108 1491 108 1491 108 1491
atc 30 30 30
gca 266 255 255 cds 676 153 MarR fam
23s 127 2753 129 2753 129 2753 16s 262 1501
5s 96 116 96 116 96 116 23s 145 2754
atgf 870 394 161 cds 369 GNAT fam
cds 264 IS5 fam 101 p-IS5/IS1182 77 p-ATP-bind

abq remarques[modifier | modifier le wikicode]

  • Remarques
    - Les intercalaires élevés des cds: Ce génome ressemble à agr plus qu’à oan, voir le tableau des intercalaires ci-dessous. Le génome oan se rapproche plus des rickettsia avec 12 intercalaires cds-aa supérieurs à 500 et un maximum de 1650. Le génome abq a des intercalaires cds-aa inférieurs à 700 comme agr mais en plus grand nombre, 6 contre 3.
    1. @ Les blocs à RNAs: Les blocs sont nombreux, 9 16s, quasiment identiques et complets.
      - Sur 18 cds 2 hp 1 pseudo et 5 petits avec moins de 210 aas.
      - Tous les blocs sauf un (incomplet, 16s23s) sont de type 16satcgca23s5s dont 5 se terminent avec 5s et 3 avec 5s-atgf.
      - Les intercalaires internes, hors cds, sont quasiment identiques.
      - Les tailles des rRNAs du 23s et du 5s ne varient pas. Il y a 5 16s à 1491 pbs et 4 avec 1501 pbs.
    2. @ Les intercalaires entre aas: Il y a 13 blocs à plusieurs aas, pour 51 au total, contre 3 pour 45 chez oan et 3 pour 38 chez agr. Aussi je distingue 2 groupes comme avec agr et oan qui ont des effectifs très faibles.
      - un groupe de 10, normal dans cette étude, autour de 15 de moyenne, de 3 à 60 pbs
      - un groupe de 7, extrême, de 76 à 220 pbs. Le maximum est équivalent à celui de oan mais nettement inférieur aux 2 extrêmes de agr, 793 et 446.
    3. @ Les plasmides: génome exceptionnel avec 5 plasmides et 9 blocs à rRNAs. Exceptionnel aussi du fait qu’un plasmide, le plasmide 1, contient 4 blocs à rRNAs, soit 2 fois plus que le chromosome avec 2 blocs. Cette situation rappelle le cas unique du génome aua où le seul bloc à rRNA se trouve sur l’unique et tout petit plasmide de 10k pbs.
  • Séquences des doubles: sur les 51 blocs à aas seulement 13 ont plus d’un aa. Les doubles sont tous des doublets de blocs à 2 aas, 5 sur 11, ccg aag gag gtg cac.
  • Tableau des intercalaires
abq intercalaires entre aas	abq intercalaires cds		abq intercalaires cds			
1370697	aac-tgc	220		810890	atgf	870		2641475	ggc	688	
616472	ccg-ccg	206		1431525	16s	779		2766227	ggg	659	
1723802	gac-gta	164		120008	16s	740		1997840	atgj	595	
1165208	gtg-gtg	132		1354091	16s	676		972026	agc	493	
1735337	cac-cac	109		510548	16s	615		1725057	ctc	475	
1443296	gcg-gac	99		404350	16s	502		86421	ggc	455	
796280	aag-aag	76		2787506	16s	496		1354448	aga	443	
				302206	16s	472		52318	tgg	481-363	
				814616	16s	452		2304295	tta	414-406	isolé
				1570334	16s	444					
											
intercalaires supérieurs à 500 pbs.											
	agr	oan	abq								
16s	2	4	6								
aas	6	12	3								
max 16s	633	998	870								
max aas	793	1650	688								

abq distribution[modifier | modifier le wikicode]

aag2 cac2 ccg2 gag3 gtg3  
ggc: 3 1aa et 1 >1aa
Al6 abq, Azospirillum brasilense strain Az39. alpha.
g1    t1       
atgi 1 tct tat atgf 3
att act aat agt
ctt cct cat cgc
gtt gct gat ggt
ttc 2 tcc 1 tac 2 tgc 1
atc 8 acc 2 aac 3 agc 1
ctc 2 ccc 1 cac 2 cgt 2
gtc 2 gcc 3 gac 3 ggc 4
tta 1 tca 1 taa tga
ata aca 1 aaa 1 aga 1
cta 1 cca 1 caa 1 cga
gta gca 8 gaa 1 gga 1
ttg 1 tcg 1 tag tgg 2
atgj 1 acg 1 aag 2 agg 1
ctg 3 ccg 2 cag 2 cgg 1
gtg 3 gcg 2 gag 3 ggg 1
alpha >1aa =1aa -5s +5s -16s +16s total
abq 30 38 3 16 87

abq. Intergen51[modifier | modifier le wikicode]

Intergen51. abq. Le génome[modifier | modifier le wikicode]

  • abq Le prélèvement: Aalpha
  • Le nom et le lien NCBI: abq, Azospirillum brasilense strain Az39 chromosome, NCBI [28], date 25.4.21.
  • abq La longueur totale des intercalaires, longueur du génome et taux intercalaires/génome:
Nom	intercals	génome		taux en %			
abq	356,439		3,064,393	11.6
abq données intercalaires[modifier | modifier le wikicode]
abq données intercalaires 200[modifier | modifier le wikicode]
abq autres intercalaires aas[modifier | modifier le wikicode]

Intergen51. abq. Les différents types d'intercalaires[modifier | modifier le wikicode]

  • Lien au tableur: Intergen51. abq les différents types d'intercalaires.
  • Légende:
    - S pour intercalaire CDS-CDS et R pour tRNA-CDS,
    - c pour intercalaire continu (les 2 gènes sont sur le même brin) et x pour discontinu (les 2 gènes sont sur 2 brins différents, le brin et son complément)
    - %reste = 100*reste/total, le reste étant ce qui reste du total après la fin du diagramme, gamme.
    - %t30 = 100*t30/total, t30 étant le total des fréquences 10 20 30
    - %t5 = 100*t/total, t5 étant le total des fréquences de -1 à -5 dans le diagramme des S-.
Int51.2 abq les différents types d'intercalaires entre gène
Int51.21 Les différents types
intercalaires CDS-CDS * autres intercalaires
continu S+ S- S0 total c/x RNA-RNA CDS-rRNA total
c 1,561 330 4 1,895 2.0 16 2 18
x 888 37 2 927 0 2 2
t 2,449 367 6 2,822 16 4 20
% 86.8 13.0 0.2
Int51.22 Détail des * autres intercalaires
intercalaires tRNA-CDS récapitulatif des * autres intercalaires
continu R+ R- R0 total c/x * autres total %
c 37 0 0 37 1.4 tRNA-CDS 64 62
x 27 0 0 27 RNA-RNA 16 15
t 64 0 0 64 CDS-rRNA 4 4
% 100.0 0.0 0.0 non RNA 20 19
- total 104 100
Int51.23 Les taux remarquables
taux %reste %t30 %t5 %0
type S+ R+ S- S+ R+ S- S+ R+
gamme 400 400 6-50 - - - - -
type S+ R+ S- S+ R+ S- S+ R+
c 3.6 10.8 2.1 25.4 2.7 79 0.2 0.0
x 9.2 3.7 13.5 19.8 3.7 19 0.2 0.0

Intergen51. abq. Les diagrammes CDS-CDS positifs[modifier | modifier le wikicode]

  • Lien tableur: Les diagrammes
  • Diagrammes des gamma:  abq présente 2 diagrammes
    - fc40, CDS-CDS continu, fréquence unitaire en abscisses et effectif en ordonnées
    - fx%, CDS-CDS discontinu, fréquences regroupées par 10 (freq10) en abscisses et pourcentage en ‰ par rapport au total, en ordonnées.
  • Équations des courbes de tendance en pour 1000: colonnes %fx %fc
Courbes de tendances pour les diagrammes en pour 1000			Calculs des f.41	abq
R2	x3		x2		x		c		Inflexion poly3	x	c
0.726	-2.54E-06	1.74E-03	-4.43E-01	59.8	fx1	abscisse	255.0	190.6
0.871	-2.17E-06	1.96E-03	-6.55E-01	86.2	fc1	ordonnée	17.0	22.1
								
0.846	2.17E-06	-1.66E-03	2.89E-01	15.3	fx41			
0.951	2,78E-06	-1,59E-03	1,03E-01	41.0	fc31			
  • Moyennes glissantes fc+400,diagonale. Voir le détail des calculs dans abs.
données	abq		calculs			poly3	abq
effect	1565		R2.21	768		abscis	400
xm	37		pte	15,49		flexa	189
ym	6		cste	4,41		flexo	2,16
x1m	220		r400l	180		xm	35
y1m	1		restp	134,19		sup4	229,3
rfin	36,42		%sd	32,17		sup4t	535,5
bornf	146		lond	183		%	42,8
supd	186,45		%sf	30,50		long	154
supdt	579,55		lonf	109			
xmp	286,26		sf/lf	1,18			
r400	97,76		sr/lr	0,78			
supf	129,00		sd/ld	1,02			
supft	423,00		i.r400	0,54						

Intergen51. abq. Les CDS-CDS négatifs[modifier | modifier le wikicode]

Sous-totaux	abq			totale	
fréquence	x-	c-		x-	c-
 - 1		0	61		4	4140
 - 2		1	0		85	11
 - 3		0	0		3	12
 - 4		6	199		717	10938
 - 5		0	0		5	19
sp6		30	70		1642	8424
total		37	330		2,456	23,544
reste		5	7		264	420
s6		2	1		361	41
s7		4	14		321	1438
s8		19	48		696	6525
rappot s1-5						
4/2/1		6.0	3.3		8.4	2.6
% / sp6						
s6/sp6		6.7	1.4		22.0	0.5
s7/sp6		13.3	20.0		19.5	17.1
s8/sp6		63.3	68.6		42.4	77.5
reste/sp6	16.7	10.0		16.1	5.0
						
total s1-5	7	260		814	15120
% / total						
%s1-5		18.9	78.8		33.1	64.2
%sp6		81.1	21.2		66.9	35.8

Intergen51. abq. Les intercalaires des blocs[modifier | modifier le wikicode]

  • Le détail
RNA-RNA		c	x		CDS-RNA		c	x
23s 5s		2			CDS 16s		1	1
16s 23s					5s CDS		1	1
16s tRNA	2			16 CDS			
tRNA 23s	2			CDS 5s			
5s tRNA					23s CDS			
tRNA in		2			CDS 23s			
tRNA contig				5s 16s			
tRNA hors	8			16s16s			
tRNA 16s								
23s tRNA								
tRNA 5s								
16s 5s								
5s 23s								
5s 5s								
total		16	0		total		2	2
  • Les rares voir gamma pour la longueur des intercalaires
  • Les tRNA-CDS compris, comparaison dans le clade et dans l'étude.

Intergen51. abq. Les intercalaires tRNA-tRNA extra bloc[modifier | modifier le wikicode]

abqp. Intergen51[modifier | modifier le wikicode]

Intergen51. abqp. Le génome[modifier | modifier le wikicode]

  • abqp Le prélèvement: Aabqp
  • Le nom et le lien NCBI: abqp, Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, NCBI [29], date 26.4.22.
  • abqp La longueur totale des intercalaires, longueur du génome et taux intercalaires/génome:
Nom	intercals	génome		taux en %			
abqp	217,409		1,901,707	11.4	
abqp données intercalaires[modifier | modifier le wikicode]
abqp données intercalaires 200[modifier | modifier le wikicode]
abqp autres intercalaires aas[modifier | modifier le wikicode]

Intergen51. abqp. Les différents types d'intercalaires[modifier | modifier le wikicode]

  • Lien au tableur: Intergen51. abqp les différents types d'intercalaires.
  • Légende:
    - S pour intercalaire CDS-CDS et R pour tRNA-CDS,
    - c pour intercalaire continu (les 2 gènes sont sur le même brin) et x pour discontinu (les 2 gènes sont sur 2 brins différents, le brin et son complément)
    - %reste = 100*reste/total, le reste étant ce qui reste du total après la fin du diagramme, gamme.
    - %t30 = 100*t30/total, t30 étant le total des fréquences 10 20 30
    - %t5 = 100*t/total, t5 étant le total des fréquences de -1 à -5 dans le diagramme des S-.
Int51.2 abqp les différents types d'intercalaires entre gène
Int51.21 Les différents types
intercalaires CDS-CDS * autres intercalaires
continu S+ S- S0 total c/x RNA-RNA CDS-rRNA total
c 919 235 2 1,156 2.2 21 1 22
x 496 26 1 523 0 5 5
t 1,415 261 3 1,679 21 6 27
% 84.3 15.5 0.2
Int51.22 Détail des * autres intercalaires
intercalaires tRNA-CDS récapitulatif des * autres intercalaires
continu R+ R- R0 total c/x * autres total %
c 10 0 0 10 0.6 tRNA-CDS 26 40
x 16 0 0 16 RNA-RNA 21 32
t 26 0 0 26 CDS-rRNA 6 9
% 100.0 0.0 0.0 non RNA 12 18
- total 65 100
Int51.23 Les taux remarquables
taux %reste %t30 %t5 %0
type S+ R+ S- S+ R+ S- S+ R+
gamme 400 400 6-50 - - - - -
type S+ R+ S- S+ R+ S- S+ R+
c 5.0 0.0 3.0 25.1 0.0 74 0.2 0.0
x 8.7 6.3 23.1 19.1 6.3 8 0.2 0.0

Intergen51. abqp. Les diagrammes CDS-CDS positifs[modifier | modifier le wikicode]

  • Lien tableur: Les diagrammes
  • Diagrammes des gamma:  abqp présente 2 diagrammes
    - fc40, CDS-CDS continu, fréquence unitaire en abscisses et effectif en ordonnées
    - fx%, CDS-CDS discontinu, fréquences regroupées par 10 (freq10) en abscisses et pourcentage en ‰ par rapport au total, en ordonnées.
  • Équations des courbes de tendance en pour 1000: colonnes %fx %fc
Courbes de tendances pour les diagrammes en pour 1000			Calculs des f.41	abqp
R2	x3		x2		x		c		Inflexion poly3	x	c
0.650	-2.13E-06	1.44E-03	-3.77E-01	56.1	fx1	abscisse	251.5	176.0
0.923	-2.61E-06	2.27E-03	-7.16E-01	89.0	fc1	ordonnée	18.5	23.2
								
0.762	2.24E-06	-1.69E-03	2.93E-01	16.1	fx41			
0.930	1.78E-06	-9.40E-04	-1.28E-02	44.9	fc41			
  • Moyennes glissantes fc+400, diagonale. Voir le détail des calculs dans abs.
données	abqp		calculs			poly3	abqp
effect	921		R2.21	689		abscis	400
xm	45		pte	12,27		flexa	166
ym	3		cste	3,81		flexo	2,40
x1m	229		r400l	171		xm	45
y1m	1		restp	128,12		sup4	169,7
rfin	49,95		%sd	38,51		sup4t	423,5
bornf	174		lond	184		%	40,1
supd	206,6		%sf	37,34		long	121
supdt	536,4		lonf	129			
xmp	335,50		sf/lf	1,28			
r400	78,18		sr/lr	0,76			
supf	164,6		sd/ld	1,12			
supft	440,8		i.r400	0,46			

Intergen51. abqp. Les CDS-CDS négatifs[modifier | modifier le wikicode]

Sous-totaux	abqp			totale	
fréquence	x-	c-		x-	c-
 - 1		0	30		4	4140
 - 2		1	0		85	11
 - 3		0	0		3	12
 - 4		1	143		717	10938
 - 5		0	0		5	19
sp6		24	62		1642	8424
total		26	235		2,456	23,544
reste		6	7		264	420
s6		2	1		361	41
s7		7	14		321	1438
s8		9	40		696	6525
rappot s1-5						
4/2/1		1.0	4.8		8.4	2.6
% / sp6						
s6/sp6		8.3	1.6		22.0	0.5
s7/sp6		29.2	22.6		19.5	17.1
s8/sp6		37.5	64.5		42.4	77.5
reste/sp6	25.0	11.3		16.1	5.0
						
total s1-5	2	173		814	15120
% / total						
%s1-5		7.7	73.6		33.1	64.2
%sp6		92.3	26.4		66.9	35.8

Intergen51. abqp. Les intercalaires des blocs[modifier | modifier le wikicode]

  • Le détail
RNA-RNA		c	x		CDS-RNA		c	x
23s 5s		3			CDS 16s		1	3
16s 23s		1			5s CDS			1
16s tRNA	3			16 CDS			
tRNA 23s	3			CDS 5s			
5s tRNA		2			23s CDS			1
tRNA in		3			CDS 23s			
tRNA contig				5s 16s			
tRNA hors	6			16s16s			
tRNA 16s								
23s tRNA								
tRNA 5s								
16s 5s								
5s 23s								
5s 5s								
total		21	0		total		1	5
  • Les rares voir gamma pour la longueur des intercalaires
  • Les tRNA-CDS compris, comparaison dans le clade et dans l'étude.

Intergen51. abqp. Les intercalaires tRNA-tRNA extra bloc[modifier | modifier le wikicode]

Azospirillum brasilense Sp245[modifier | modifier le wikicode]

abs opérons[modifier | modifier le wikicode]

  • Lien tableur: abs opérons
  • Liens: gtRNAdb [30], NCBI [31], génome [32]
  • Phylogénie: Bacteria; Proteobacteria; Alphaproteobacteria; Rhodospirillales; Rhodospirillaceae; Azospirillum.
  • Légende: cdsa: cds aas, cdsd: cds dirigé
A9. Azospirillum brasilense strain Sp245
68.45%GC 10.1.20 Paris  80   doubles intercal cds aa avec aa cdsa cdsd protéines
chromosome [33]
comp 16414..16980 cds 163 163 189 prolyl-tRNA synthetase associated domain-containing protein
17144..17218 ggc 670 670
17889..18566 cds 226 demethylmenaquinone methyltransferase
84790..85017 cds 114 114 76 osmotically-inducible lipoprotein B
comp 85132..85205 ggg 35 35
comp 85241..85900 cds 220 N-acetyltransferase
comp 93530..94258 cds 60 60 243 SDR family NAD(P)-dependent oxidoreductase
comp 94319..94395 agg 175 175
94571..96262 cds 564 hp
comp 131833..132117 cds 206 206 95 YggT family protein
132324..132399 gcg 140 140
comp 132540..133586 cds 349 DMT family transporter
comp 483582..484082 cds 170 170 167 xanthine phosphoribosyltransferase
484253..484329 cgt 77 77
comp 484407..484586 cds 60 hp
536869..537573 cds 495 495 235 phosphatase PAP2 family protein
538069..539152 16s’ @1 189 1084
539342..540019 23s° 127 678
540147..540262 5s 153 153 116
comp 540416..542290 cds 625 GGDEF domain-containing protein
600048..601079 cds 79 79 344 tyrosine-type recombinase/integrase
comp 601159..601233 acg 81 81
comp 601315..603243 cds 643 DNA helicase RecQ
comp 656242..656520 cds 169 169 93 hp
comp 656690..656765 gcc 141 141
comp 656907..657305 cds 133 TIGR02300 family protein
comp 864141..864458 cds 209 209 106 50S ribosomal protein L21
864668..864757 tcg 79 79
comp 864837..865679 cds 281 alpha/beta hydrolase
927651..927896 cds 392 392 82 hp
928289..928371 tta 175 175
928547..929164 cds 206 hp
comp 1148345..1149223 cds 234 234 293 N-formylglutamate amidohydrolase
1149458..1149532 gtc 106 106
comp 1149639..1151516 cds 626 methyl-accepting chemotaxis protein
1243974..1245108 cds 131 131 378 tRNA 2-thiouridine(34) synthase MnmA
1245240..1245314 atgj 354 354
comp 1245669..1246637 cds 323 NAD(+) diphosphatase
1279875..1280237 cds 74 74 121 hp
comp 1280312..1280397 tac 148 148
comp 1280546..1281172 cds 209 nitrogen fixation protein NifQ
comp 1500772..1501110 cds 338 338 113 P-II family nitrogen regulator
1501449..1501524 cac + 109 109
1501634..1501709 cac 2 cac 129 129
1501839..1503305 cds 106 106 489 bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase
1503412..1504977 cds 173 173 522 malonyl-CoA decarboxylase
1505151..1505235 cta 91 91
1505327..1506661 cds 445 trigger factor
1511745..1512017 cds 105 105 91 HU family DNA-binding protein
1512123..1512197 gta 163 163
1512361..1512437 gac 344 344
1512782..1513150 cds 123 NADH-quinone oxidoreductase subunit A
1657596..1659397 cds 123 123 601 p-single-stranded-DNA-specific exonuclease RecJ
1659521..1659596 gaa 234 234
1659831..1660671 cds 280 aldo/keto reductase
comp 1808199..1808735 cds 79 79 179 hp
1808815..1808892 cca 49 49
1808942..1809238 cds 10 10 99 ETC complex I subunit
1809249..1809325 aga 442 442
1809768..1810013 cds 82 hp
comp 1825075..1825305 cds 210 210 77 hp
comp 1825516..1825591 aac @2 219 219
comp 1825811..1825884 tgc 217 217
1826102..1826758 cds 219 protein-L-isoaspartate O-methyltransferase
comp 1878424..1878714 cds 244 244 97 YkgJ family cysteine cluster protein
comp 1878959..1879074 5s 123 116
comp 1879198..1881950 23s 272 2753
comp 1882223..1882298 gca 32 32
comp 1882331..1882407 atc 110
comp 1882518..1883224 16s° 100 100 707
<comp 1883325..1883763 cds 146 p-erythrose-4-phosphate dehydrogenase
1896604..1897080 cds 192 192 159 peptidoglycan-associated lipoprotein Pal
comp 1897273..1897347 acc 162 162
comp 1897510..1899495 cds 662 polysaccharide biosynthesis protein
comp 2032701..2033588 cds 165 165 296 DUF3108 domain-containing protein
2033754..2033828 gtg + 132 132
2033961..2034035 gtg 2 gtg 231 231
2034267..2034431 cds 55 hp
2113098..2113601 cds 85 85 168 MerR family transcriptional regulator
2113687..2113763 ccc 140 140
comp 2113904..2115682 cds 593 cyclic nucleotide-binding domain-containing protein
comp 2163405..2167388 cds 775 775 1328 non-ribosomal peptide synthetase
2168164..2168552 16s° 100 389
comp 2168653..2169323 16s° 522 522 671
comp 2169846..2170325 cds 160 DUF2141 domain-containing protein
2176963..2177427 cds 107 107 155 membrane protein
comp 2177535..2177610 gcc 30 30
comp 2177641..2177727 ctg 135 135
comp 2177863..2180208 cds 782 mechanosensitive ion channel
2233677..2234435 cds 92 92 253 hp
comp 2234528..2234603 gag + 38 38
comp 2234642..2234717 gag 2 gag 68 68
comp 2234786..2235836 cds 350 p-low specificity L-threonine aldolase
comp 2293087..2293593 cds 211 211 169 hp
2293805..2293881 cgt 137 137
2294019..2294495 cds 5 5 159 GNAT family N-acetyltransferase
comp 2294501..2294576 atgi 145 145
comp 2294722..2296683 cds 654 RNA polymerase sigma factor RpoD
2372946..2373401 cds 86 86 152 MaoC family dehydratase
comp 2373488..2373563 aag + 74 74
comp 2373638..2373713 aag 2 aag 309 309
2374023..2375549 cds 509 methyltransferase domain-containing protein
comp 2418203..2418400 cds 69 69 66 preprotein translocase subunit SecE
comp 2418470..2418545 tgg 152 152
comp 2418698..2419888 cds 81 81 397 elongation factor Tu
comp 2419970..2420043 gga 60 60
comp 2420104..2420189 tac 144 144
2420334..2421188 cds 91 91 285 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
2421280..2421355 aca 137 137
2421493..2423187 cds 565 site-specific integrase
2561207..2562223 cds 109 109 339 farnesyltranstransferase
2562333..2562409 ccg + 205 205
2562615..2562691 ccg 2 ccg 136 136
2562828..2563241 cds 138 hp
comp 2680406..2680930 cds 140 140 175 disulfide bond formation protein B
2681071..2681157 ttg 162 162
2681320..2681715 cds 132 cupin domain-containing protein
2856509..2858152 cds 365 365 548 recombinase family protein
comp 2858518..2858608 tcc 118 118
comp 2858727..2859530 cds 268 alpha/beta hydrolase
plasmide1 [34] @3
198109..199200 cds 84 84 364 tyrosine-type recombinase/integrase
comp 199285..199360 aaa 135 135
comp 199496..200044 cds 183 pantetheine-phosphate adenylyltransferase
243776..244348 cds 205 205 191 hp
244554..244643 tca 143 143
244787..245683 cds 299 diguanylate cyclase
338004..339383 cds 116 116 460 hp
comp 339500..339586 ctc 257 257
comp 339844..340836 cds 331 alpha/beta hydrolase
comp 364473..365501 cds 200 200 343 Ppx/GppA family phosphatase
365702..365775 cag 746 746
366522..367214 cds 231 FadR family transcriptional regulator
474173..477079 cds 298 298 969 PAS domain-containing protein
477378..477464 ctg 30 30
477495..477570 gcc 238 238
477809..478123 cds 105 hp
599223..600230 cds 245 245 336 inorganic phosphate transporter
comp 600476..600550 ggc 351 351
600902..602071 cds 390 adenylate/guanylate cyclase domain-containing protein
comp 629856..631229 cds 154 154 458 tetratricopeptide repeat protein
631384..631458 acc 1 1
631460..631535 gcg 99 99
631635..631711 gac 35 35
631747..631821 gtc 1 1
631823..631896 cag 153 153
632050..632259 cds 70 hp
>comp 699265..699846 cds 210 210 194 P-hp
700057..700132 aac 4 4
700137..700213 gac 32 32
comp 700246..700851 cds 202 hp
909530..909766 cds 153 153 79 hp
comp 909920..910035 5s 127 116
comp 910163..912915 23s 271 2753
comp 913187..913262 gca 30 30
comp 913293..913369 atc 110
comp 913480..914970 16s 486 486 1491
915457..916713 cds 419 exonuclease subunit SbcD
comp 998160..999149 cds 229 229 330 complex I NDUFA9 subunit family protein
999379..999465 ctg 123 123
999589..1000215 cds 209 ribonuclease D
comp 1098197..1098655 cds 675 675 153 MarR family transcriptional regulator
1099331..1100821 16s 107 1491
1100929..1101005 atc 31 31
1101037..1101112 gca 271
1101384..1104136 23s 147 147 2753
comp 1104284..1105390 cds 369 GNAT family N-acetyltransferase
1157171..1157356 cds 98 98 62 DNA gyrase inhibitor YacG
1157455..1157530 ttc 178 178
1157709..1158686 cds 326 alpha-(1,3)-fucosyltransferase
1394614..1396740 cds 453 453 709 PAS domain S-box protein
1397194..1397287 agc 52 52
comp 1397340..1397858 cds 173 tyrosine-type recombinase/integrase
1399009..1399830 cds 301 301 274 hp
comp 1400132..1400206 caa 79 79
comp 1400286..1402379 cds 698 hp
1577667..1578095 cds 457 457 143 DUF1489 domain-containing protein
1578553..1580043 16s 110 1491
1580154..1580230 atc 31 31
1580262..1580337 gca 269
1580607..1581986 23s° 100 1380
1582087..1582616 23s° 123 530
1582740..1582855 5s 100 116
1582956..1583032 atgf 706 706
1583739..1585157 cds 473 pyruvate kinase
plasmide2 [35]
271302..272090 cds 529 529 263 ATP-binding cassette domain-containing protein
272620..272695 tgg 480 480
273176..273922 cds 249 sigma-70 family RNA polymerase sigma factor
449562..450338 cds 465 465 259 IclR family transcriptional regulator
450804..452289 16s 584 1486
452874..453640 23s° 128 767
453769..453884 5s 101 116
453986..454062 atgf 359 359
comp 454422..457751 cds 1110 NERD domain-containing protein
plasmide4 [36]
>comp 131140..131621 cds 193 193 161 p-erythrose-4-phosphate dehydrogenase
131815..131891 atgf 202 202
comp 132094..132276 cds 61 hp
comp 197300..198643 cds 738 738 448 peptidoglycan DD-metalloendopeptidase family protein
199382..199953 16s° 193 572
200147..200223 atgf 437 437
comp 200661..202571 cds 637 PAS domain-containing sensor histidine kinase
246777..248687 cds 208 208 637 RNA-directed DNA polymerase
comp 248896..248972 cgg 96 96
comp 249069..249983 cds 305 alpha/beta hydrolase
319641..319943 cds 134 134 101 STAS domain-containing protein
comp 320078..320164 ctc 125 125
320290..321018 cds 243 lipoyl(octanoyl) transferase LipB
comp 401067..402227 cds 281 281 387 PQQ-dependent sugar dehydrogenase
comp 402509..402624 5s 129 116
comp 402754..403402 23s° 106 649
comp 403509..403880 16s° 502 502 372
comp 404383..404577 cds 65 hp
501394..501756 cds 95 95 121 response regulator
501852..501927 aac 4 4
501932..502008 gac 4 4
502013..502087 ggc 102 102
comp 502190..502957 cds 256 helix-turn-helix transcriptional regulator
503041..503667 cds 249 249 209 pyridoxamine 5'-phosphate oxidase
comp 503917..504474 16s° 547 547 558
505022..506005 cds 328 lytic transglycosylase domain-containing protein
comp 601019..603679 cds 358 358 887 bifunctional acetaldehyde-CoA/alcohol dehydrogenase
604038..604113 ttc 318 318
> 604432..605613 cds 394 site-specific integrase
plasmide6 [37]
88804..89472 cds 397 397 223 RraA family protein
89870..89944 ggc 249 249
90194..91186 cds 331 UDP-N-acetylglucosamine 4,6-dehydratase (inverting)

abs cumuls[modifier | modifier le wikicode]

cumuls. abs.
opérons Fréquences intercalaires tRNAs Fréquences intercalaires cds Fréquences aas cds chromosome
effectif gammes sans rRNAs avec rRNAs gammes cds gammes cdsd gammes cdsa gammes cdsa 30-300
avec rRNA opérons 10 1 2 1 0 1 100 18 1 0
16atcgca235 1 20 3 50 5 40 200 29 30 0
Id-23s°-atgf 1 40 4 4 100 22 80 300 26 60 3
1623s°5atgf 1 60 1 150 29 120 400 20 90 10
max a 3 80 1 200 18 160 500 7 120 9
a doubles 0 100 1 250 18 200 600 6 150 8
autres 7 120 1 300 3 240 700 9 180 13
total aas 10 140 1 350 5 280 800 2 210 9
sans opérons 51 160 0 400 7 320 900 1 240 6
1 aa 39 180 1 450 2 360 1000 1 270 8
max a 5 200 0 500 6 400 1100 0 300 7
a doubles 5 2 10 2 48
total aas 67 17 4 125 0 121 121
total aas
remarques 3
avec jaune moyenne 71 31 221 308
variance 72 1 168 230
sans jaune moyenne 151 242 166
variance 72 137 72

abs tRNA-cds[modifier | modifier le wikicode]

  • Note: intercalaires prélevés de la colonne cds de abs opérons dans un bloc de tRNAs uniquement. Le début du bloc est dans l'ordre des adresses, deb intercalaire entre le cds et le 1er tRNA dd bloc, fin entre le dernier tRNA et le cds terminal. J'ai procédé, dans les colonnes petit et grand, à la réorientation des blocs d'après la constatation que les blocs à rRNA ont leurs cds de début et de fin sont orientés du cds-16s au 5s-tRNAs-cds, l'intercalaire cds-16s étant plus grands que l'intercalaire avec le cds terminal. En tête de colonne est le % du nombre des intercalaires inférieurs à 201 pbs.
abs	63			69			44			88
deb	fin		deb	fin		grand	petit		grand	petit
5	145		210	32		79	49		145	5
10	442		114	35		81	79		442	10
60	175		79	49		92	68		210	32
69	152		453	52		102	95		114	35
74	148		92	68		114	35		79	49
79	81		170	77		134	125		453	52
79	49		209	79		135	84		175	60
81	144		301	79		135	107		92	68
84	135		79	81		136	109		152	69
85	140		173	91		137	91		148	74
86	309		208	96		140	85		170	77
91	137		95	102		144	81		81	79
92	68		234	106		145	5		209	79
95	102		365	118		148	74		301	79
98	178		229	123		152	69		144	81
105	344		134	125		154	153		135	84
107	135		338	129		162	140		140	85
109	136		84	135		169	141		309	86
114	35		107	135		170	77		137	91
116	257		109	136		173	91		173	91
123	234		91	137		175	60		102	95
131	354		211	137		178	98		208	96
134	125		85	140		192	162		178	98
140	162		206	140		202	193		344	105
154	153		169	141		205	143		234	106
163	670		205	143		206	140		135	107
165	231		81	144		208	96		136	109
169	141		5	145		209	79		257	116
170	77		74	148		210	32		365	118
173	91		69	152		211	137		229	123
192	162		154	153		217	210		234	123
193	202		140	162		229	123		134	125
200	746		192	162		231	165		338	129
205	143		60	175		234	106		354	131
206	140		392	175		234	123		211	137
208	96		98	178		257	116		162	140
209	79		193	202		298	238		206	140
210	217		210	217		301	79		169	141
210	32		165	231		309	86		205	143
211	137		123	234		338	129		154	153
229	123		298	238		344	105		192	162
234	106		397	249		351	245		670	163
245	351		116	257		354	131		231	165
298	238		86	309		358	318		392	175
301	79		358	318		365	118		202	193
338	129		105	344		392	175		746	200
358	318		245	351		397	249		217	210
365	118		131	354		442	10		298	238
392	175		10	442		453	52		351	245
397	249		529	480		529	480		397	249
453	52		163	670		670	163		358	318
529	480		200	746		746	200		529	480
  • Comparaison cds-cds tRNA-cds: deb fin, c'est l'ordre des adresses et grand petit l'ordre après réorientation. Leur pourcentage est calculé par rapport à la colonne, c'est à dire la moitié du total des tRNA-cds.
alpha	cds total	total	<0	0-200	201-370	371-600	>600	deb	fin	grand	petit
abs	6,817		104		69	27	6	2	33	36	23	46
‰					663	260	58	19	635	692	442	885

abs blocs[modifier | modifier le wikicode]

abs blocs abrégé[modifier | modifier le wikicode]

  • Lien tableur: abs blocs abrégé
  • Note:
    - hp pour hypothetical protein
    - p- pour pseudo, par exemple p-elon en abrégé donne p-elongation factor Tu.
A9p. abs abq, protéines.
abrégé nom
23s RlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
50s L21 50S ribosomal protein L21
AAA fam AAA family ATPase
ab hydrolase alpha/beta hydrolase
ab hydrolase f alpha/beta hydrolase fold domain-containing protein
AG cyclase adenylate/guanylate cyclase domain-containing protein
ak reductase aldo/keto reductase
ATP bind ATP-binding cassette domain-containing protein
bacteriofer bacterioferritin
bif CoA bifunctional acetaldehyde-CoA/alcohol dehydrogenase
bif NAD bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase
chemotaxis p methyl-accepting chemotaxis protein
cupin dom cupin domain-containing protein
cyclicN bind cyclic nucleotide-binding domain-containing protein
diG cyclase diguanylate cyclase
dip ABC dipeptide ABC transporter ATP-binding protein
disulfide disulfide bond formation protein B
DMT fam DMT family transporter
DUF1489 DUF1489 domain-containing protein
DUF2141 DUF2141 domain-containing protein
DUF3108 DUF3108 domain-containing protein
DUF3618 DUF3618 domain-containing protein
EAL & GGDEF EAL and GGDEF domain-containing protein
elonga Tu elongation factor Tu
ETC complex ETC complex I subunit
exo SbcD exonuclease subunit SbcD
FAD bind FAD-binding oxidoreductase
FadR fam FadR family transcriptional regulator
farnesyl farnesyltranstransferase
fucosyl alpha-1,3-fucosyltransferase
GGDEF dom GGDEF domain-containing protein
glycosyl glycosyltransferase
GNAT fam GNAT family N-acetyltransferase
gyrase YacG DNA gyrase inhibitor YacG
Hase HypA hydrogenase maturation nickel metallochaperone HypA
helicas RecQ DNA helicase RecQ
HU bind HU family DNA-binding protein
Hx-t-Hx helix-turn-helix transcriptional regulator
Hx-t-Hx dom helix-turn-helix domain-containing protein
IclR fam IclR family transcriptional regulator
inorganic P inorganic phosphate transporter
IS3 fam IS3 family transposase
IS5 fam IS5 family transposase
L-iso-Asp protein-L-isoaspartate O-methyltransferase
lipoyl LipB lipoyl(octanoyl) transferase LipB
low Thr low specificity L-threonine aldolase
lytic dom lytic transglycosylase domain-containing protein
malate G malate synthase G
malonyl CoA malonyl-CoA decarboxylase
MaoC fam MaoC family dehydratase
MarR fam MarR family transcriptional regulator
mecano ion mechanosensitive ion channel
membrane p membrane protein
menaquinone dimethylmenaquinone methyltransferase
MerR fam MerR family transcriptional regulator
methyl trans methyltransferase domain-containing protein
N-acetyl trans N-acetyltransferase
N-formyl Glu N-formylglutamate amidohydrolase
NAD diP NAD(+) diphosphatase
NADH-quinone NADH-quinone oxidoreductase subunit A
NDUFA9 complex I NDUFA9 subunit family protein
NERD dom NERD domain-containing protein
nitrogen NifQ nitrogen fixation protein NifQ
non ribosom non-ribosomal peptide synthetase
osmose LipB osmotically-inducible lipoprotein B
p-ATP-bind p-ATP-binding protein
p-erythrose p-erythrose-4-phosphate dehydrogenase
P-II nitrogen P-II family nitrogen regulator
p-IS5/IS1182 P-IS5/IS1182 family transposase
p-low Thr p-low specificity L-threonine aldolase
p-ssDNA exo p-single-stranded-DNA-specific exonuclease RecJ
pantetheine pantetheine-phosphate adenylyltransferase
PAP2 fam phosphatase PAP2 family protein
PAS dom PAS domain-containing protein
PAS kinase PAS domain-containing sensor histidine kinase
PAS S-box PAS domain S-box protein
peptido fam peptidoglycan DD-metalloendopeptidase family protein
peptido Pal peptidoglycan-associated lipoprotein Pal
polymerase RNA-directed DNA polymerase
polysacchard polysaccharide biosynthesis protein
Ppx/GppA Ppx/GppA family phosphatase
PQQ PQQ-dependent sugar dehydrogenase
Prolyl-tRNA prolyl-tRNA synthetase associated domain-containing protein
pyridoxamine pyridoxamine 5'-phosphate oxidase
pyruvate kin pyruvate kinase
recombinase recombinase family protein
response reg response regulator
restriction end restriction endonuclease
ribonucleaseD ribonuclease D
RraA fam RraA family protein
SDR fam SDR family NAD(P)-dependent oxidoreductase
sigma RpoD RNA polymerase sigma factor RpoD
sigma-70 fam sigma-70 family RNA polymerase sigma factor
SLT dom transglycosylase SLT domain-containing protein
ss integrase site-specific integrase
Ss-DNA single-stranded-DNA-specific exonuclease RecJ
STAS dom STAS domain-containing protein
subunit SecE preprotein translocase subunit SecE
tetratricopep tetratricopeptide repeat protein
TIGR02300 TIGR02300 family protein
trigger factor trigger factor
tRNA MnmA tRNA 2-thiouridine(34) synthase MnmA
Tyr rec/int tyrosine-type recombinase/integrase
UDP-N-acetyl UDP-N-acetylglucosamine 4,6-dehydratase (inverting)
xanthine xanthine phosphoribosyltransferase
YggT fam YggT family protein
YkgJ fam YkgJ family cysteine cluster protein

abs blocs tableau[modifier | modifier le wikicode]

  • Lien tableur: abs blocs tableau
  • Légende: lien au tableau des protéines, abrégé
    - vert: la taille des rRNAs en pbs alors que les protéines (cds) sont en aas.
  • Note: 10 cds < 259 sur 20 dont 2 hp + 1 p
A9b. abs blocs.
gène inter long abrégé gène inter long abrégé gène inter long abrégé
cds 486 419 SbcD cds 100 146 P-eryt cds 675 153 MarR
16s 110 1491 16s° 110 707 16s 107 1491
atc 30 atc 32 atc 31
gca 271 gca 272 gca 271
23s 127 2753 23s 123 2753 23s 147 2753
5s 153 116 5s 244 116 cds 369 GNAT
cds 79 hp cds 97 YkgJ
cds 457 143 DUF1489
16s 110 1491
atc 31
gca 269
23s° 100 1380
23s° 123 530
5s 100 116
atgf 706
cds 473 pyruvat
cds 465 259 IclR cds 502 65 hp cds 495 235 PAP2
16s 584 1486 16s° 106 372 16s' 189 1084
23s° 128 767 23s° 129 649 23s° 127 678
5s 101 116 5s 281 116 5s 153 v116
atgf 359 cds 387 PQQ cds 625 GGDEF
cds 1110 NERD
cds 775 1328 non-rib cds 738 448 peptido cds 249 209 pyridox
16s° 100 389 16s° 193 16s° 547 558
16s° 522 671 atgf 437 cds 328 lytic
cds 160 DUF2141 cds 637 PAS

abs abq blocs[modifier | modifier le wikicode]

  • Lien tableur: abs abq blocs
  • Légende: lien au tableau des protéines, abs abq blocs abrégé
    - vert: la taille des rRNAs en pbs alors qu'en clair les protéines (cdsa) sont en aas.
    - 16s° 16s' 23s°
    - comp: complement, le cds a changé de brin. Cela ressemble à une recombinaison. Exemple CHA1
    - hp caracter: hypothetical protein caractérisée. Le cds est, dans un génome hypothétique, alors que dans l'autre il est caractérisé,tout en ayant à peu près même taille et même intercalaire. Exemple CHA
    - modif: le cds a le même nom mais la taille est légèrement modifiée, ou bien le nom est modifié et nom et intercalaire sont les mêmes. Exemple CHA CHC
    - déplacé: Le cds est déplacé avec son rRNA, tout en conservant taille et intercalaire. Exemple le pavé après CHE
    - d’où?: je ne peux pas savoir de quel bloc à rRNAs, il vient. Exemple le pavé après CHE
    - recomb: En bordure un changement net du cds est du à la recombinaison d'un pavé de clusters. Exemple CHC
    - recombi: à l'intérieur, un changement net de cds est du à un déplacement ou à une recombinaison interne. Exemple CHC
    - insertion: C'est le cas typique du bloc à rRNAs incomplet qui lui manque 5s et atcgca dans abq. Exemple PL1G
    - bloc?: cela vient de quel bloc à rRNA? Exemple PL1I
    - réunion: 2 déplacés réunis. Exemple PL1I, réunion de bloc? et où?.
  • Notes:
    - PL1G
    - disparition des atc et gca internes non retrouvés dans les blocs aas
    - Les 5s ne sont pas abimés mais 2 disparaissent
    - Les atgf disparaissent aussi
    - Les 23s, 2 de perdus et 4 de modifiés et perdent leur 5s et 5satgf au contraire de rpm
    - Les 16s, aucun perdu, 4 modifiés s° et 1 modifié s'.
    - Les blocs rRNAs modifiés restent sur place.
A9-2b. Comparaison abs abq
A9. Azospirillum brasilense strain Sp245
sens adresse bloc inter cdsa protéine Note
chrom
2856509..2858152 cds 365 548 recombinase CHA1
comp 2858518..2858608 tcc 118
comp 2858727..2859530 cds 268 ab hydrolase
comp 16414..16980 cds 163 189 Prolyl-tRNA CHA
17144..17218 ggc 670
17889..18566 cds 226 menaquinone
84790..85017 cds 114 76 osmose LipB comp
comp 85132..85205 ggg 35
comp 85241..85900 cds 220 N-acetyl trans
comp 93530..94258 cds 60 243 SDR fam
comp 94319..94395 agg 175
94571..96262 cds 564 hp hp caracter
comp 131833..132117 cds 206 95 YggT fam
132324..132399 gcg 140
comp 132540..133586 cds 349 DMT fam modif
comp 483582..484082 cds 170 167 xanthine
484253..484329 cgt 77
comp 484407..484586 cds 60 hp
536869..537573 cds 495 235 PAP2 fam
538069..539152 16s’ 189 1084
539342..540019 23s° 127 678
540147..540262 5s 153 116
comp 540416..542290 cds 625 GGDEF dom
600048..601079 cds 79 344 Tyr rec/int comp
comp 601159..601233 acg 81
comp 601315..603243 cds 643 helicas RecQ
CHB
comp 656242..656520 cds 169 93 hp
comp 656690..656765 gcc 141
comp 656907..657305 cds 133 TIGR02300
comp 864141..864458 cds 209 106 50s L21
864668..864757 tcg 79
comp 864837..865679 cds 281 ab hydrolase
2233677..2234435 cds 92 253 hp recomb
comp 2234528..2234603 gag 38
comp 2234642..2234717 gag 68
comp 2234786..2235836 cds 350 p-low Thr modif
comp 2293087..2293593 cds 211 169 hp CHC
2293805..2293881 cgt 137
2294019..2294495 cds 5 159 GNAT fam
comp 2294501..2294576 atgi 145
comp 2294722..2296683 cds 654 sigma RpoD
2372946..2373401 cds 86 152 MaoC fam
comp 2373488..2373563 aag 74
comp 2373638..2373713 aag 309
2374023..2375549 cds 509 methyl trans
comp 2418203..2418400 cds 69 66 subunit SecE
comp 2418470..2418545 tgg 152
comp 2418698..2419888 cds 81 397 elonga Tu
comp 2419970..2420043 gga 60
comp 2420104..2420189 tac 144
2420334..2421188 cds 91 285 23s RlmB
2421280..2421355 aca 137
2421493..2423187 cds 565 ss integrase recombi
2561207..2562223 cds 109 339 farnesyl
2562333..2562409 ccg 205
2562615..2562691 ccg 136
2562828..2563241 cds 138 hp
comp 2680406..2680930 cds 140 175 disulfide
2681071..2681157 ttg 162
2681320..2681715 cds 132 cupin dom
1896604..1897080 cds 192 159 peptido Pal CHD
comp 1897273..1897347 acc 162
comp 1897510..1899495 cds 662 polysacchard
comp 2032701..2033588 cds 165 296 DUF3108
2033754..2033828 gtg 132
2033961..2034035 gtg 231
2034267..2034431 cds 55 hp
2113098..2113601 cds 85 168 MerR fam
2113687..2113763 ccc 140
comp 2113904..2115682 cds 593 cyclicN bind
comp 1808199..1808735 cds 79 179 hp CHE
1808815..1808892 cca 49
1808942..1809238 cds 10 99 ETC complex
1809249..1809325 aga 442
1809768..1810013 cds 82 hp
comp 1825075..1825305 cds 210 77 hp
comp 1825516..1825591 aac 219
comp 1825811..1825884 tgc 217
1826102..1826758 cds 219 L-iso-Asp
comp 1878424..1878714 cds 244 97 YkgJ fam
comp 1878959..1879074 5s 123 116
comp 1879198..1881950 23s 272 2753
comp 1882223..1882298 gca 32
comp 1882331..1882407 atc 110
comp 1882518..1883224 16s° 100 707
<comp 1883325..1883763 cds 146 p-erythrose comp
comp 2163405..2167388 cds 775 1328 non ribosom déplacé
2168164..2168552 16s° 100 389
comp 2168653..2169323 16s° 522 671 d’où?
comp 2169846..2170325 cds 160 DUF2141
927651..927896 cds 392 82 hp CHF
928289..928371 tta 175
928547..929164 cds 206 hp recombi
comp 1148345..1149223 cds 234 293 N-formyl Glu
1149458..1149532 gtc 106
comp 1149639..1151516 cds 626 chemotaxis p modif
1243974..1245108 cds 131 378 tRNA MnmA
1245240..1245314 atgj 354
comp 1245669..1246637 cds 323 NAD diP recombi
1279875..1280237 cds 74 121 hp
comp 1280312..1280397 tac 148
comp 1280546..1281172 cds 209 nitrogen NifQ
comp 1500772..1501110 cds 338 113 P-II nitrogen
1501449..1501524 cac 109
1501634..1501709 cac 129
1501839..1503305 cds 106 489 bif NAD
1503412..1504977 cds 173 522 malonyl CoA
1505151..1505235 cta 91
1505327..1506661 cds 445 trigger factor
1511745..1512017 cds 105 91 HU bind
1512123..1512197 gta 163
1512361..1512437 gac 344
1512782..1513150 cds 123 NADH-quinone
1657596..1659397 cds 123 601 p-ssDNA exo
1659521..1659596 gaa 234
1659831..1660671 cds 280 ak reductase
plasmide1
comp 197300..198643 cds 738 448 peptido fam PL4
199382..199953 16s° 193 572 déplacé
200147..200223 atgf 437
comp 200661..202571 cds 637 PAS kinase déplacé
909530..909766 cds 153 79 hp hp caracter
comp 909920..910035 5s 127 116
comp 910163..912915 23s 271 2753
comp 913187..913262 gca 30 PL1B
comp 913293..913369 atc 110
comp 913480..914970 16s 486 1491
915457..916713 cds 419 exo SbcD
comp 998160..999149 cds 229 330 NDUFA9
999379..999465 ctg 123
999589..1000215 cds 209 ribonucleaseD
198109..199200 cds 84 364 Tyr rec/int comp
comp 199285..199360 aaa 135
comp 199496..200044 cds 183 pantetheine PL1C
243776..244348 cds 205 191 hp
244554..244643 tca 143
244787..245683 cds 299 diG cyclase recomb
1399009..1399830 cds 301 274 hp PL1D
comp 1400132..1400206 caa 79
comp 1400286..1402379 cds 698 hp hp caracter
comp 364473..365501 cds 200 343 Ppx/GppA PL1E
365702..365775 cag 746
366522..367214 cds 231 FadR fam comp
1394614..1396740 cds 453 709 PAS S-box recomb
1397194..1397287 agc 52 PL1F
comp 1397340..1397858 cds 173 Tyr rec/int recomb
comp 1098197..1098655 cds 675 153 MarR fam PL1G
1099331..1100821 16s 107 1491
1100929..1101005 atc 31 insertion
1101037..1101112 gca 271
1101384..1104136 23s 147 2753
comp 1104284..1105390 cds 369 GNAT fam
1157171..1157356 cds 98 62 gyrase YacG
1157455..1157530 ttc 178
1157709..1158686 cds 326 fucosyl
comp 629856..631229 cds 154 458 tetratricopep PL1H
631384..631458 acc 1
631460..631535 gcg 99
631635..631711 gac 35
631747..631821 gtc 1
631823..631896 cag 153
632050..632259 cds 70 hp comp
1577667..1578095 cds 457 143 DUF1489 PL1I
1578553..1580043 16s 110 1491 bloc?
1580154..1580230 atc 31
1580262..1580337 gca 269
1580607..1581986 23s° 100 1380 réunion
1582087..1582616 23s° 123 530
1582740..1582855 5s 100 116
1582956..1583032 atgf 706 d’où?
1583739..1585157 cds 473 pyruvate kin comp
338004..339383 cds 116 460 hp PL1J
comp 339500..339586 ctc 257
comp 339844..340836 cds 331 ab hydrolase comp
474173..477079 cds 298 969 PAS dom PL1K
477378..477464 ctg 30
477495..477570 gcc 238
477809..478123 cds 105 hp comp
599223..600230 cds 245 336 inorganic P
comp 600476..600550 ggc 351
600902..602071 cds 390 AG cyclase recomb
>comp 699265..699846 cds 210 194 p-hp PL1L
700057..700132 aac 4
700137..700213 gac 32
comp 700246..700851 cds 202 hp
plasmide2
271302..272090 cds 529 263 ATP bind comp
272620..272695 tgg 480
273176..273922 cds 249 sigma-70 fam
449562..450338 cds 465 259 IclR fam modif
450804..452289 16s 584 1486
452874..453640 23s° 128 767
453769..453884 5s 101 116
453986..454062 atgf 359
comp 454422..457751 cds 1110 NERD dom comp
plasmide4
2176963..2177427 cds 107 155 membrane p comp
comp 2177535..2177610 gcc 30
comp 2177641..2177727 ctg 135 CH
comp 2177863..2180208 cds 782 mecano ion
246777..248687 cds 208 637 polymerase recomb
comp 248896..248972 cgg 96
comp 249069..249983 cds 305 ab hydrolase PL4B
319641..319943 cds 134 101 STAS dom
comp 320078..320164 ctc 125
320290..321018 cds 243 lipoyl LipB
comp 401067..402227 cds 281 387 PQQ
comp 402509..402624 5s 129 116
comp 402754..403402 23s° 106 649
comp 403509..403880 16s° 502 372
comp 404383..404577 cds 65 hp
501394..501756 cds 95 121 response reg
501852..501927 aac 4
501932..502008 gac 4
502013..502087 ggc 102
comp 502190..502957 cds 83 256 Hx-t-Hx
503041..503667 cds 249 209 pyridoxamine
comp 503917..504474 16s° 547 558
505022..506005 cds 328 lytic dom modif
comp 601019..603679 cds 358 887 bif CoA
604038..604113 ttc 318
> 604432..605613 cds 394 ss integrase recomb
>comp 131140..131621 cds 193 161 p-erythrose
131815..131891 atgf 202 d’où?
comp 132094..132276 cds 61 hp
plasmide6
88804..89472 cds 397 223 RraA fam
89870..89944 ggc 249
90194..91186 cds 331 UDP-N-acetyl
A2. Azospirillum brasilense strain Az39
sens adresse bloc inter cdsa protéine ordre
chrom
2482875..2484518 cds 365 548 recombinase CHA1
comp 2484884..2484974 tcc 120
comp 2485095..2485898 cds 268 ab hydrolase
comp 2640759..2641325 cds 149 189 Prolyl-tRNA CHA
2641475..2641549 ggc 688
2642238..2642915 cds 226 menaquinone
comp 2764482..2765567 cds 659 362 hp
comp 2766227..2766300 ggg 35
comp 2766336..2766995 cds 220 N-acetyl trans
2781933..2783774 cds 187 614 EAL & GGDEF
comp 2783962..2784077 5s 129 116
comp 2784207..2786959 23s 255 2753
comp 2787215..2787290 gca 30
comp 2787321..2787397 atc 108
comp 2787506..2789006 16s 496 1501
comp 2789503..2790207 cds 235 PAP2 fam
2843264..2843443 cds 77 60 hp
comp 2843521..2843597 cgt 170
2843768..2844268 cds 167 xanthine
125527..126444 cds 127 306 restriction end
comp 126572..126647 gcg 206
126854..127138 cds 95 YggT fam
comp 163237..164982 cds 175 582 Hase HypA
165158..165234 agg 59
165294..166022 cds 243 SDR fam
comp 188235..189860 cds 42 542 glycosyl CHB
comp 189903..189977 acg 81
comp 190059..191987 cds 643 helicas RecQ
comp 250833..251111 cds 169 93 hp
comp 251281..251356 gcc 141
comp 251498..251893 cds 132 TIGR02300
comp 458142..458459 cds 209 106 50s L21
458669..458758 tcg 63
comp 458822..459664 cds 281 ab hydrolase f
comp 496776..497171 cds 162 132 cupin dom CHC
comp 497334..497420 ttg 137
497558..498085 cds 176 disulfide
comp 615937..616350 cds 121 138 hp
comp 616472..616548 ccg 206
comp 616755..616831 ccg 109
comp 616941..617957 cds 339 farnesyl
comp 748703..749161 cds 38 153 hp
comp 749200..749275 aca 91
comp 749367..750221 cds 144 285 23s RlmB
750366..750451 tac 60
750512..750585 gga 81
750667..751857 cds 153 397 elonga Tu
752011..752086 tgg 69
752156..752353 cds 66 subunit SecE
comp 794457..795983 cds 296 509 methyl trans
796280..796355 aag 76
796432..796507 aag 109
comp 796617..797057 cds 147 MaoC fam
870412..872373 cds 159 654 sigma RpoD
872533..872608 atgi 5
comp 872614..873093 cds 134 160 GNAT fam
comp 873228..873304 cgt 212
873517..874023 cds 169 hp
931962..933011 cds 68 350 low Thr
933080..933155 gag 38
933194..933269 gag 72
comp 933342..934340 cds 333 SLT dom
997881..998357 cds 246 159 peptido Pal CHD
comp 998604..998678 acc 175
comp 998854..1000815 cds 654 polysacchard
comp 1164137..1165048 cds 159 304 DUF3108
1165208..1165282 gtg 132
1165415..1165489 gtg 231
1165721..1165885 cds 55 hp
1242416..1242919 cds 85 168 MerR fam
1243005..1243081 ccc 139
comp 1243221..1244999 cds 593 cyclicN bind
comp 1353398..1353895 cds 118 166 hp CHE
1354014..1354091 cca 49
1354141..1354437 cds 10 99 ETC complex
1354448..1354524 aga 443
1354968..1355213 cds 82 hp
comp 1370270..1370500 cds 196 77 hp
comp 1370697..1370772 aac 220
comp 1370993..1371066 tgc 218
1371285..1371941 cds 219 L-iso-Asp
comp 1427443..1427733 cds 236 97 YkgJ fam
comp 1427970..1428085 5s 129 116
comp 1428215..1430967 23s 266 2753
comp 1431234..1431309 gca 30
comp 1431340..1431416 atc 108
comp 1431525..1433015 16s 779 1491
1433795..1437778 cds 1328 non ribosom
comp 1576457..1577296 cds 243 280 ak reductase CHF
comp 1577540..1577615 gaa 123
comp 1577739..1579538 cds 600 ss-DNA
comp 1723089..1723457 cds 344 123 NADH-quinone
comp 1723802..1723878 gac 164
comp 1724043..1724117 gta 106
comp 1724224..1724496 cds 91 HU bind
comp 1730385..1731719 cds 91 445 trigger factor
comp 1731811..1731895 cta 173
comp 1732069..1733634 cds 106 522 malonyl CoA
comp 1733741..1735207 cds 129 489 bif NAD
comp 1735337..1735412 cac 109
comp 1735522..1735597 cac 337
1735935..1736273 cds 113 P-II nitrogen
1951126..1951752 cds 149 209 nitrogen NifQ
1951902..1951987 tac 74
comp 1952062..1952424 cds 121 hp
1996903..1997244 cds 595 114 hp
comp 1997840..1997914 atgj 131
comp 1998046..1999179 cds 378 tRNA MnmA
2086487..2088658 cds 156 724 malate G
comp 2088815..2088889 gtc 234
2089124..2090002 cds 293 N-formyl Glu
comp 2303404..2303880 cds 414 159 bacteriofer
comp 2304295..2304377 tta 406
comp 2304784..2305029 cds 82 hp
plasmide1
>comp 115594..115896 cds 394 101 p-IS5/IS1182 PL1A
comp 116291..116367 atgf 96
comp 116464..116579 5s 129 116
comp 116709..119461 23s 255 2753
comp 119717..119792 gca 30
comp 119823..119899 atc 108
comp 120008..121498 16s 740 1491
122239..123597 cds 453 peptido fam
comp 217550..218176 cds 123 209 ribonucleaseD PL1B
comp 218300..218386 ctg 228
218615..219604 cds 330 NDUFA9
comp 300477..301733 cds 472 419 exo SbcD
302206..303696 16s 108 1491
303805..303881 atc 30
303912..303987 gca 255
304243..306995 23s 129 2753
307125..307240 5s 96 116
307337..307413 atgf 161
<comp 307575..307805 cds 77 p-ATP-bind
comp 466493..467710 cds 231 406 ss integrase PL1C
comp 467942..468031 tca 205
comp 468237..468809 cds 191 hp
512242..512790 cds 136 183 pantetheine
512927..513002 aaa 209
513212..514036 cds 275 DUF3618
931813..933912 cds 79 700 membrane p PL1D
933992..934066 caa 382
comp 934449..935270 cds 274 hp
comp 948715..949743 cds 199 343 Ppx/GppA PL1E
949943..950016 cag 246
comp 950263..950829 cds 189 IS3 fam
> 971260..971532 cds 493 91 P-hp PL1F
comp 972026..972119 agc 197
972317..972550 cds 78 hp
comp 1302373..1303350 cds 166 326 fucosyl PL1G
comp 1303517..1303592 ttc 98
comp 1303691..1303876 cds 62 gyrase YacG
1349823..1350929 cds 145 369 GNAT fam
comp 1351075..1353828 23s 262 2754
comp 1354091..1355591 16s 676 1501
1356268..1356726 cds 153 MarR fam
comp 1441708..1443066 cds 153 453 hp PL1H
1443220..1443294 acc 1
1443296..1443371 gcg 99
1443471..1443547 gac 44
1443592..1443666 gtc 1
1443668..1443741 cag 137
comp 1443879..1446428 cds 850 dip ABC
1566394..1566612 cds 193 73 hp PL1I
comp 1566806..1566921 5s 128 116
comp 1567050..1569802 23s 254 2753
comp 1570057..1570132 gca 30
comp 1570163..1570239 atc 94
comp 1570334..1571834 16s 444 1501
comp 1572279..1572707 cds 143 DUF1489
1723583..1724962 cds 94 460 hp PL1J
comp 1725057..1725143 ctc 475
1725619..1726311 cds 231 FadR fam
1757680..1760568 cds 308 963 PAS dom PL1K
1760877..1760963 ctg 29
1760993..1761068 gcc 247
comp 1761316..1761840 cds 175 Hx-t-Hx
1854042..1855049 cds 135 336 inorganic P
comp 1855185..1855259 ggc 243
1855503..1858685 cds 1061 AAA fam
>comp 1883235..1883816 cds 210 194 P-hp PL1L
1884027..1884102 aac 4
1884107..1884183 gac 32
comp 1884216..1884821 cds 202 hp
plasmide2
comp 51090..51836 cds 481 249 sigma-70 fam
comp 52318..52393 tgg 363
52757..53587 cds 277 hp
comp 809229..810019 cds 870 264 IS5 fam
comp 810890..810966 atgf 96
comp 811063..811178 5s 127 116
comp 811306..814058 23s 266 2753
comp 814325..814400 gca 30
comp 814431..814507 atc 108
comp 814616..816106 16s 452 1491
comp 816559..817443 cds 295 Hx-t-Hx dom
plasmide4
196992..199346 cds 148 785 mecano ion PL4A
199495..199581 ctg 30
199612..199687 gcc 188
199876..201333 cds 486 hp
237538..238578 cds 92 347 response reg PL4B
comp 238671..238747 cgg 96
comp 238844..239821 cds 326 ab hydrolase
comp 257739..258470 cds 125 244 lipoyl LipB
258596..258682 ctc 123
comp 258806..259108 cds 101 STAS dom
comp 399367..400527 cds 278 387 PQQ
comp 400806..400921 5s 129 116
comp 401051..403803 23s 255 2753
comp 404059..404134 gca 30
comp 404165..404241 atc 108
comp 404350..405850 16s 502 1501
comp 406353..406547 cds 65 hp
504531..504893 cds 82 121 response reg
504976..505051 aac 3
505055..505131 gac 4
505136..505210 ggc 102
comp 505313..506080 cds 83 256 Hx-t-Hx
506164..506790 cds 202 209 pyridoxamine
comp 506993..507108 5s 127 116
comp 507236..509988 23s 266 2753
comp 510255..510330 gca 30
comp 510361..510437 atc 110
comp 510548..512038 16s 615 1491
512654..513568 cds 305 lytic dom
comp 588108..590768 cds 340 887 bif CoA
591109..591184 ttc 286
591471..592979 cds 503 FAD bind
plasmide5
86421..87089 cds 455 223 RraA fam
87545..87619 ggc 193
87813..88865 cds 351 UDP-N-acety

abs remarques[modifier | modifier le wikicode]

  • Remarques:
    - Les remarques de abq qui ne changent pas: les intercalaires élevés avec les cds, les intercalaires entre aas (@2) et les séquences des doubles. La phylogénie étroite entre les 2 souches explique cette étroite ressemblance en tout cas pour les intercalaires et les doubles, mais pas pour les blocs à rRNAs.
    - Le tableau des intercalaires et des doubles ci-dessous met en parallèle ces 3 remarques.
    - Les remarques qui changent fondamentalement: ce sont les blocs à rRNAs (@1) et les plasmides (@3). J’ai fait une comparaison détaillée entre les 2 génomes dans abs abq blocs. Elle montre 2 processus distincts:
    1. Le processus de recombinaison qui explique l’ordre des blocs et le changement de certains cds.
    2. Le processus de conversion génique qui, en grande partie, a détruit partiellement les rRNAs 16s et 23s et non les 5s. Cependant un 5s a disparu en laissant son atgf. D’après la majorité des cds identiques entre abs et abq et qui sont attachés à ces blocs, les rRNas modifiés restent sur place.
  • Tableau des intercalaires et des doubles
abs intercalaires aas		abs	intercalaires cds	abs intercalaires cds			
adresse	aas			adresse	rRNA			adresse	aas		
1825516	aac-tgc	219		2168164	16s°	775		365702	cag	746	
2562333	ccg-ccg	205		199382	16s°	738		17144	ggc	670	
1512123	gta-gac	163		1582956	atgf	706		272620	tgg	529-480	isolé
2033754	gtg-gtg	132		913480	16s	675		1397194	agc	453	
1501449	cac-cac	109		503917	16s°	547		1809249	aga	442	
631460	gcg-gac	99		2168653	16s°	522					
2373488	aag-aag	74		403509	16s°	502			atgj	354	
				538069	16s’	495			ctc	257	
				913480	16s	486			ggg	114	
				450804	16s	465					
				1578553	16s	457			cag abq	246	
				200147	atgf	437					
											
abq intercalaires entre aas	abq intercalaires cds		abq intercalaires cds			
1370697	aac-tgc	220		810890	atgf	870		2641475	ggc	688	
616472	ccg-ccg	206		1431525	16s	779		2766227	ggg	659	
1723802	gac-gta	164		120008	16s	740		1997840	atgj	595	
1165208	gtg-gtg	132		1354091	16s	676		972026	agc	493	
1735337	cac-cac	109		510548	16s	615		1725057	ctc	475	
1443296	gcg-gac	99		404350	16s	502		86421	ggc	455	
796280	aag-aag	76		2787506	16s	496		1354448	aga	443	
				302206	16s	472		52318	tgg	481-363	
				814616	16s	452		2304295	tta	414-406	isolé
				1570334	16s	444					
											
intercalaires supérieurs à 500 pbs.											
	agr	oan	abq	abs							
16s	2	4	6	7							
aas	6	12	3	3							
max 16s	633	998	870	775							
max aas	793	1650	688	746							
											
											
Doubles abs			Doubles abq							
aas	n	doublets	aas	n	doublets					
1	39	ccg		1	38	ccg					
2	10	aag		2	11	aag					
3	1	gag		3	1	gag					
4		gtg		4		gtg					
5	1	cac		5	1	cac					

abs distribution[modifier | modifier le wikicode]

aag2 cac2 ccg2 gag2 gtg2  
ggc: 3 1aa et 1 >1aa
Al7 abs, Azospirillum brasilense strain Sp245. alpha.
g1    t1       
atgi 1 tct tat atgf 4
att act aat agt
ctt cct cat cgc
gtt gct gat ggt
ttc 2 tcc 1 tac 2 tgc 1
atc 4 acc 2 aac 3 agc 1
ctc 2 ccc 1 cac 2 cgt 2
gtc 2 gcc 3 gac 4 ggc 4
tta 1 tca 1 taa tga
ata aca 1 aaa 1 aga 1
cta 1 cca 1 caa 1 cga
gta 1 gca 4 gaa 1 gga 1
ttg 1 tcg 1 tag tgg 2
atgj 1 acg 1 aag 2 agg 1
ctg 3 ccg 2 cag 2 cgg 1
gtg 2 gcg 2 gag 2 ggg 1
alpha >1aa =1aa -5s +5s -16s +16s total
abs 30 39 3 8 80

abs. Intergen51[modifier | modifier le wikicode]

Intergen51. abs. Le génome[modifier | modifier le wikicode]

  • abs Le prélèvement: Aalpha
  • Le nom et le lien NCBI: abs, Azospirillum baldaniorum, NCBI [38], date 25.4.21.
  • abs La longueur totale des intercalaires, longueur du génome et taux intercalaires/génome:
Nom	intercals	génome		taux en %			
abs	363,304		3,023,440	12.0		
abs données intercalaires[modifier | modifier le wikicode]
abs données intercalaires 200[modifier | modifier le wikicode]
abs autres intercalaires aas[modifier | modifier le wikicode]

Intergen51. abs. Les différents types d'intercalaires[modifier | modifier le wikicode]

  • Lien au tableur: Intergen51. abs les différents types d'intercalaires.
  • Légende:
    - S pour intercalaire CDS-CDS et R pour tRNA-CDS,
    - c pour intercalaire continu (les 2 gènes sont sur le même brin) et x pour discontinu (les 2 gènes sont sur 2 brins différents, le brin et son complément)
    - %reste = 100*reste/total, le reste étant ce qui reste du total après la fin du diagramme, gamme.
    - %t30 = 100*t30/total, t30 étant le total des fréquences 10 20 30
    - %t5 = 100*t/total, t5 étant le total des fréquences de -1 à -5 dans le diagramme des S-.
Int51.2 abs les différents types d'intercalaires entre gène
Int51.21 Les différents types
intercalaires CDS-CDS * autres intercalaires
continu S+ S- S0 total c/x RNA-RNA CDS-rRNA total
c 1,564 324 6 1,894 2.1 12 1 13
x 881 34 2 917 0 1 1
t 2,445 358 8 2,811 12 2 14
% 87.0 12.7 0.3
Int51.22 Détail des * autres intercalaires
intercalaires tRNA-CDS récapitulatif des * autres intercalaires
continu R+ R- R0 total c/x * autres total %
c 36 0 0 36 1.2 tRNA-CDS 66 60
x 30 0 0 30 RNA-RNA 12 11
t 66 0 0 66 CDS-rRNA 2 2
% 100.0 0.0 0.0 non RNA 30 27
- total 110 100
Int51.23 Les taux remarquables
taux %reste %t30 %t5 %0
type S+ R+ S- S+ R+ S- S+ R+
gamme 400 400 6-50 - - - - -
type S+ R+ S- S+ R+ S- S+ R+
c 3.5 5.6 3.4 24.8 2.8 77 0.3 0.0
x 10.2 0.0 8.8 18.9 3.3 12 0.2 0.0

Intergen51. abs. Les diagrammes CDS-CDS positifs[modifier | modifier le wikicode]

  • Lien tableur: Les diagrammes
  • Diagrammes des gamma:  abs présente 2 diagrammes
    - fc40, CDS-CDS continu, fréquence unitaire en abscisses et effectif en ordonnées
    - fx%, CDS-CDS discontinu, fréquences regroupées par 10 (freq10) en abscisses et pourcentage en ‰ par rapport au total, en ordonnées.
  • Équations des courbes de tendance en pour 1000: colonnes %fx %fc
Courbes de tendances pour les diagrammes en pour 1000			Calculs des f.41	abs
R2	x3		x2		x		c		Inflexion poly3	x	c
0.750	-1.80E-06	1.34E-03	-3.91E-01	58.8	fx1	abscisse	235.5	197.1
0.883	-2.23E-06	1.96E-03	-6.44E-01	85.2	fc1	ordonnée	18.4	21.2
								
0.822	2.18E-06	-1.54E-03	2.33E-01	20.5	fx41			
0.952	2.74E-06	-1.62E-03	1.23E-01	38.9	fc41			
données	abs		calculs			formules				légende  de la colonne calculs
effect	1570		R2.21	756		diagramme pol21				coefficient de détermination polynôme 21
xm	45		pte	17,64		1000*(-1+1000*ym/effect)/(x1m-xm)	pente de la diagonale
ym	6		cste	4,62		1+x1m*pte/1000				sa constante
x1m	205		r400l	195		400-x1m					longueur de x1m à 400
y1m	1		restp	157,96		rfin+r400				somme des intercalaires au-delà de x1m
rfin	35,03		%sd	33,76		100*supd/supdt				taux des intercalaires au-dessus de la diagonale
bornf	145		lond	160		x1m-xm					longueur de la diagonale
supd	178,07		%sf	31,67		100*supf/supft				taux des intercalaires pour la forme
supdt	527,39		lonf	100		bornf-xm				longueur de la forme
xmp	314,65		sf/lf	1,24		supf/lonf				indice intercalaire de la forme
r400	122,93		sr/lr	0,91		(supd-supf)/(lond-lonf)			indice intercalaire du reste de la diagonale
supf	123,66		sd/ld	1,11		supd/lond				indice intercalaire de la diagonale
supft	390,45		i.r400	0,63		r400/r400i				indice intercalaire de r400
										
poly3	abs									
abscis	400									
flexa	188									
flexo	2,21									
xm	45									
sup4	205,8									
sup4t	496,2									
%s4	41,5									
lon4	143

Légende de la colonne données					suite de la légende des données	
effect	total des intercalaires du génome			supf	somme des intercalaires au-dessus de la diagonale de xm à bornf
xm	abscisse du minmum local 				supft	somme des intercalaires de xm à bornf
ym	son ordonnée en effectif				poly3	
x1m	abscisse à 1‰ de la courbe des moyennes			abscis	abscisse limite des diagrammes en poly3
y1m	l’ordonnée de 1‰ 					flexa	abscisse du point d’inflexion de la courbe
rfin	reste des intercalaires àprès 400			flexo	son ordonnée
bornf	borne estimée de la forme				xm	abscisse du minmum local du diagramme poly3
supd	somme des intercalaires au-dessus de la diagonale	sup4	somme des intercalaires au-dessus  de l’horizontale flexo de xm à flexa
supdt	somme des intercalaires de xm à y1m			sup4t	somme des intercalaires de xm à flexa
xmp	somme des intercalaires de 0 à xm			%s4	taux des intercalaires pour poly3
r400	somme des intercalaires de y1m à 400			lon4	longueur de xm à flexa					

Intergen51. abs. Les CDS-CDS négatifs[modifier | modifier le wikicode]

Sous-totaux	abs			totale	
fréquence	x-	c-		x-	c-
 - 1		0	55		4	4140
 - 2		1	0		85	11
 - 3		0	0		3	12
 - 4		3	194		717	10938
 - 5		0	0		5	19
sp6		30	75		1642	8424
total		34	324		2,456	23,544
reste		3	11		264	420
s6		3	2		361	41
s7		7	15		321	1438
s8		17	47		696	6525
rappot s1-5						
4/2/1		3.0	3.5		8.4	2.6
% / sp6						
s6/sp6		10.0	2.7		22.0	0.5
s7/sp6		23.3	20.0		19.5	17.1
s8/sp6		56.7	62.7		42.4	77.5
reste/sp6	10.0	14.7		16.1	5.0
						
total s1-5	4	249		814	15120
% / total						
%s1-5		11.8	76.9		33.1	64.2
%sp6		88.2	23.1		66.9	35.8

Intergen51. abs. Les intercalaires des blocs[modifier | modifier le wikicode]

  • Le détail
RNA-RNA		c	x		CDS-RNA		c	x
23s 5s		1			CDS 16s			
16s 23s					5s CDS		1	1
16s tRNA				16 CDS			
tRNA 23s	1			CDS 5s			
5s tRNA					23s CDS			
tRNA in					CDS 23s			
tRNA contig	1			5s 16s			
tRNA hors	9			16s16s			
tRNA 16s								
23s tRNA								
tRNA 5s								
16s 5s								
5s 23s								
5s 5s								
total		12	0		total		1	1
  • Les rares voir gamma pour la longueur des intercalaires
  • Les tRNA-CDS compris, comparaison dans le clade et dans l'étude.

Intergen51. abs. Les intercalaires tRNA-tRNA extra bloc[modifier | modifier le wikicode]

absp. Intergen51[modifier | modifier le wikicode]

Intergen51. absp. Le génome[modifier | modifier le wikicode]

  • absp Le prélèvement: Aalpha
  • Le nom et le lien NCBI: absp, Azospirillum baldaniorum plasmid AZOBR_p1, NCBI [39], date 11.4.22.
  • absp La longueur totale des intercalaires, longueur du génome et taux intercalaires/génome:
Nom	intercals	génome		taux en %			
absp	211,208		1,766,028	12.0	
absp données intercalaires[modifier | modifier le wikicode]
absp données intercalaires 200[modifier | modifier le wikicode]
absp autres intercalaires aas[modifier | modifier le wikicode]