Recherche:Genèse et duplication des gènes des tRNAs/Annexe/Tableur

Une page de Wikiversité.
Sauter à la navigation Sauter à la recherche
Tableur
Image logo représentative de la faculté
Annexe 2
Recherche : Genèse et duplication des gènes des tRNAs
Précédent :Sommaire
Suivant :Tableaux
Icon falscher Titel.svg
En raison de limitations techniques, la typographie souhaitable du titre, « Annexe : Tableur
Genèse et duplication des gènes des tRNAs/Annexe/Tableur
 », n'a pu être restituée correctement ci-dessus.



Paris le 01.08.18

Sommaire

Liste des génomes[modifier | modifier le wikicode]

E79[modifier | modifier le wikicode]

E79 liste[modifier | modifier le wikicode]

Lien tableaux

tRNAs;KEGG;Génome
1463;aml;Ailuropoda melanoleuca (panda) (BGI-Shenzhen AilMel 1.0 Dec 2009)
211;acs;Anolis carolinensis (lizard) (Broad AnoCar2.0 May 2010)
414;aga;Anopheles gambiae
684;ath;Arabidopsis thaliana (TAIR10 Feb 2011)
7080;bacu;Balaenoptera acutorostrata scammoni (Minke whale Oct. 2013 BalAcu1.0/balAcu1)
4040;bta;Bos taurus (Cow Jun. 2014 Bos_taurus_UMD_3.1.1/bosTau8)
639;bdi;Brachypodium distachyon (JGI v1.0 8X)
1095;cbr*;Caenorhabditis brenneri (WUGSC 6.0.1 Feb 2008)
743;cbr;Caenorhabditis briggsae (C. briggsae Jan. 2007 WUGSC 1.0/cb3)
596;cel;Caenorhabditis elegans (WS220 Oct 2010)
827;cja*;Caenorhabditis japonica (WUGSC 3.0.2 Mar 2008)
408;cjc;Callithrix jacchus (marmoset) (WUGSC 3.2 Mar 2009)
13727;cmk;Callorhinchus milii (Elephant shark Dec. 2013 Callorhinchus_milii-6.1.3/calMil1)
906;cfa;Canis familiaris (dog) (CanFam3.1 Sept 2011)
383;cpo*;Cavia porcellus (Guinea pig) (Broad Feb 2008)
518;csi*;Ceratotherium simum (White rhinoceros May 2012 CerSimSim1.0/cerSim1)
554;cpic;Chrysemys picta bellii (Painted turtle Dec. 2011 v3.0.1/chrPic1)
498;cge;Cricetulus griseus cell line CHO-K1 (Chinese hamster ovary CriGri 1.0 Aug 2011)
1119;dno*;Dasypus novemcinctus (Armadillo Dec. 2011 Baylor/dasNov3)
289;dme;Drosophila melanogaster (D. melanogaster Aug. 2014 BDGP Release 6 + ISO1 MT/dm6)
256;dsi;Drosophila simulans (D. simulans Apr. 2005 WUGSC mosaic 1.0)
326;dya;Drosophila yakuba (D. yakuba Nov. 2005 WUGSC 7.1)
494;ecb;Equus caballus (horse) (Sep 2007)
485;eeu*;Erinaceus europaeus (Hedgehog May 2012 EriEur2.0/eriEur2)
3729;fca;Felis catus (cat) (Felis_catus-6.2 Sept 2011)
1492;gmo*;Gadus morhua (Atlantic cod May 2010 Genofisk GadMor_May2010/gadMor1)
283;gga;Gallus gallus (galGal4 Nov 2011)
2489;gac*;Gasterosteus aculeatus (stickleback) (Broad 1.0 Feb 2006)
203;gfr;Geospiza fortis (Medium ground finch Apr. 2012 GeoFor_1.0/geoFor1)
738;gmx;Glycine max (soybean) (Wm82.a2)
435;ggo;Gorilla gorilla gorilla (gorilla) (gorGor3.1 May 2011)
367;hgl;Heterocephalus glaber (Naked mole-rat Jan. 2012 Broad HetGla_female_1.0/hetGla2)
622;hsa;Homo sapiens (hg38 - GRCh38 Dec 2013)
373;lcm;Latimeria chalumnae (Coelacanth Aug. 2011 Broad/latCha1)
82;lma;Leishmania major
2002;lav;Loxodonta africana (elephant) (Broad/July 2009)
458;mcc;Macaca mulatta (Rhesus Oct. 2010 BGI CR_1.0/rheMac3)
353;meu*;Macropus eugenii (Wallaby Sep. 2009 TWGS Meug_1.1/macEug2)
582;mtr;Medicago truncatula (March 2009 Version 3.0)
155;mgp;Meleagris gallopavo (turkey) (TGC Turkey_2.01 Dec 2009)
191;mun*;Melopsittacus undulatus (Budgerigar Sep. 2011 WUSTL v6.3/melUnd1)
258;mmr*;Microcebus murinus (Mouse lemur) (Jun 2003)
481;mdo;Monodelphis domestica (opossum) (Broad Oct 2006)
469;mmu;Mus musculus (mm10 Dec 2011)
749;mpu*;Mustela putorius furo (Ferret Apr. 2011 MusPutFur1.0/musFur1)
252;mlu*;Myotis lucifugus (Microbat Jul. 2010 Broad Institute Myoluc2.0/myoLuc2)
421;nle;Nomascus leucogenys (Gibbon Oct. 2012 GGSC Nleu3.0/nomLeu3)
338;opr*;Ochotona princeps (Pika May 2012 OchPri3.0/ochPri3)
674;oni*;Oreochromis niloticus (Nile tilapia Jan. 2011 Broad oreNil1.1/oreNil2)
856;oaa;Ornithorhynchus anatinus (platypus) (WUGSC 5.0.1 Mar 2007)
506;ocu;Oryctolagus cuniculus (rabbit) (Broad Apr 2009)
738;osa;Oryza sativa
326;oga*;Otolemur garnettii (Bushbaby Mar. 2011 Broad/otoGar3)
1176;oas;Ovis aries (sheep) (Feb 2010)
503;ptr;Pan troglodytes (Chimp Feb. 2011 CSAC 2.1.4/panTro4)
476;pan*;Papio anubis (Baboon Mar. 2012 Baylor Panu_2.0/papAnu2)
411;pha*;Papio hamadryas (baboon) (Nov 2008)
2485;pma*;Petromyzon marinus (Lamprey Sep. 2010 WUGSC 7.0/petMar2)
418;ppp;Physcomitrella patens 
35;pfa;Plasmodium falciparum
517;ppy*;Pongo pygmaeus abelii (Orangutan July 2007 WUGSC 2.0.2/ponAbe2)
618;pop;Populus trichocarpa (Jan 2010 Version 2.0) 
407;rno;Rattus norvegicus (rn5 Mar 2012)
334;sbq;Saimiri boliviensis (Squirrel monkey Oct. 2011 Broad/saiBol1)
446;shr;Sarcophilus harrisii (Tasmanian devil Feb. 2011 WTSI Devil_ref v7.0/sarHar1)
374;san*;Sorex araneus (Shrew Aug. 2008 Broad/sorAra2)
578;sbi;Sorghum bicolor (Version 1.0)
804;str*;Spermophilus tridecemlineatus (Squirrel Nov. 2011 Broad/speTri2)
1065;spu;Strongylocentrotus purpuratus (Sea urchin) 
807;ssc;Sus scrofa (Pig Aug. 2011 SGSC Sscrofa10.2/susScr3)
230;tgu;Taeniopygia guttata (Zebra finch Feb. 2013 WashU taeGut324/taeGut2)
575;tru;Takifugu rubripes (Fugu Oct. 2011 FUGU5/fr3)
455;tsy*;Tarsius syrichta (Tarsier Sep. 2013 Tarsius_syrichta-2.0.1/tarSyr2)
540;tng;Tetraodon nigroviridis (tetraodon) (Genoscope 8.0 Mar 2007)
2017;tma*;Trichechus manatus latirostris (Manatee Oct. 2011 Broad v1.0/triMan1)
5845;ttr*;Tursiops truncatus (Dolphin Oct. 2011 Baylor Ttru_1.4/turTru2)
499;vvi;Vitis vinifera (Grapevine 12X)
2639;xtr;Xenopus tropicalis (frog) (JGI 4.2 Nov 2009)
1198;zma;Zea mays (Version 5b.60)

E79 décomptes[modifier | modifier le wikicode]

Lien tableaux

acs;;;;aga;;;;aml;;;;ath;;;;bacu;;;;bdi;;;;bta;;;;cbr;;;;cbre;;;;cel;;;;cfa;;;;cge;;;;cjap;;;;cjc;;;;cmk;;;;cpic;;;;cpo;;;;csi;;;;dme;;;;dno;;;;dsi;;;;dya;;;;ecb;;;;eeu;;;;fca;;;;gac;;;;gfr;;;;gga;;;;ggo;;;;gmo;;;;gmx;;;;hgl;;;;hsa-18;;;;lav;;;;lcm;;;;lma;;;;mcc;;;;mdo;;;;meu;;;;mgp;;;;mlu;;;;mmr;;;;mmu;;;;mpu;;;;mtr;;;;mun;;;;nle;;;;oaa;;;;oas;;;;ocu;;;;oga;;;;oni;;;;opr;;;;osa;;;;pan;;;;pfa;;;;pha;;;;pma;;;;pop;;;;ppp;;;;ppy;;;;ptr;;;;rno;;;;san;;;;sbi;;;;sbq;;;;shr;;;;spu;;;;ssc;;;;str;;;;tgu;;;;tma;;;;tng;;;;tru;;;;tsy;;;;ttr;;;;vvi;;;;xtr;;;;zma;;;;;;dre;;;;
5;3;(AAC);;31;7;(AAC);;10;2;(AAC);;15;3;(AAC);;14;9;(AAC);;16;5;(AAC);;6;6;(AAA);;25;7;(AAC);;33;3;(AAC);;19;4;(AAC);;6;4;(AAC);;13;9;(AAC);;1;1;(AAA);;7;4;(AAC);;3;3;(AAA);;2;2;(AAA);;;;;;11;6;(AAC);;6;2;(AAC);;12;8;(AAC);;7;2;(AAC);;7;2;(AAC);;12;5;(AAC);;7;4;(AAC);;1;1;(AAA);;21;12;(AAC);;2;2;(AAC);;7;5;(AAC);;9;7;(AAC);;6;6;(AAA);;22;7;(AAC);;12;11;(AAC);;10;6;(AAC);;1;1;(AAA);;3;3;(AAC);;2;1;(AAC);;10;7;(AAC);;9;3;(AAC);;1;1;(AAA);;3;3;(AAC);;5;2;(AAC);;4;2;(AAC);;8;6;(AAC);;8;5;(AAC);;1;1;(AAA);;4;3;(AAC);;1;1;(AAA);;1;1;(AAA);;1;1;(AAA);;12;8;(AAC);;1;1;(AAA);;8;2;(AAC);;7;5;(AAC);;18;7;(AAC);;1;1;(AAA);;1;1;(AAC);;9;4;(AAC);;2;2;(AAA);;6;5;(AAA);;2;2;(AAA);;10;6;(AAC);;11;5;(AAC);;1;1;(AAA);;;;;;16;7;(AAC);;6;4;(AAC);;8;1;(AAC);;2;2;(AAA);;10;6;(AAC);;1;1;(AAA);;2;2;(AAA);;1;1;(AAA);;1;1;(AAA);;1;1;(AAA);;6;5;(AAC);;8;7;(AAC);;2;2;(AAA);;2;2;(AAA);;1;1;(AAA);;;;10;10;(AAA);;
4;2;(AAG);;5;2;(AAG);;7;5;(AAG);;12;3;(AAG);;6;2;(AAG);;14;7;(AAG);;20;13;(AAC);;26;5;(AAG);;32;3;(AAG);;20;6;(AAG);;4;1;(AAG);;5;2;(AAG);;23;4;(AAC);;8;4;(AAG);;22;16;(AAC);;16;15;(AAC);;6;2;(AAC);;6;3;(AAG);;4;1;(AAG);;5;2;(AAG);;5;1;(AAG);;5;1;(AAG);;7;2;(AAG);;6;2;(AAG);;8;4;(AAC);;49;18;(AAG);;4;3;(AAG);;3;3;(AAG);;9;5;(AAG);;21;13;(AAC);;16;1;(AAG);;5;3;(AAG);;9;4;(AAG);;41;34;(AAC);;4;3;(AAG);;3;1;(AAG);;9;7;(AAC);;8;3;(AAG);;8;3;(AAC);;1;1;(AAG);;3;2;(AAG);;5;2;(AAG);;5;3;(AAG);;6;2;(AAG);;17;6;(AAC);;3;3;(AAG);;11;7;(AAC);;23;16;(AAC);;7;4;(AAC);;5;3;(AAG);;6;3;(AAC);;14;9;(AAG);;5;3;(AAG);;15;4;(AAG);;9;5;(AAC);;1;1;(AAG);;9;5;(AAG);;166;70;(AAC);;17;4;(AAC);;13;3;(AAC);;16;10;(AAG);;11;6;(AAG);;8;5;(AAC);;7;2;(AAC);;15;4;(AAG);;7;3;(AAG);;9;3;(AAG);;20;3;(AAC);;8;3;(AAG);;18;14;(AAC);;9;8;(AAC);;11;8;(AAC);;10;7;(AAC);;19;11;(AAC);;6;3;(AAG);;6;1;(AAG);;15;7;(AAC);;55;19;(AAC);;22;11;(AAC);;;;232;86;(AAC);;
6;2;(AAT);;12;2;(AAT);;12;5;(AAT);;17;2;(AAT);;12;6;(AAT);;20;7;(AAT);;11;5;(AAG);;21;4;(AAT);;33;2;(AAT);;21;2;(AAT);;9;5;(AAT);;13;3;(AAT);;26;4;(AAG);;13;8;(AAT);;20;14;(AAG);;2;2;(AAG);;5;2;(AAG);;13;6;(AAT);;10;2;(AAT);;12;6;(AAT);;9;3;(AAT);;10;2;(AAT);;20;7;(AAT);;9;2;(AAT);;6;1;(AAG);;101;17;(AAT);;6;2;(AAT);;7;1;(AAT);;14;9;(AAT);;33;22;(AAG);;31;19;(AAT);;8;3;(AAT);;15;10;(AAT);;22;18;(AAG);;7;6;(AAT);;3;1;(AAT);;12;8;(AAT);;13;1;(AAT);;5;3;(AAG);;3;2;(AAT);;10;4;(AAT);;4;2;(AAT);;12;5;(AAT);;10;4;(AAT);;9;6;(AAG);;5;2;(AAT);;10;6;(AAG);;8;5;(AAG);;6;3;(AAG);;11;5;(AAT);;4;1;(AAG);;25;13;(AAT);;8;2;(AAT);;18;4;(AAT);;8;4;(AAG);;1;1;(AAT);;12;7;(AAT);;112;56;(AAG);;49;36;(AAG);;6;1;(AAG);;16;9;(AAT);;17;11;(AAT);;1;1;(AAG);;6;2;(AAG);;17;3;(AAT);;11;5;(AAT);;11;1;(AAT);;18;13;(AAG);;13;1;(AAT);;6;3;(AAG);;2;2;(AAG);;8;5;(AAG);;15;13;(AAG);;11;8;(AAG);;8;3;(AAT);;11;6;(AAT);;10;5;(AAG);;38;18;(AAG);;29;10;(AAG);;;;270;146;(AAG);;
4;2;(ACG);;10;1;(ACG);;8;3;(ACG);;11;7;(ACG);;2;2;(ACA);;16;4;(ACG);;18;4;(AAT);;22;5;(ACG);;2;2;(ACA);;18;4;(ACG);;6;5;(ACG);;1;1;(ACC);;26;6;(AAT);;6;2;(ACG);;31;23;(AAT);;11;9;(AAT);;10;3;(AAT);;10;6;(ACG);;10;1;(ACG);;24;24;(ACC);;9;1;(ACG);;12;1;(ACG);;10;4;(ACG);;6;3;(ACG);;10;2;(AAT);;49;12;(ACG);;6;5;(ACG);;8;4;(ACG);;1;1;(ACA);;26;21;(AAT);;13;2;(ACG);;4;4;(ACC);;7;2;(ACG);;43;30;(AAT);;5;5;(ACA);;4;1;(ACG);;2;2;(ACA);;4;4;(ACA);;6;2;(AAT);;2;2;(ACG);;6;5;(ACG);;1;1;(ACA);;1;1;(ACA);;6;3;(ACG);;23;9;(AAT);;3;2;(ACG);;13;9;(AAT);;27;17;(AAT);;6;3;(AAT);;7;3;(ACG);;10;4;(AAT);;1;1;(ACA);;7;3;(ACG);;1;1;(ACA);;14;9;(AAT);;1;1;(AGA);;2;2;(ACA);;110;63;(AAT);;20;6;(AAT);;12;3;(AAT);;7;3;(ACG);;1;1;(ACA);;12;7;(AAT);;15;8;(AAT);;15;4;(ACG);;1;1;(ACA);;4;4;(ACG);;69;12;(AAT);;1;1;(ACA);;14;8;(AAT);;40;35;(AAT);;13;8;(AAT);;18;10;(AAT);;12;3;(AAT);;1;1;(ACA);;6;5;(ACA);;15;6;(AAT);;63;18;(AAT);;69;37;(AAT);;;;258;129;(AAT);;
5;1;(AGA);;6;2;(AGA);;2;2;(ACT);;37;11;(AGA);;12;11;(ACC);;11;3;(AGA);;143;134;(ACA);;17;3;(AGA);;32;4;(ACG);;1;1;(ACT);;10;5;(AGA);;6;3;(ACG);;21;4;(ACG);;9;4;(AGA);;1;1;(ACA);;5;5;(ACA);;7;3;(ACG);;13;5;(AGA);;8;3;(AGA);;10;5;(ACG);;8;3;(AGA);;9;3;(AGA);;12;4;(AGA);;7;2;(AGA);;1;1;(ACA);;52;14;(AGA);;2;1;(AGA);;9;5;(AGA);;7;4;(ACG);;31;23;(ACG);;15;5;(AGA);;5;3;(ACG);;9;4;(AGA);;1;1;(ACA);;4;2;(ACG);;1;1;(AGA);;6;3;(ACG);;5;5;(ACG);;7;5;(ACG);;5;3;(AGA);;6;2;(AGA);;6;4;(ACG);;2;2;(ACC);;8;3;(AGA);;1;1;(ACA);;4;4;(AGA);;1;1;(ACA);;2;2;(ACC);;16;16;(ACA);;10;3;(AGA);;6;4;(ACG);;16;4;(ACG);;7;2;(AGA);;24;7;(ACG);;4;4;(ACA);;1;1;(AGC);;7;4;(ACG);;1;1;(ACC);;1;1;(ACA);;1;1;(ACC);;11;8;(AGA);;7;2;(ACG);;6;3;(ACG);;9;5;(ACG);;11;3;(AGA);;6;2;(ACG);;10;3;(AGA);;29;9;(ACG);;7;2;(ACG);;7;7;(ACC);;1;1;(ACA);;5;5;(ACA);;14;4;(ACG);;16;3;(ACG);;6;3;(ACG);;19;18;(ACC);;1;1;(ACA);;2;2;(ACA);;1;1;(ACA);;;;9;9;(ACA);;
12;6;(AGC);;17;4;(AGC);;10;4;(AGA);;16;3;(AGC);;9;6;(ACG);;19;3;(AGC);;20;20;(ACC);;29;7;(AGC);;20;4;(AGA);;15;4;(AGA);;14;11;(AGC);;6;1;(AGA);;19;5;(AGA);;15;13;(AGC);;2;2;(ACC);;7;5;(ACG);;8;2;(AGA);;23;16;(AGC);;12;2;(AGC);;10;3;(AGA);;9;1;(AGC);;18;4;(AGC);;27;16;(AGC);;14;10;(AGC);;2;2;(ACC);;53;22;(AGC);;16;7;(AGC);;24;11;(AGC);;11;5;(AGA);;1;1;(ACT);;24;3;(AGC);;2;2;(ACT);;26;16;(AGC);;4;4;(ACC);;3;3;(AGA);;2;1;(AGC);;9;4;(AGA);;12;6;(AGA);;8;2;(AGA);;7;3;(AGC);;8;5;(AGC);;7;6;(AGA);;6;3;(ACG);;15;13;(AGC);;1;1;(ACC);;9;2;(AGC);;7;3;(ACG);;12;8;(ACG);;5;5;(ACC);;21;14;(AGC);;2;2;(ACT);;2;2;(ACT);;15;11;(AGC);;12;5;(AGA);;7;3;(ACG);;1;1;(AGG);;9;3;(AGA);;85;30;(ACG);;12;8;(ACG);;8;3;(ACG);;22;19;(AGC);;3;3;(ACT);;1;1;(ACT);;8;4;(AGA);;27;13;(AGC);;9;3;(AGA);;18;8;(AGC);;26;9;(ACT);;10;4;(AGA);;6;3;(ACG);;1;1;(ACC);;9;9;(ACC);;1;1;(ACT);;11;6;(AGA);;7;4;(AGA);;7;5;(ACG);;11;10;(ACG);;33;13;(ACG);;35;10;(ACG);;;;11;11;(ACC);;
3;1;(AGG);;7;5;(AGG);;17;14;(AGC);;16;5;(AGG);;10;7;(AGA);;15;4;(AGG);;13;6;(ACG);;6;4;(AGG);;35;2;(AGC);;22;6;(AGC);;8;1;(AGG);;22;17;(AGC);;31;8;(AGC);;7;1;(AGG);;9;5;(ACG);;3;3;(ACT);;28;24;(AGC);;10;2;(AGG);;7;1;(AGG);;23;16;(AGC);;6;1;(AGG);;6;1;(AGG);;10;1;(AGG);;10;2;(AGG);;9;4;(ACG);;63;5;(AGG);;4;1;(AGG);;7;1;(AGG);;23;20;(AGC);;30;18;(AGA);;21;5;(AGG);;7;5;(AGA);;9;2;(AGG);;14;10;(ACG);;5;2;(AGC);;2;1;(AGG);;22;18;(AGC);;15;6;(AGC);;13;9;(AGC);;7;2;(AGG);;6;1;(AGG);;11;8;(AGC);;10;5;(AGA);;9;1;(AGG);;12;7;(ACG);;3;3;(AGG);;10;7;(AGA);;18;11;(ACT);;2;2;(ACG);;9;1;(AGG);;6;4;(AGA);;10;4;(AGA);;8;1;(AGG);;20;4;(AGC);;10;4;(AGA);;1;1;(CAA);;19;16;(AGC);;22;8;(AGA);;1;1;(ACT);;13;3;(AGA);;11;3;(AGG);;12;6;(AGA);;11;9;(AGA);;10;8;(AGC);;14;5;(AGG);;15;12;(AGC);;10;2;(AGG);;32;11;(AGC);;23;18;(AGC);;15;9;(AGA);;6;4;(ACG);;8;5;(ACG);;14;9;(AGA);;12;5;(AGC);;12;10;(AGC);;12;9;(AGA);;13;9;(AGA);;40;17;(AGA);;13;5;(AGA);;;;203;56;(ACG);;
4;3;(AGT);;8;1;(AGT);;9;2;(AGG);;10;3;(AGT);;20;18;(AGC);;9;7;(AGT);;4;4;(ACT);;22;2;(AGT);;25;12;(AGG);;6;4;(AGG);;8;6;(AGT);;7;1;(AGG);;9;2;(AGG);;10;9;(AGT);;26;14;(AGA);;24;22;(AGA);;8;2;(AGG);;10;7;(AGT);;9;3;(AGT);;7;1;(AGG);;8;1;(AGT);;8;1;(AGT);;9;7;(AGT);;9;7;(AGT);;2;2;(ACT);;99;50;(AGT);;5;3;(AGT);;4;4;(AGT);;10;5;(AGG);;55;31;(AGC);;9;6;(AGT);;46;45;(AGC);;9;6;(AGT);;3;3;(ACT);;12;10;(AGG);;3;1;(AGT);;8;2;(AGG);;11;1;(AGG);;7;3;(AGG);;4;4;(AGT);;5;3;(AGT);;7;1;(AGG);;23;19;(AGC);;10;8;(AGT);;12;5;(AGA);;5;4;(AGT);;19;17;(AGC);;83;51;(AGC);;2;1;(AGA);;8;6;(AGT);;13;8;(AGC);;18;7;(AGC);;7;6;(AGT);;14;4;(AGG);;20;16;(AGC);;1;1;(CAC);;7;2;(AGG);;106;44;(AGC);;14;6;(AGA);;19;9;(AGC);;12;8;(AGT);;31;26;(AGC);;36;31;(AGC);;8;1;(AGG);;12;9;(AGT);;9;4;(AGG);;9;5;(AGT);;19;5;(AGG);;9;1;(AGG);;256;252;(AGC);;3;2;(ACT);;5;5;(ACT);;20;13;(AGC);;10;3;(AGG);;7;2;(AGG);;19;14;(AGC);;11;2;(AGC);;67;17;(AGC);;66;32;(AGC);;;;14;11;(ACT);;
2;1;(CAA);;4;4;(CAA);;10;6;(AGT);;12;6;(CAA);;7;2;(AGG);;1;1;(ATA);;13;5;(AGA);;11;10;(CAA);;31;5;(AGT);;17;3;(AGT);;2;2;(ATC);;8;7;(AGT);;24;7;(AGT);;1;1;(ATA);;75;56;(AGC);;11;10;(AGC);;10;10;(AGT);;1;1;(ATC);;4;4;(CAA);;11;10;(AGT);;4;4;(CAA);;1;1;(ATT);;1;1;(ATA);;6;6;(CAA);;8;3;(AGA);;1;1;(ATT);;1;1;(ATT);;3;3;(CAA);;9;7;(AGT);;55;30;(AGG);;2;2;(ATT);;13;9;(AGG);;1;1;(ATA);;29;20;(AGA);;11;8;(AGT);;1;1;(CAA);;10;7;(AGT);;12;6;(AGT);;8;5;(AGT);;2;2;(CAA);;5;5;(ATG);;3;3;(AGT);;8;3;(AGG);;1;1;(ATG);;25;10;(AGC);;3;3;(CAA);;9;4;(AGG);;19;6;(AGG);;18;11;(AGC);;1;1;(ATC);;7;1;(AGG);;14;4;(AGG);;4;4;(CAA);;11;3;(AGT);;9;4;(AGG);;1;1;(CAG);;10;6;(AGT);;54;18;(AGG);;20;2;(AGC);;13;2;(AGG);;2;2;(ATA);;11;7;(AGG);;33;23;(AGG);;8;6;(AGT);;1;1;(ATA);;9;7;(AGT);;3;3;(CAA);;27;13;(AGT);;13;7;(AGT);;12;5;(AGG);;3;1;(AGA);;14;10;(AGA);;13;9;(AGG);;18;11;(AGT);;9;7;(AGT);;7;3;(AGG);;15;6;(AGG);;60;18;(AGG);;15;4;(AGG);;;;336;176;(AGA);;
3;1;(CAC);;29;8;(CAC);;1;1;(ATC);;8;2;(CAC);;13;9;(AGT);;3;3;(ATG);;31;19;(AGC);;6;3;(CAC);;2;2;(ATA);;7;7;(CAA);;1;1;(ATT);;4;4;(CAA);;7;7;(CAA);;1;1;(ATC);;12;11;(AGG);;12;8;(AGG);;1;1;(ATC);;2;2;(ATT);;7;2;(CAC);;1;1;(ATG);;6;2;(CAC);;4;4;(CAA);;1;1;(ATG);;4;2;(CAC);;18;14;(AGC);;7;6;(CAA);;2;2;(CAA);;7;5;(CAC);;4;4;(ATA);;30;20;(AGT);;18;8;(CAA);;15;15;(AGT);;7;7;(CAA);;54;40;(AGC);;2;2;(ATA);;2;1;(CAC);;1;1;(ATA);;1;1;(ATC);;1;1;(ATA);;3;3;(CAC);;3;3;(CAA);;3;3;(CAA);;11;9;(AGT);;6;6;(ATT);;7;1;(AGG);;4;2;(CAC);;12;9;(AGT);;23;16;(AGT);;4;1;(AGG);;1;1;(ATT);;9;8;(AGT);;18;12;(AGT);;7;2;(CAC);;2;2;(ATA);;11;7;(AGT);;2;2;(CAT);;1;1;(ATC);;62;33;(AGT);;14;2;(AGG);;10;2;(AGT);;1;1;(ATC);;10;8;(AGT);;9;7;(AGT);;4;4;(CAA);;2;2;(ATC);;2;2;(ATA);;10;4;(CAC);;18;12;(CAA);;10;9;(ATC);;34;32;(AGT);;18;10;(AGC);;20;16;(AGC);;26;17;(AGT);;1;1;(ATA);;1;1;(ATC);;9;7;(AGT);;10;6;(AGT);;151;75;(AGT);;20;13;(AGT);;;;92;26;(AGC);;
4;2;(CAG);;10;2;(CAG);;6;6;(ATT);;3;1;(CAG);;20;19;(ATC);;16;7;(CAA);;13;2;(AGG);;7;5;(CAG);;1;1;(ATG);;6;2;(CAC);;5;5;(CAA);;9;6;(CAC);;13;5;(CAC);;1;1;(ATG);;24;17;(AGT);;17;16;(AGT);;6;6;(CAA);;6;6;(CAA);;8;1;(CAG);;8;7;(CAA);;9;1;(CAG);;11;3;(CAC);;1;1;(ATT);;6;4;(CAG);;8;2;(AGG);;18;11;(CAC);;3;2;(CAC);;7;5;(CAG);;2;2;(ATT);;1;1;(ATC);;13;2;(CAC);;2;2;(ATC);;13;6;(CAC);;16;7;(AGG);;1;1;(ATC);;2;1;(CAG);;1;1;(ATC);;4;3;(CAA);;1;1;(ATG);;4;3;(CAG);;5;1;(CAC);;5;2;(CAC);;1;1;(ATG);;6;6;(CAA);;10;2;(AGT);;6;6;(CAG);;3;3;(ATT);;1;1;(ATG);;5;5;(AGT);;3;3;(CAA);;5;5;(CAA);;3;3;(ATA);;11;3;(CAG);;1;1;(ATC);;4;4;(ATA);;1;1;(CGA);;1;1;(ATT);;2;2;(ATC);;7;5;(AGT);;1;1;(ATC);;2;1;(ATT);;5;5;(ATA);;2;1;(ATC);;7;4;(CAC);;2;2;(ATG);;1;1;(ATC);;9;4;(CAG);;5;3;(CAG);;2;2;(ATT);;6;6;(ATC);;6;3;(AGG);;11;4;(AGG);;4;4;(ATA);;1;1;(ATC);;1;1;(ATG);;1;1;(ATA);;4;4;(ATA);;1;1;(ATG);;1;1;(ATC);;;;315;138;(AGG);;
12;8;(CAT);;18;5;(CAT);;9;7;(CAA);;32;16;(CAT);;8;8;(CAA);;11;3;(CAC);;14;10;(AGT);;23;5;(CAT);;14;12;(CAA);;5;2;(CAG);;8;3;(CAC);;10;5;(CAG);;12;7;(CAG);;7;7;(CAA);;1;1;(ATA);;1;1;(ATA);;6;3;(CAC);;15;11;(CAC);;12;4;(CAT);;81;76;(CAC);;12;4;(CAT);;8;1;(CAG);;6;6;(CAA);;16;6;(CAT);;9;6;(AGT);;9;3;(CAG);;7;5;(CAG);;14;6;(CAT);;9;9;(CAA);;1;1;(ATG);;7;1;(CAG);;5;5;(CAA);;9;2;(CAG);;14;13;(AGT);;3;3;(ATT);;4;2;(CAT);;2;2;(ATT);;9;3;(CAC);;8;8;(CAA);;11;4;(CAT);;5;2;(CAG);;7;3;(CAG);;4;4;(CAA);;7;4;(CAC);;3;3;(ATA);;9;3;(CAT);;6;6;(CAA);;10;10;(CAA);;2;2;(ATA);;14;4;(CAC);;5;2;(CAC);;7;7;(CAA);;15;4;(CAT);;19;5;(CAA);;2;2;(ATC);;1;1;(CGC);;7;6;(CAA);;1;1;(ATG);;3;3;(CAA);;1;1;(ATT);;7;7;(CAA);;1;1;(ATC);;7;5;(CAC);;13;10;(CAG);;1;1;(ATT);;7;7;(CAA);;22;8;(CAT);;73;30;(CAT);;6;5;(CAA);;1;1;(ATT);;8;6;(AGT);;16;15;(AGT);;12;12;(CAA);;2;2;(ATG);;1;1;(ATT);;10;10;(ATC);;3;3;(ATC);;1;1;(ATT);;1;1;(ATG);;;;359;182;(AGT);;
7;4;(CCA);;6;1;(CCA);;9;2;(CAC);;16;5;(CCA);;32;24;(CAC);;8;1;(CAG);;11;11;(ATA);;13;1;(CCA);;15;8;(CAC);;19;3;(CAT);;7;3;(CAG);;16;9;(CAT);;30;5;(CAT);;11;7;(CAC);;6;6;(ATC);;1;1;(ATT);;6;2;(CAG);;4;2;(CAG);;8;2;(CCA);;10;4;(CAG);;9;2;(CCA);;15;4;(CAT);;15;6;(CAC);;7;5;(CCA);;1;1;(ATC);;286;65;(CAT);;6;4;(CAT);;6;3;(CCA);;11;6;(CAC);;2;2;(ATT);;36;14;(CAT);;6;3;(CAC);;20;9;(CAT);;1;1;(ATA);;4;4;(CAA);;1;1;(CCA);;9;8;(CAA);;11;6;(CAG);;7;4;(CAC);;5;3;(CCA);;14;6;(CAT);;14;6;(CAT);;12;8;(CAC);;5;3;(CAG);;1;1;(ATC);;4;3;(CCA);;13;9;(CAC);;10;5;(CAC);;2;2;(ATC);;16;6;(CAG);;9;4;(CAG);;9;2;(CAC);;6;4;(CCA);;11;4;(CAC);;2;2;(ATT);;1;1;(CGG);;12;6;(CAC);;42;24;(CAA);;11;5;(CAC);;6;3;(CAA);;18;11;(CAC);;2;2;(ATT);;5;3;(CAG);;15;8;(CAT);;9;5;(CAA);;8;6;(CAC);;8;5;(CCA);;18;13;(CCA);;12;5;(CAC);;10;10;(CAA);;3;3;(ATT);;1;1;(ATA);;16;9;(CAC);;10;10;(CAA);;4;4;(CAA);;7;7;(CAA);;1;1;(ATG);;22;16;(CAA);;20;8;(CAA);;;;5;4;(ATA);;
2;1;(CCC);;2;2;(CCT);;7;5;(CAG);;5;1;(CCC);;7;4;(CAG);;56;31;(CAT);;6;6;(ATC);;5;5;(CCC);;8;5;(CAG);;12;3;(CCA);;23;17;(CAT);;6;4;(CCA);;18;4;(CCA);;12;9;(CAG);;1;1;(ATG);;7;6;(CAA);;15;10;(CAT);;26;15;(CAT);;3;1;(CCT);;30;20;(CAT);;3;2;(CCT);;8;2;(CCA);;3;2;(CAG);;5;3;(CCC);;2;2;(ATG);;74;27;(CCA);;3;3;(CCA);;4;2;(CCC);;5;4;(CAG);;15;15;(CAA);;18;3;(CCA);;5;4;(CAG);;7;5;(CCA);;3;3;(ATG);;4;3;(CAC);;1;1;(CCC);;12;8;(CAC);;25;11;(CAT);;6;5;(CAG);;3;2;(CCC);;4;2;(CCA);;6;4;(CCA);;10;4;(CAG);;20;14;(CAT);;48;44;(ATT);;1;1;(CCC);;9;6;(CAG);;18;13;(CAG);;7;7;(CAA);;18;10;(CAT);;13;8;(CAT);;16;8;(CAG);;5;2;(CCC);;10;2;(CAG);;9;9;(CAA);;1;1;(CGT);;6;5;(CAG);;71;25;(CAC);;7;2;(CAG);;11;9;(CAC);;11;8;(CAG);;7;7;(CAA);;13;6;(CAT);;6;5;(CCA);;11;3;(CAC);;5;3;(CAG);;6;3;(CCC);;4;3;(CCC);;5;2;(CAG);;39;36;(CAC);;4;4;(CAA);;1;1;(ATC);;37;19;(CAG);;29;13;(CAC);;6;4;(CAC);;22;19;(CAC);;1;1;(ATT);;53;28;(CAC);;16;3;(CAC);;;;11;7;(ATC);;
1;1;(CCG);;8;1;(CGA);;24;13;(CAT);;4;3;(CCG);;21;13;(CAT);;18;6;(CCA);;4;4;(ATG);;2;1;(CCT);;29;5;(CAT);;3;1;(CCC);;6;6;(CCA);;7;5;(CCC);;2;2;(CCC);;20;13;(CAT);;2;2;(ATT);;6;6;(CAC);;8;7;(CCA);;8;4;(CCA);;4;1;(CGA);;15;12;(CCA);;3;1;(CGA);;1;1;(CCC);;25;13;(CAT);;3;2;(CCG);;5;5;(ATT);;4;3;(CCC);;4;3;(CCC);;2;2;(CCG);;17;7;(CAT);;28;19;(CAC);;9;3;(CCC);;14;8;(CAT);;5;3;(CCC);;4;4;(ATT);;8;8;(CAG);;1;1;(CCG);;6;4;(CAG);;9;6;(CCA);;14;7;(CAT);;2;2;(CCG);;3;2;(CCC);;2;2;(CCC);;19;11;(CAT);;11;9;(CCA);;14;9;(CAA);;1;1;(CCG);;17;10;(CAT);;32;18;(CAT);;9;7;(CAC);;10;7;(CCA);;6;6;(CCA);;27;7;(CAT);;4;3;(CCG);;60;29;(CAT);;12;6;(CAC);;1;1;(CTC);;15;6;(CAT);;75;38;(CAG);;26;8;(CAT);;5;2;(CAG);;22;13;(CAT);;14;10;(CAC);;8;7;(CCA);;2;1;(CCC);;11;4;(CAG);;15;7;(CAT);;3;3;(CCG);;1;1;(CCG);;23;11;(CAT);;4;2;(CAG);;1;1;(CAC);;1;1;(ATT);;20;12;(CAT);;21;7;(CAG);;7;4;(CAG);;6;5;(CAG);;14;10;(CAA);;32;15;(CAG);;13;3;(CAG);;;;24;15;(ATT);;
3;3;(CCT);;6;2;(CGC);;10;7;(CCA);;8;4;(CCT);;256;243;(CCA);;9;1;(CCC);;14;14;(CAA);;8;4;(CGA);;22;3;(CCA);;1;1;(CCG);;9;7;(CCC);;3;3;(CCG);;1;1;(CCG);;11;10;(CCA);;31;30;(CAA);;6;4;(CAG);;6;5;(CCC);;9;6;(CCC);;3;1;(CGC);;326;322;(CCC);;5;2;(CGC);;4;2;(CCT);;7;4;(CCA);;7;6;(CCT);;8;8;(CAA);;2;2;(CCG);;2;2;(CCT);;3;3;(CCT);;9;7;(CCA);;47;34;(CAG);;5;4;(CCG);;6;5;(CCA);;4;2;(CCG);;17;14;(CAA);;11;8;(CAT);;1;1;(CCT);;19;14;(CAT);;8;2;(CCC);;8;7;(CCA);;3;2;(CCT);;2;2;(CCG);;2;2;(CCG);;8;6;(CCA);;4;3;(CCC);;7;5;(CAC);;4;3;(CCT);;10;10;(CCA);;14;9;(CCA);;2;2;(CAG);;16;11;(CCC);;3;1;(CCC);;12;5;(CCA);;6;5;(CCT);;18;7;(CCA);;12;6;(CAG);;1;1;(CTG);;8;5;(CCA);;278;91;(CAT);;14;2;(CCA);;24;9;(CAT);;10;9;(CCA);;9;7;(CAG);;5;4;(CCC);;3;2;(CCG);;39;30;(CAT);;8;7;(CCA);;4;3;(CCT);;19;12;(CCT);;7;4;(CCA);;14;7;(CAT);;7;4;(CAG);;10;10;(CAA);;12;7;(CCA);;36;12;(CAT);;12;5;(CAT);;17;11;(CAT);;11;5;(CAC);;138;39;(CAT);;79;48;(CAT);;;;241;118;(CAA);;
2;2;(CGA);;13;6;(CGG);;7;5;(CCC);;7;4;(CGA);;2148;2045;(CCC);;6;4;(CCG);;39;27;(CAC);;7;5;(CGC);;25;14;(CCC);;4;3;(CCT);;4;3;(CCG);;6;5;(CCT);;3;1;(CCT);;5;4;(CCC);;1540;1503;(CAC);;16;11;(CAT);;3;3;(CCG);;4;2;(CCG);;5;3;(CGG);;5;5;(CCG);;5;3;(CGG);;5;1;(CGA);;8;5;(CCC);;3;3;(CGA);;9;3;(CAC);;26;5;(CCT);;1;1;(CGA);;2;1;(CGA);;9;5;(CCC);;154;112;(CAT);;13;3;(CCT);;3;2;(CCC);;5;5;(CCT);;35;26;(CAC);;15;13;(CCA);;1;1;(CGA);;9;6;(CCA);;4;3;(CCG);;5;3;(CCC);;1;1;(CGA);;5;5;(CCT);;3;3;(CCT);;7;5;(CCC);;5;3;(CCG);;4;2;(CAG);;2;2;(CGA);;10;9;(CCC);;9;5;(CCC);;18;14;(CAT);;4;3;(CCG);;3;3;(CCG);;9;7;(CCC);;4;3;(CGA);;9;5;(CCC);;19;11;(CAT);;1;1;(GAA);;8;5;(CCC);;9;8;(CCA);;7;1;(CCC);;9;1;(CCA);;13;11;(CCC);;23;14;(CAT);;3;3;(CCG);;6;4;(CCT);;13;3;(CCA);;4;4;(CCC);;3;3;(CGA);;6;5;(CGA);;6;4;(CCC);;7;4;(CCA);;5;3;(CAT);;16;13;(CAC);;6;5;(CCC);;17;10;(CCA);;6;4;(CCA);;217;208;(CCA);;7;3;(CAG);;33;12;(CCA);;27;7;(CCA);;;;227;96;(CAC);;
3;3;(CGC);;6;3;(CGT);;7;5;(CCG);;7;3;(CGC);;21;20;(CCG);;10;6;(CCT);;6;3;(CAG);;4;2;(CGG);;24;11;(CCG);;6;3;(CGA);;29;28;(CCT);;3;3;(CGA);;15;5;(CGA);;4;3;(CCG);;25;20;(CAG);;10;9;(CCA);;5;4;(CCT);;7;7;(CCT);;3;1;(CGT);;47;46;(CCT);;4;2;(CGT);;5;3;(CGC);;4;2;(CCG);;4;4;(CGC);;5;3;(CAG);;29;6;(CGA);;2;2;(CGC);;4;4;(CGC);;5;3;(CCG);;29;19;(CCA);;6;2;(CGA);;4;4;(CCG);;4;4;(CGA);;10;6;(CAG);;2;1;(CCC);;2;1;(CGC);;8;5;(CCC);;5;4;(CCT);;3;3;(CCG);;3;3;(CGC);;2;2;(CGA);;3;3;(CGA);;3;3;(CCG);;21;21;(CCT);;41;23;(CAT);;2;2;(CGC);;3;2;(CCG);;14;11;(CCG);;47;45;(CCA);;6;5;(CCT);;5;5;(CCT);;6;6;(CCG);;4;3;(CGC);;8;5;(CCG);;10;6;(CCA);;1;1;(GCT);;4;2;(CCG);;6;2;(CCC);;6;5;(CCG);;11;8;(CCC);;7;3;(CCG);;8;5;(CCA);;8;6;(CCT);;4;4;(CGA);;6;2;(CCC);;3;2;(CCG);;4;2;(CGC);;7;3;(CGC);;3;1;(CCG);;20;19;(CCC);;3;3;(CCA);;5;4;(CAG);;2;2;(CCG);;4;3;(CCC);;7;6;(CCC);;1766;1696;(CCC);;26;20;(CAT);;105;35;(CCC);;11;2;(CCC);;;;300;139;(CAG);;
2;1;(CGG);;15;3;(CTC);;45;44;(CCT);;5;3;(CGG);;67;67;(CCT);;5;1;(CGA);;35;19;(CAT);;9;4;(CGT);;11;7;(CCT);;4;4;(CGC);;8;7;(CGA);;6;5;(CGC);;8;1;(CGC);;5;4;(CCT);;94;74;(CAT);;2;1;(CCC);;4;3;(CGA);;4;4;(CGA);;15;5;(CTC);;6;6;(CGA);;10;4;(CTC);;5;2;(CGG);;7;6;(CCT);;3;1;(CGG);;24;15;(CAT);;56;15;(CGC);;1;1;(CGG);;3;2;(CGG);;6;5;(CCT);;18;14;(CCC);;8;3;(CGC);;5;4;(CCT);;4;4;(CGC);;50;34;(CAT);;1;1;(CCG);;2;1;(CGG);;4;2;(CCG);;3;3;(CGA);;4;4;(CCT);;1;1;(CGG);;3;3;(CGC);;3;3;(CGC);;5;4;(CCT);;4;4;(CGA);;14;7;(CCA);;2;2;(CGG);;5;4;(CCT);;9;7;(CCT);;341;339;(CCC);;5;4;(CGA);;3;3;(CGA);;18;6;(CCT);;4;1;(CGG);;11;5;(CCT);;9;6;(CCC);;1;1;(GTA);;5;4;(CCT);;10;6;(CCG);;11;4;(CCT);;5;3;(CCG);;9;7;(CCT);;16;14;(CCC);;3;3;(CGA);;3;2;(CGC);;7;3;(CCG);;5;4;(CCT);;3;1;(CGG);;9;5;(CGG);;4;4;(CCT);;3;3;(CCG);;4;4;(CCC);;21;14;(CAT);;11;5;(CCT);;4;4;(CCG);;3;2;(CCG);;12;12;(CCG);;10;1;(CCA);;8;6;(CCG);;6;3;(CCG);;;;522;174;(CAT);;
1;1;(CGT);;11;6;(CTG);;4;4;(CGA);;6;4;(CGT);;4;4;(CGA);;11;2;(CGC);;178;173;(CCA);;30;9;(CTC);;9;6;(CGA);;4;1;(CGG);;4;4;(CGC);;3;1;(CGG);;8;1;(CGG);;4;4;(CGA);;30;20;(CCA);;3;3;(CCG);;5;5;(CGC);;6;5;(CGC);;8;4;(CTG);;17;16;(CGC);;8;4;(CTG);;5;1;(CGT);;4;4;(CGA);;4;4;(CGT);;23;22;(CCA);;18;5;(CGG);;1;1;(CGT);;2;2;(CGT);;5;5;(CGA);;10;7;(CCG);;5;2;(CGG);;3;3;(CGA);;4;2;(CGG);;23;17;(CCA);;8;8;(CCT);;2;1;(CGT);;7;6;(CCT);;6;4;(CGC);;2;2;(CGA);;6;3;(CTC);;3;1;(CGG);;3;1;(CGG);;3;3;(CGA);;5;4;(CGC);;3;2;(CCC);;1;1;(CTC);;5;5;(CGA);;8;7;(CGA);;6;6;(CCG);;4;4;(CGC);;3;2;(CGC);;6;5;(CGA);;7;7;(CGT);;9;6;(CGA);;4;2;(CCG);;1;1;(GTC);;3;3;(CGA);;50;25;(CCT);;5;4;(CGA);;10;5;(CCT);;6;5;(CGA);;5;3;(CCG);;4;4;(CGC);;2;1;(CGG);;10;3;(CCT);;3;3;(CGA);;2;2;(CGT);;9;5;(CGT);;4;4;(CGA);;6;5;(CCT);;2;2;(CCT);;13;11;(CCA);;3;2;(CGA);;10;5;(CCT);;4;4;(CCT);;54;53;(CCT);;6;3;(CCC);;27;9;(CCT);;11;6;(CCT);;;;44;22;(CCA);;
5;4;(CTC);;17;2;(CTT);;5;4;(CGC);;13;4;(CTC);;20;19;(CGC);;8;3;(CGG);;1295;1266;(CCC);;10;4;(CTG);;6;4;(CGC);;7;5;(CGT);;4;2;(CGG);;4;4;(CGT);;11;3;(CGT);;4;3;(CGC);;81;74;(CCC);;10;10;(CCT);;3;1;(CGG);;4;2;(CGG);;13;1;(CTT);;4;3;(CGG);;11;1;(CTT);;14;3;(CTC);;8;7;(CGC);;9;4;(CTC);;6;5;(CCC);;23;9;(CGT);;6;2;(CTC);;7;2;(CTC);;5;5;(CGC);;28;21;(CCT);;4;2;(CGT);;6;5;(CGC);;5;5;(CGT);;72;70;(CCC);;3;3;(CGA);;2;1;(CTC);;4;4;(CGA);;3;1;(CGG);;5;3;(CGC);;1;1;(CTG);;3;3;(CGT);;2;2;(CGT);;10;7;(CGC);;2;1;(CGG);;3;2;(CCG);;5;5;(CTG);;5;4;(CGC);;11;8;(CGC);;33;32;(CCT);;4;1;(CGG);;3;1;(CGG);;12;8;(CGC);;11;4;(CTC);;13;5;(CGC);;5;4;(CCT);;1;1;(GTT);;5;4;(CGC);;35;17;(CGA);;5;3;(CGC);;7;2;(CGA);;4;3;(CGC);;5;4;(CCT);;3;1;(CGG);;5;5;(CGT);;10;6;(CGA);;5;4;(CGC);;10;2;(CTC);;29;10;(CTC);;7;6;(CGC);;6;6;(CGA);;1;1;(CGA);;90;88;(CCC);;4;4;(CGC);;5;5;(CGA);;3;3;(CGA);;4;4;(CGA);;6;6;(CCG);;23;10;(CGA);;6;3;(CGA);;;;268;181;(CCC);;
5;3;(CTG);;9;1;(GAA);;5;2;(CGG);;9;5;(CTG);;4;2;(CGG);;6;4;(CGT);;16;13;(CCG);;40;4;(CTT);;9;5;(CGG);;24;5;(CTC);;5;5;(CGT);;20;14;(CTC);;40;9;(CTC);;4;1;(CGG);;2;2;(CCG);;10;9;(CGA);;3;3;(CGT);;5;5;(CGT);;8;1;(GAA);;7;7;(CGT);;8;3;(GAA);;8;5;(CTG);;3;2;(CGG);;8;6;(CTG);;24;24;(CCG);;53;25;(CTC);;3;2;(CTG);;5;3;(CTG);;4;1;(CGG);;14;13;(CGA);;24;7;(CTC);;3;2;(CGG);;8;2;(CTC);;3;3;(CCG);;3;2;(CGC);;3;1;(CTG);;5;4;(CGC);;3;3;(CGT);;2;1;(CGG);;3;2;(CTT);;6;1;(CTC);;8;4;(CTC);;3;1;(CGG);;5;5;(CGT);;6;4;(CCT);;13;10;(CTT);;4;1;(CGG);;7;3;(CGG);;3;3;(CGA);;5;5;(CGT);;3;3;(CGT);;4;2;(CGG);;12;6;(CTG);;9;6;(CGG);;3;3;(CGA);;1;1;(TAA);;4;1;(CGG);;24;6;(CGC);;4;2;(CGG);;8;2;(CGC);;5;2;(CGG);;4;4;(CGA);;4;4;(CGT);;1;1;(CTA);;11;2;(CGC);;4;1;(CGG);;10;3;(CTG);;21;11;(CTG);;3;1;(CGG);;18;17;(CGC);;3;3;(CGC);;7;6;(CCG);;5;4;(CGG);;6;6;(CGC);;3;2;(CGC);;21;20;(CGC);;8;4;(CCT);;36;21;(CGC);;22;11;(CGC);;;;59;35;(CCG);;
6;3;(CTT);;5;1;(GCA);;10;10;(CGT);;19;5;(CTT);;4;4;(CGT);;19;3;(CTC);;116;114;(CCT);;22;6;(GAA);;10;4;(CGT);;7;3;(CTG);;3;3;(CTA);;11;6;(CTG);;16;5;(CTG);;4;4;(CGT);;12;7;(CCT);;4;4;(CGC);;1;1;(CTA);;1;1;(CTA);;7;4;(GCA);;45;38;(CTC);;7;3;(GCA);;16;4;(CTT);;3;3;(CGT);;149;121;(CTT);;53;52;(CCT);;81;20;(CTG);;7;6;(CTT);;6;2;(CTT);;6;5;(CGT);;26;20;(CGC);;13;5;(CTG);;4;4;(CGT);;13;7;(CTG);;16;14;(CCT);;4;4;(CGG);;4;2;(CTT);;3;1;(CGG);;13;3;(CTC);;3;3;(CGT);;6;4;(GAA);;7;5;(CTG);;12;5;(CTG);;4;4;(CGT);;5;5;(CTA);;2;1;(CGA);;6;4;(GAA);;5;5;(CGT);;10;8;(CGT);;7;6;(CGC);;19;5;(CTC);;8;2;(CTC);;8;7;(CGT);;11;7;(CTT);;5;2;(CGT);;5;4;(CGC);;1;1;(TAC);;6;6;(CGT);;21;9;(CGG);;4;2;(CGT);;5;5;(CGG);;7;7;(CGT);;5;5;(CGC);;8;3;(CTC);;14;5;(CTC);;8;4;(CGG);;5;5;(CGT);;32;23;(CTT);;42;12;(CTT);;4;4;(CGT);;3;1;(CGG);;2;1;(CGG);;13;13;(CCT);;13;10;(CGT);;6;4;(CGG);;4;3;(CGG);;4;2;(CGG);;3;1;(CGA);;36;17;(CGG);;9;4;(CGG);;;;104;29;(CCT);;
5;1;(GAA);;15;1;(GCC);;10;10;(CTA);;21;5;(GAA);;9;9;(CTA);;11;3;(CTG);;7;7;(CGA);;16;2;(GCA);;37;3;(CTC);;30;6;(CTT);;22;16;(CTC);;86;75;(CTT);;37;7;(CTT);;3;3;(CTA);;48;48;(CGA);;2;2;(CGG);;5;1;(CTC);;77;73;(CTC);;14;2;(GCC);;10;7;(CTG);;15;2;(GCC);;9;1;(GAA);;51;48;(CTC);;8;3;(GAA);;5;5;(CGA);;97;23;(CTT);;6;2;(GAA);;10;5;(GAA);;3;3;(CTA);;22;12;(CGG);;22;2;(CTT);;4;1;(CTC);;15;10;(CTT);;4;3;(CGA);;2;2;(CGT);;2;1;(GAA);;4;4;(CGT);;11;3;(CTG);;7;2;(CTC);;1;1;(GAC);;11;7;(CTT);;6;2;(CTT);;14;6;(CTC);;19;15;(CTC);;3;3;(CGC);;1;1;(GAC);;5;5;(CTA);;27;14;(CTC);;1;1;(CGG);;15;7;(CTG);;9;4;(CTG);;15;2;(CTC);;10;6;(GAA);;25;11;(CTC);;4;1;(CGG);;1;1;(TAG);;4;1;(CTC);;23;12;(CGT);;21;8;(CTC);;6;3;(CGT);;2;2;(CTA);;5;2;(CGG);;10;6;(CTG);;7;3;(CTG);;6;3;(CGT);;10;7;(CTC);;13;7;(GAA);;2;2;(GAT);;13;8;(CTC);;7;7;(CGT);;2;2;(CGT);;4;3;(CGA);;13;5;(CTC);;8;7;(CGT);;4;4;(CGT);;3;3;(CGT);;5;2;(CGC);;29;14;(CGT);;6;2;(CGT);;;;80;44;(CGA);;
12;4;(GCA);;6;2;(GCT);;37;34;(CTC);;2;1;(GAC);;468;447;(CTC);;18;2;(CTT);;16;14;(CGC);;21;5;(GCC);;11;5;(CTG);;15;5;(GAA);;20;16;(CTG);;8;4;(GAA);;24;5;(GAA);;15;9;(CTC);;3858;3758;(CGC);;5;5;(CGT);;8;5;(CTG);;12;8;(CTG);;6;2;(GCT);;43;30;(CTT);;3;2;(GCT);;8;3;(GCA);;12;6;(CTG);;34;20;(GCA);;7;6;(CGC);;35;12;(GAA);;1;1;(GAC);;1;1;(GAC);;9;7;(CTC);;30;23;(CGT);;22;5;(GAA);;6;3;(CTG);;10;5;(GAA);;15;15;(CGC);;3;2;(CTA);;1;1;(GCA);;2;2;(CTA);;19;9;(CTT);;7;6;(CTG);;5;3;(GCA);;5;2;(GAA);;8;2;(GAA);;12;7;(CTG);;17;14;(CTG);;1;1;(CGG);;5;5;(GCA);;17;10;(CTC);;19;14;(CTG);;3;3;(CGT);;29;20;(CTT);;9;5;(CTT);;11;4;(CTG);;10;4;(GCA);;10;7;(CTG);;7;7;(CGT);;1;1;(TAT);;11;7;(CTG);;1;1;(CTA);;11;7;(CTG);;2;2;(CTA);;11;6;(CTC);;6;6;(CGT);;19;9;(CTT);;13;7;(CTT);;2;2;(CTA);;11;8;(CTG);;8;6;(GCA);;31;11;(GCA);;12;8;(CTG);;7;4;(CTC);;3;2;(CTC);;6;5;(CGC);;18;5;(CTG);;21;7;(CTC);;10;7;(CTC);;8;8;(CTA);;4;3;(CGG);;1;1;(CTA);;4;4;(CTA);;;;112;26;(CGC);;
7;2;(GCC);;22;21;(GTA);;25;21;(CTG);;1;1;(GAG);;20;16;(CTG);;18;5;(GAA);;4;1;(CGG);;9;3;(GCT);;49;4;(CTT);;13;2;(GCA);;408;398;(CTT);;41;17;(GCA);;15;3;(GCA);;13;8;(CTG);;41;41;(CGG);;2;2;(CTA);;26;19;(CTT);;22;16;(CTT);;9;9;(GTA);;12;7;(GAA);;10;10;(GTA);;16;2;(GCC);;16;8;(CTT);;14;4;(GCC);;7;5;(CGG);;1;1;(GAC);;1;1;(GAT);;11;5;(GCA);;21;16;(CTG);;4;4;(CTA);;1;1;(GAC);;15;11;(CTT);;3;1;(GAT);;3;1;(CGG);;8;6;(CTC);;4;1;(GCC);;6;4;(CTC);;12;4;(GAA);;11;3;(CTT);;5;1;(GCC);;27;10;(GCA);;20;9;(GCA);;26;19;(CTT);;271;266;(CTT);;1;1;(CGT);;10;6;(GCC);;17;14;(CTG);;25;15;(CTT);;3;3;(CTA);;14;8;(GAA);;6;2;(GAA);;43;21;(CTT);;17;6;(GCC);;20;5;(CTT);;10;3;(CTC);;1;1;(TCC);;12;6;(CTT);;11;3;(CTC);;17;2;(CTT);;15;8;(CTC);;24;20;(CTG);;4;4;(CTA);;8;4;(GAA);;10;5;(GAA);;26;9;(CTC);;10;7;(CTT);;19;3;(GCC);;42;16;(GCC);;16;9;(CTT);;6;2;(CTG);;6;2;(CTG);;3;1;(CGG);;21;11;(CTT);;14;6;(CTG);;6;3;(CTG);;395;387;(CTC);;3;2;(CGT);;51;19;(CTC);;30;14;(CTC);;;;180;91;(CGG);;
5;3;(GCT);;20;2;(GTC);;772;760;(CTT);;2;1;(GAT);;29;24;(CTT);;4;2;(GAC);;7;7;(CGT);;19;6;(GTA);;24;6;(GAA);;14;4;(GCC);;10;6;(GAA);;14;5;(GCC);;34;10;(GCC);;16;12;(CTT);;137;133;(CGT);;5;3;(CTC);;8;3;(GAA);;13;6;(GAA);;14;3;(GTC);;1;1;(GAC);;6;1;(GTC);;8;4;(GCT);;12;4;(GAA);;7;3;(GCT);;9;9;(CGT);;107;35;(GCA);;10;5;(GCA);;7;2;(GCC);;19;14;(CTT);;50;30;(CTC);;14;1;(GCA);;6;2;(GAA);;29;23;(GCA);;10;10;(CGT);;9;7;(CTG);;2;2;(GCT);;14;10;(CTG);;46;15;(GCA);;10;7;(GAA);;6;5;(GCT);;8;2;(GCC);;11;3;(GCC);;7;3;(GAA);;11;5;(GAA);;11;3;(CTC);;8;8;(GCT);;20;14;(CTT);;24;18;(GAA);;60;57;(CTC);;1;1;(GAT);;9;9;(GAT);;23;14;(GAA);;7;3;(GCT);;20;7;(GAA);;14;10;(CTG);;1;1;(TCG);;12;3;(GAA);;108;48;(CTG);;18;3;(GAA);;10;2;(CTG);;27;19;(CTT);;13;7;(CTC);;40;14;(GCA);;1;1;(GAG);;13;8;(CTG);;10;5;(GAA);;8;2;(GCT);;17;3;(GCT);;21;10;(GAA);;12;5;(CTT);;6;5;(CTT);;4;4;(CGT);;19;10;(GAA);;20;7;(CTT);;7;7;(CTT);;15;8;(CTG);;26;14;(CTC);;40;10;(CTG);;13;7;(CTG);;;;66;42;(CGT);;
1;1;(GGG);;21;5;(GTG);;11;3;(GAA);;18;14;(GCA);;13;9;(GAA);;2;2;(GAT);;13;13;(CTA);;34;7;(GTC);;1;1;(GAT);;9;3;(GCT);;21;12;(GCA);;9;6;(GCT);;15;3;(GCT);;8;4;(GAA);;4;4;(CTA);;11;10;(CTG);;1;1;(GAC);;1;1;(GAC);;5;1;(GTG);;1;1;(GAT);;6;2;(GTG);;9;9;(GTA);;3;3;(GAC);;13;13;(GTA);;12;12;(CTA);;12;2;(GCC);;8;1;(GCC);;7;4;(GCT);;13;8;(GAA);;45;23;(CTG);;29;3;(GCC);;1;1;(GAC);;14;5;(GCC);;24;18;(CTC);;13;9;(CTT);;3;2;(GTA);;16;9;(CTT);;24;5;(GCC);;29;10;(GCA);;6;4;(GTA);;5;3;(GCT);;7;5;(GCT);;1;1;(GAC);;25;10;(GCA);;5;3;(CTG);;1;1;(GGA);;17;13;(GAA);;1;1;(GAC);;9;6;(CTG);;25;16;(GCA);;21;11;(GCA);;42;34;(GCA);;10;10;(GTA);;17;4;(GAC);;17;11;(CTT);;1;1;(TCT);;1;1;(GAC);;23;10;(CTT);;1;1;(GAG);;16;5;(CTT);;18;13;(GAA);;21;14;(CTG);;11;4;(GCC);;25;12;(GCA);;22;7;(CTT);;1;1;(GAC);;11;10;(GTA);;24;17;(GTA);;1;1;(GAC);;10;4;(GAA);;10;4;(GAA);;19;19;(CTC);;15;8;(GCA);;23;13;(GAA);;6;5;(GAA);;19;16;(CTT);;11;8;(CTG);;97;23;(CTT);;127;91;(CTT);;;;9;6;(CTA);;
6;6;(GTA);;12;2;(GTT);;25;12;(GCA);;25;9;(GCC);;1;1;(GAC);;15;9;(GCA);;164;161;(CTC);;21;3;(GTG);;21;5;(GCA);;19;12;(GTA);;11;3;(GCC);;1;1;(GGC);;24;2;(GTA);;3;3;(GAC);;428;406;(CTC);;9;7;(CTT);;34;16;(GCA);;24;20;(GCA);;10;1;(GTT);;22;13;(GCA);;6;1;(GTT);;17;3;(GTC);;25;15;(GCA);;13;4;(GTC);;44;41;(CTC);;30;16;(GCT);;6;3;(GCT);;16;13;(GTA);;1;1;(GAC);;43;23;(CTT);;28;12;(GCT);;23;18;(GCA);;8;6;(GCT);;28;23;(CTG);;7;6;(GAA);;3;1;(GTC);;10;5;(GAA);;9;2;(GCT);;16;9;(GCC);;3;1;(GTC);;5;5;(GTA);;8;8;(GTA);;1;1;(GAT);;9;2;(GCC);;16;3;(CTT);;7;5;(GTA);;1;1;(GAC);;37;19;(GCA);;16;11;(CTT);;21;3;(GCC);;12;5;(GCC);;13;5;(GCC);;14;3;(GTC);;17;9;(GCA);;14;5;(GAA);;1;1;(TGA);;2;2;(GAT);;57;23;(GAA);;1;1;(GAT);;14;3;(GAA);;1;1;(GAC);;26;18;(CTT);;12;7;(GCT);;22;11;(GCC);;21;5;(GAA);;1;1;(GAT);;19;7;(GTC);;82;20;(GTC);;23;13;(GCA);;3;3;(GAC);;2;2;(GAC);;10;6;(CTG);;14;9;(GCC);;15;10;(GCA);;25;19;(GCA);;12;8;(GAA);;16;11;(CTT);;58;18;(GAA);;25;8;(GAA);;;;245;87;(CTC);;
8;2;(GTC);;6;5;(TAA);;10;2;(GCC);;16;9;(GCT);;1;1;(GAT);;28;9;(GCC);;40;32;(CTG);;23;3;(GTT);;39;14;(GCC);;27;7;(GTC);;8;6;(GCT);;1;1;(GGT);;41;9;(GTC);;3;3;(GAT);;18;10;(CTG);;22;20;(GAA);;11;5;(GCC);;10;2;(GCC);;4;4;(TAA);;19;9;(GCC);;3;3;(TAA);;5;1;(GTG);;10;1;(GCC);;5;1;(GTG);;47;45;(CTG);;17;13;(GTA);;12;8;(GTA);;10;3;(GTC);;3;3;(GAT);;36;24;(GAA);;1;1;(GGT);;10;4;(GCC);;13;13;(GTA);;36;22;(CTT);;17;14;(GCA);;2;1;(GTG);;3;3;(GAC);;15;13;(GTA);;10;4;(GCT);;3;3;(GTG);;8;3;(GTC);;5;2;(GTC);;60;28;(GCA);;12;8;(GCT);;26;6;(GAA);;9;5;(GTC);;3;3;(GAT);;40;23;(GCC);;6;4;(GAA);;10;3;(GCT);;7;5;(GCT);;10;5;(GCT);;5;1;(GTG);;28;9;(GCC);;2;2;(GAC);;1;1;(TGC);;28;15;(GCA);;1;1;(GAC);;14;6;(GCA);;1;1;(GAG);;1;1;(GAG);;16;11;(GAA);;2;2;(GGC);;8;4;(GCT);;3;3;(GAC);;21;11;(GCA);;9;1;(GTG);;26;9;(GTG);;19;10;(GCC);;6;6;(GAT);;5;5;(GAT);;16;9;(CTT);;1;1;(GCG);;18;3;(GCC);;14;5;(GCC);;3;3;(GAC);;23;12;(GAA);;2;1;(GAG);;12;1;(GAC);;;;266;123;(CTG);;
5;2;(GTG);;3;1;(TAC);;1;1;(GCG);;3;2;(GGA);;24;19;(GCA);;1;1;(GCG);;40;25;(CTT);;6;4;(TAA);;14;5;(GCT);;19;6;(GTG);;9;9;(GTA);;11;11;(GTA);;17;5;(GTG);;32;23;(GCA);;36;25;(CTT);;1;1;(GAG);;10;7;(GCT);;13;6;(GCT);;2;1;(TAC);;10;7;(GCT);;2;1;(TAC);;11;1;(GTT);;12;7;(GCT);;7;2;(GTT);;887;879;(CTT);;184;49;(GTC);;5;4;(GTC);;6;4;(GTG);;35;30;(GCA);;27;19;(GCA);;21;20;(GTA);;7;5;(GCT);;13;3;(GTC);;32;19;(GAA);;7;5;(GCC);;3;1;(GTT);;6;6;(GAT);;24;12;(GTC);;8;8;(GTA);;4;2;(GTT);;7;3;(GTG);;6;3;(GTG);;15;6;(GCC);;9;9;(GTA);;3;3;(GAC);;4;4;(GTG);;23;14;(GCA);;18;12;(GCT);;61;56;(GCA);;1;1;(GGT);;8;7;(GTA);;1;1;(GGT);;14;5;(GTT);;20;6;(GCT);;2;2;(GAT);;1;1;(TGG);;13;7;(GCC);;68;30;(GCA);;26;5;(GCC);;7;5;(GCA);;6;3;(GAT);;1;1;(GAC);;2;2;(GTA);;9;9;(GTA);;13;7;(GCA);;12;5;(GCC);;13;1;(GTT);;39;9;(GTT);;10;4;(GCT);;48;19;(GCA);;9;4;(GCA);;11;8;(GAA);;11;6;(GCT);;1;1;(GCG);;9;7;(GCT);;22;20;(GCA);;1;1;(GAC);;5;5;(GAT);;25;15;(GCA);;;;953;463;(CTT);;
10;4;(GTT);;3;2;(TAG);;13;10;(GCT);;1;1;(GGT);;64;51;(GCC);;18;6;(GCT);;30;18;(GAA);;6;4;(TAC);;2;1;(GGG);;20;3;(GTT);;13;4;(GTC);;15;5;(GTC);;23;3;(GTT);;15;6;(GCC);;35;25;(GAA);;1;1;(GAT);;4;4;(GGC);;11;11;(GTA);;2;1;(TAG);;2;2;(GGC);;2;1;(TAG);;5;4;(TAA);;14;10;(GTA);;3;3;(TAA);;12;8;(GAA);;52;19;(GTG);;4;4;(GTG);;11;6;(GTT);;13;8;(GCC);;30;13;(GCC);;33;8;(GTC);;6;6;(GGC);;9;1;(GTG);;1;1;(GAC);;8;7;(GCT);;1;1;(TAA);;28;20;(GCA);;9;1;(GTG);;13;12;(GTC);;1;1;(TAA);;9;2;(GTT);;9;5;(GTT);;8;6;(GCT);;8;4;(GTC);;10;3;(GCA);;9;5;(GTT);;13;8;(GCC);;4;4;(GGA);;30;27;(GCC);;12;12;(GTA);;13;4;(GTC);;18;18;(GTA);;3;3;(TAA);;4;1;(GGA);;30;18;(GCA);;1;1;(TGT);;9;5;(GCT);;54;25;(GCC);;16;6;(GCT);;16;3;(GCC);;34;25;(GCA);;1;1;(GAG);;15;3;(GTC);;19;10;(GTC);;24;6;(GCC);;7;4;(GCT);;6;6;(TAA);;14;9;(TAA);;17;14;(GTA);;13;6;(GCC);;12;5;(GCC);;1;1;(GAT);;23;18;(GGA);;19;13;(GCT);;1;1;(GGG);;43;37;(GCC);;2;2;(GAT);;92;46;(GCA);;33;3;(GCC);;;;197;87;(GAA);;
2;2;(TAA);;2;2;(TAT);;11;10;(GTA);;83;33;(GTA);;13;10;(GCT);;4;3;(GGA);;338;313;(GCA);;5;2;(TAG);;1;1;(GGT);;4;3;(TAA);;9;2;(GTG);;14;3;(GTG);;5;5;(TAA);;3;1;(GCG);;16;16;(GAC);;18;14;(GCA);;15;11;(GTA);;13;7;(GTC);;2;2;(TAT);;14;11;(GTA);;1;1;(TCA);;2;1;(TAC);;10;5;(GTC);;6;6;(TAC);;32;19;(GCA);;123;41;(GTT);;6;5;(GTT);;3;3;(TAA);;8;4;(GCT);;2;2;(GCG);;18;3;(GTG);;2;2;(GGT);;25;17;(GTT);;28;23;(GCA);;8;8;(GTA);;1;1;(TAC);;15;9;(GCC);;13;4;(GTT);;7;1;(GTG);;2;2;(TAC);;2;2;(TAA);;3;3;(TAA);;1;1;(GGA);;7;2;(GTG);;23;4;(GCC);;4;3;(TAA);;9;6;(GCT);;4;4;(GGG);;2;2;(GCG);;23;6;(GTC);;8;1;(GTG);;10;4;(GTC);;4;4;(TAC);;1;1;(GGC);;20;10;(GCC);;1;1;(TTC);;1;1;(GGC);;1;1;(GCG);;1;1;(GGA);;1;1;(GCG);;14;6;(GCC);;3;3;(GAT);;10;1;(GTG);;7;1;(GTG);;13;6;(GCT);;1;1;(GGA);;4;3;(TAC);;11;6;(TAC);;97;83;(GTC);;7;5;(GCT);;5;3;(GCT);;22;20;(GCA);;1;1;(GGG);;15;14;(GTA);;10;10;(GTA);;1;1;(GCG);;11;6;(GCA);;85;15;(GCC);;14;4;(GCT);;;;6;4;(GAC);;
2;2;(TAC);;8;1;(TCC);;11;6;(GTC);;29;8;(GTC);;1;1;(GGA);;3;1;(GGT);;63;55;(GCC);;24;16;(TAT);;28;8;(GTA);;5;4;(TAC);;21;13;(GTT);;17;9;(GTT);;7;5;(TAC);;8;5;(GCT);;2;2;(GAG);;11;6;(GCC);;10;4;(GTC);;10;2;(GTG);;1;1;(TCA);;21;9;(GTC);;5;2;(TCC);;2;1;(TAG);;11;3;(GTG);;3;3;(TAG);;10;3;(GCC);;12;8;(TAA);;11;11;(TAA);;3;3;(TAC);;2;2;(GGA);;41;27;(GCT);;22;10;(GTT);;7;7;(GTA);;4;4;(TAA);;33;26;(GCC);;19;16;(GTC);;1;1;(TAG);;8;4;(GCT);;2;2;(TAA);;14;4;(GTT);;1;1;(TAG);;3;3;(TAC);;2;2;(TAC);;4;4;(GGC);;12;8;(GTT);;15;9;(GCT);;1;1;(TAC);;4;3;(GGA);;1;1;(GGT);;7;6;(GCT);;9;1;(GTG);;12;4;(GTT);;23;14;(GTG);;5;5;(TAG);;8;3;(GGT);;11;7;(GCT);;1;1;(TTG);;15;13;(GTA);;65;31;(GCT);;18;16;(GTA);;9;3;(GCT);;8;4;(GCT);;33;24;(GCA);;15;7;(GTT);;12;4;(GTT);;3;3;(GGA);;15;15;(GTA);;4;4;(TAG);;8;6;(TAG);;10;3;(GTG);;1;1;(GGA);;5;5;(GGT);;23;18;(GCC);;13;11;(GTA);;24;6;(GTC);;13;7;(GTC);;11;8;(GCT);;17;6;(GCC);;3;3;(GCG);;22;12;(GGA);;;;4;2;(GAG);;
3;3;(TAG);;8;4;(TCG);;8;1;(GTG);;12;6;(GTG);;14;14;(GTA);;17;14;(GTA);;7;7;(GCG);;42;9;(TCC);;34;3;(GTC);;3;1;(TAG);;4;4;(TAA);;4;4;(TAA);;6;4;(TAG);;2;2;(GGC);;15;10;(GCA);;20;19;(GCT);;8;2;(GTG);;14;4;(GTT);;6;2;(TCC);;10;4;(GTG);;5;3;(TCG);;2;2;(TAT);;17;8;(GTT);;4;4;(TAT);;9;9;(GCG);;12;8;(TAC);;1;1;(TAC);;2;2;(TAG);;2;2;(GGC);;1;1;(GGC);;9;5;(TAA);;10;6;(GTC);;5;4;(TAC);;76;69;(GCT);;5;3;(GTG);;1;1;(TAT);;2;2;(GGA);;5;4;(TAC);;3;3;(TAA);;1;1;(TAT);;2;2;(TAG);;2;2;(TAG);;1;1;(GGG);;4;4;(TAA);;3;2;(GGA);;1;1;(TAT);;1;1;(GGC);;28;26;(GTA);;3;3;(GGA);;26;15;(GTT);;3;3;(TAA);;9;1;(GTT);;4;4;(TAT);;20;17;(GTA);;1;1;(GGA);;35;35;1.00;;10;4;(GTC);;19;11;(GGT);;34;5;(GTC);;8;7;(GTA);;2;2;(GGA);;13;7;(GCC);;3;3;(TAA);;4;4;(TAA);;11;7;(GGC);;11;5;(GTC);;4;4;(TAT);;22;16;(TAT);;18;8;(GTT);;31;30;(GGC);;13;10;(GTA);;36;34;(GCT);;19;13;(GTC);;19;9;(GTG);;10;5;(GTG);;2;2;(GGC);;9;2;(GCT);;99;59;(GCT);;13;5;(GGT);;;;10;9;(GAT);;
1;1;(TAT);;2;2;(TCT);;28;18;(GTT);;19;9;(GTT);;45;38;(GTC);;26;5;(GTC);;19;11;(GCT);;10;6;(TCG);;26;5;(GTG);;7;4;(TAT);;5;5;(TAC);;5;4;(TAC);;7;5;(TAT);;1;1;(GGT);;19;7;(GCC);;1;1;(GGC);;18;9;(GTT);;5;5;(TAA);;10;4;(TCG);;23;6;(GTT);;4;4;(TCT);;1;1;(TCA);;4;4;(TAA);;2;2;(TCA);;12;8;(GCT);;17;12;(TAG);;2;2;(TAT);;2;2;(TAT);;23;22;(GTA);;50;47;(GTA);;9;4;(TAC);;7;2;(GTG);;3;3;(TAG);;1;1;(GGT);;9;7;(GTT);;1;1;(TCC);;1;1;(GGC);;6;6;(TAG);;1;1;(TAC);;4;2;(TCC);;3;3;(TAT);;3;2;(TAT);;11;11;(GTA);;6;6;(TAC);;1;1;(GGG);;1;1;(TCA);;2;2;(GGG);;27;14;(GTC);;3;3;(GGC);;6;5;(TAA);;3;2;(TAC);;12;12;(TAA);;1;1;(TCA);;31;11;(GTC);;1;1;(GGC);;;;;;10;1;(GTG);;90;50;(GTA);;13;4;(GTG);;11;3;(GTC);;1;1;(GGC);;1;1;(GCG);;3;2;(TAC);;5;5;(TAC);;2;2;(GGG);;9;4;(GTG);;2;2;(TCA);;33;14;(TCC);;4;4;(TAA);;1;1;(GGG);;7;4;(GTC);;1;1;(GGC);;12;8;(GTG);;23;13;(GTT);;15;9;(GTT);;1;1;(GGT);;1;1;(GGA);;3;2;(GGA);;21;18;(GTA);;;;136;38;(GCA);;
1;1;(TCA);;2;1;(TGA);;5;4;(TAA);;6;3;(TAA);;11;4;(GTG);;21;7;(GTG);;32;28;(GGA);;10;3;(TCT);;33;5;(GTT);;2;2;(TCA);;4;4;(TAG);;4;4;(TAG);;1;1;(TCA);;35;25;(GTA);;33;23;(GCT);;1;1;(GGG);;4;4;(TAA);;7;7;(TAC);;3;3;(TCT);;8;8;(TAA);;2;2;(TGA);;7;2;(TCC);;6;6;(TAC);;7;2;(TCC);;1;1;(GGA);;61;15;(TAT);;4;2;(TCC);;1;1;(TCA);;15;8;(GTC);;30;15;(GTC);;10;3;(TAG);;9;4;(GTT);;5;5;(TAT);;19;19;(GTA);;11;11;(TAA);;1;1;(TCG);;1;1;(GGG);;7;7;(TAT);;4;3;(TAG);;1;1;(TCG);;6;2;(TCC);;7;2;(TCC);;16;4;(GTC);;4;4;(TAG);;4;2;(GGT);;11;6;(TCC);;19;19;(GTA);;24;20;(GTG);;16;16;(GTA);;8;5;(TAC);;3;3;(TAG);;9;7;(TAC);;7;2;(TCC);;26;10;(GTG);;24;23;(GTA);;;;;;18;10;(GTT);;90;34;(GTC);;24;13;(GTT);;9;3;(GTG);;1;1;(GGG);;9;6;(GCT);;1;1;(TAG);;2;2;(TAG);;2;2;(GGT);;12;7;(GTT);;9;3;(TCC);;19;10;(TCG);;11;9;(TAC);;5;5;(GGT);;5;3;(GTG);;1;1;(GGT);;17;11;(GTT);;7;7;(TAA);;42;13;(TAA);;18;17;(GTA);;2;2;(GGT);;1;1;(GGG);;42;12;(GTC);;;;836;445;(GCC);;
8;3;(TCC);;3;2;(TGC);;7;7;(TAC);;7;3;(TAC);;24;7;(GTT);;16;6;(GTT);;2;2;(GGC);;8;5;(TGA);;7;3;(TAA);;34;6;(TCC);;5;5;(TAT);;5;5;(TAT);;47;11;(TCC);;14;6;(GTC);;1;1;(GGA);;5;5;(GTA);;3;2;(TAC);;4;3;(TAG);;2;2;(TGA);;16;16;(TAC);;5;2;(TGG);;7;2;(TCG);;5;5;(TAG);;5;4;(TCG);;1;1;(GGC);;1;1;(TCA);;2;2;(TCG);;7;4;(TCC);;7;1;(GTG);;26;16;(GTG);;8;3;(TAT);;4;4;(TAA);;2;2;(TCA);;20;14;(GTC);;7;7;(TAC);;1;1;(TCT);;31;31;(GTA);;11;7;(TCC);;6;6;(TAT);;3;3;(TCT);;5;4;(TCG);;3;2;(TCG);;10;3;(GTG);;5;5;(TAT);;13;11;(GTA);;1;1;(TCG);;13;8;(GTC);;21;11;(GTT);;8;6;(GTC);;4;4;(TAG);;11;11;(TAT);;7;6;(TAG);;6;5;(TCG);;30;13;(GTT);;15;7;(GTC);;;;;;7;7;(TAA);;27;12;(GTG);;7;6;(TAA);;14;5;(GTT);;29;28;(GTA);;4;3;(GGA);;3;3;(TAT);;5;5;(TAT);;14;14;(GTA);;9;9;(TAA);;5;3;(TCG);;18;9;(TCT);;5;3;(TAG);;9;9;(GTA);;8;5;(GTT);;15;15;(GTA);;5;4;(TAA);;9;7;(TAC);;4;3;(TAC);;49;44;(GTC);;19;19;(GTA);;107;48;(GTA);;26;8;(GTG);;;;24;7;(GCG);;
3;3;(TCG);;8;2;(TGG);;5;5;(TAG);;11;5;(TAG);;13;12;(TAA);;4;2;(TAA);;1;1;(GGT);;14;1;(TGC);;8;5;(TAC);;8;4;(TCG);;1;1;(TCA);;2;2;(TCA);;11;5;(TCG);;9;4;(GTG);;168;165;(GGC);;14;10;(GTC);;3;3;(TAG);;5;5;(TAT);;2;2;(TGC);;3;3;(TAG);;5;2;(TGT);;3;3;(TCT);;5;5;(TAT);;5;5;(TCT);;1;1;(GGG);;61;21;(TCC);;3;3;(TCT);;2;2;(TCG);;29;20;(GTT);;34;18;(GTT);;18;2;(TCC);;4;3;(TAC);;9;4;(TCC);;27;13;(GTG);;5;4;(TAG);;1;1;(TGA);;15;9;(GTC);;5;3;(TCG);;7;4;(TCA);;3;3;(TGA);;5;4;(TCT);;5;5;(TCT);;13;5;(GTT);;1;1;(TCA);;30;14;(GTC);;4;4;(TCT);;11;4;(GTG);;10;7;(TAA);;8;5;(GTG);;7;7;(TAT);;1;1;(TCA);;25;20;(TAT);;5;5;(TCT);;4;3;(TAA);;10;1;(GTG);;;;;;7;5;(TAC);;168;68;(GTT);;8;3;(TAC);;2;1;(TAA);;13;6;(GTC);;1;1;(GGC);;1;1;(TCA);;2;2;(TCA);;24;4;(GTC);;5;4;(TAC);;5;5;(TCT);;15;9;(TGA);;5;4;(TAT);;8;3;(GTC);;4;3;(TAA);;15;11;(GTC);;4;3;(TAC);;4;4;(TAG);;5;4;(TAG);;9;5;(GTG);;23;12;(GTC);;59;13;(GTC);;49;18;(GTT);;;;424;263;(GCT);;
3;3;(TCT);;2;1;(TGT);;6;6;(TAT);;5;2;(TAT);;18;18;(TAC);;5;3;(TAC);;39;38;(GTA);;41;11;(TGG);;8;2;(TAG);;8;3;(TCT);;11;4;(TCC);;6;1;(TCC);;12;3;(TCT);;27;18;(GTT);;6;6;(GGG);;10;8;(GTG);;5;5;(TAT);;1;1;(TCA);;5;1;(TGG);;6;6;(TAT);;5;3;(TTC);;2;2;(TGA);;4;4;(TCA);;3;3;(TGA);;10;9;(GTA);;79;14;(TCG);;3;3;(TGA);;4;4;(TCT);;9;8;(TAA);;16;15;(TAA);;9;3;(TCG);;5;5;(TAG);;6;6;(TCG);;51;37;(GTT);;7;7;(TAT);;1;1;(TGC);;14;4;(GTG);;6;6;(TCT);;10;4;(TCC);;6;4;(TGC);;2;2;(TGA);;2;2;(TGA);;7;5;(TAA);;9;7;(TCC);;18;8;(GTG);;5;4;(TGA);;21;14;(GTT);;15;13;(TAC);;13;5;(GTT);;1;1;(TCA);;9;6;(TCC);;1;1;(TCA);;3;3;(TGA);;4;1;(TAC);;29;20;(GTT);;;;;;3;3;(TAG);;5;3;(TAA);;9;3;(TAT);;2;1;(TAC);;11;4;(GTG);;1;1;(GGG);;9;3;(TCC);;12;7;(TCC);;15;7;(GTG);;4;4;(TAG);;5;5;(TGA);;17;7;(TGC);;10;8;(TCC);;6;2;(GTG);;2;2;(TAC);;12;5;(GTG);;6;6;(TAG);;6;6;(TAT);;4;4;(TAT);;13;6;(GTT);;14;9;(GTG);;42;18;(GTG);;5;3;(TAA);;;;2;2;(GGA);;
1;1;(TGA);;1;1;(TTA);;2;2;(TCA);;13;2;(TCC);;4;4;(TAG);;10;4;(TAG);;42;33;(GTC);;10;4;(TGT);;26;13;(TAT);;9;7;(TGA);;15;15;(TCG);;6;4;(TCG);;7;3;(TGA);;11;11;(TAA);;12;12;(GGT);;17;12;(GTT);;1;1;(TCA);;4;2;(TCC);;6;2;(TGT);;1;1;(TCA);;4;2;(TTG);;2;1;(TGC);;4;2;(TCC);;10;10;(TGC);;9;2;(GTC);;68;25;(TCT);;5;5;(TGC);;4;3;(TGA);;8;8;(TAC);;9;9;(TAC);;18;8;(TCT);;3;3;(TAT);;6;6;(TCT);;15;14;(TAA);;4;4;(TCA);;1;1;(TGG);;27;21;(GTT);;6;5;(TGA);;5;3;(TCG);;2;2;(TGG);;1;1;(TGC);;5;5;(TGC);;3;1;(TAC);;29;28;(TCG);;30;16;(GTT);;5;5;(TGC);;8;8;(TAA);;7;5;(TAG);;5;5;(TAA);;14;2;(TCC);;4;4;(TCG);;12;6;(TCC);;7;6;(TGC);;10;5;(TAG);;10;10;(TAA);;;;;;4;4;(TAT);;26;19;(TAC);;1;1;(TCA);;6;5;(TAG);;41;30;(GTT);;31;29;(GTA);;5;4;(TCG);;5;5;(TCG);;16;7;(GTT);;6;6;(TAT);;7;4;(TGC);;21;6;(TGG);;5;3;(TCG);;9;2;(GTT);;1;1;(TAG);;23;18;(GTT);;5;5;(TAT);;1;1;(TCA);;1;1;(TCA);;6;6;(TAA);;21;14;(GTT);;47;19;(GTT);;4;2;(TAC);;;;4;3;(GGC);;
6;6;(TGC);;11;3;(TTC);;7;4;(TCC);;6;2;(TCG);;8;8;(TAT);;4;3;(TAT);;19;5;(GTG);;19;4;(TTC);;3;2;(TCA);;9;2;(TGC);;9;9;(TCT);;5;5;(TCT);;11;5;(TGC);;6;5;(TAC);;36;29;(GTA);;13;13;(TAA);;6;4;(TCC);;5;4;(TCG);;6;1;(TTC);;34;24;(TCC);;4;2;(TTT);;8;1;(TGG);;4;3;(TCG);;5;2;(TGG);;16;8;(GTG);;62;19;(TGA);;5;4;(TGG);;7;4;(TGC);;5;5;(TAG);;24;20;(TAG);;11;5;(TGA);;7;4;(TCA);;4;4;(TGA);;50;39;(TAC);;5;5;(TCC);;1;1;(TGT);;16;15;(TAA);;9;6;(TGC);;7;6;(TCT);;2;2;(TGT);;3;3;(TGG);;4;3;(TGG);;4;4;(TAG);;16;15;(TCT);;8;5;(TAA);;4;3;(TGG);;6;6;(TAC);;10;8;(TAT);;8;8;(TAC);;5;3;(TCG);;4;4;(TCT);;7;7;(TCG);;4;3;(TGG);;5;3;(TAT);;7;5;(TAC);;;;;;1;1;(TCA);;40;14;(TAG);;17;7;(TCC);;5;3;(TAT);;8;8;(TAA);;17;10;(GTC);;6;6;(TCT);;6;6;(TCT);;4;4;(TAA);;3;3;(TCA);;6;1;(TGG);;21;10;(TGT);;7;6;(TCT);;3;3;(TAA);;1;1;(TAT);;6;6;(TAA);;1;1;(TCA);;12;5;(TCC);;6;4;(TCC);;16;16;(TAC);;9;7;(TAA);;46;35;(TAA);;9;5;(TAG);;;;12;8;(GGG);;
3;1;(TGG);;4;2;(TTG);;84;82;(TCG);;10;9;(TCT);;17;17;(TCA);;9;3;(TCC);;30;14;(GTT);;24;5;(TTG);;66;5;(TCC);;31;8;(TGG);;5;5;(TGA);;3;3;(TGA);;43;10;(TGG);;4;4;(TAG);;49;35;(GTC);;5;5;(TAC);;4;4;(TCG);;6;6;(TCT);;4;2;(TTG);;8;7;(TCG);;258;97;2.66;;6;2;(TGT);;5;5;(TCT);;6;6;(TGT);;28;21;(GTT);;53;17;(TGC);;4;4;(TGT);;4;3;(TGG);;6;6;(TAT);;18;16;(TAT);;17;5;(TGC);;4;3;(TCC);;8;7;(TGC);;11;11;(TAG);;4;4;(TCG);;1;1;(TTC);;7;6;(TAC);;8;3;(TGG);;4;2;(TGA);;5;4;(TTC);;5;3;(TGT);;3;3;(TGT);;5;5;(TAT);;4;4;(TGA);;7;5;(TAC);;2;2;(TGT);;4;4;(TAG);;5;5;(TCA);;3;3;(TAG);;6;6;(TCT);;3;2;(TGA);;27;26;(TCT);;6;5;(TGT);;10;5;(TCC);;3;3;(TAG);;;;;;4;2;(TCC);;10;7;(TAT);;7;2;(TCG);;1;1;(TCA);;7;5;(TAC);;10;2;(GTG);;4;4;(TGA);;3;3;(TGA);;4;2;(TAC);;6;4;(TCC);;7;3;(TGT);;1;1;(TTA);;5;5;(TGA);;5;4;(TAC);;1;1;(TCA);;26;26;(TAC);;16;11;(TCC);;7;7;(TCG);;5;5;(TCG);;4;4;(TAG);;5;4;(TAC);;36;19;(TAC);;5;4;(TAT);;;;236;100;(GTA);;
3;2;(TGT);;8;5;(TTT);;17;17;(TCT);;12;6;(TGA);;987;962;(TCC);;5;1;(TCG);;10;10;(TAA);;16;5;(TTT);;17;6;(TCG);;11;2;(TGT);;11;8;(TGC);;15;14;(TGC);;12;5;(TGT);;5;5;(TAT);;37;27;(GTG);;4;4;(TAG);;5;5;(TCT);;5;3;(TGA);;6;2;(TTT);;9;9;(TCT);;;;;;7;2;(TTC);;4;4;(TGA);;8;5;(TTC);;19;19;(TAA);;29;7;(TGG);;4;4;(TTC);;4;3;(TGT);;3;3;(TCA);;2;2;(TCA);;27;7;(TGG);;4;4;(TCG);;7;3;(TGG);;7;7;(TAT);;9;9;(TCT);;1;1;(TTG);;5;5;(TAG);;7;2;(TGT);;6;6;(TGC);;1;1;(TTG);;5;4;(TTC);;9;6;(TTC);;1;1;(TCA);;8;7;(TGC);;10;4;(TAG);;1;1;(TTA);;5;5;(TAT);;15;9;(TCC);;5;5;(TAT);;4;4;(TGA);;7;5;(TGC);;10;9;(TGA);;7;4;(TTC);;4;2;(TCG);;7;7;(TAT);;;;;;6;5;(TCG);;1;1;(TCA);;11;6;(TCT);;9;4;(TCC);;3;3;(TAG);;33;24;(GTT);;9;6;(TGC);;8;7;(TGC);;9;6;(TAG);;4;4;(TCG);;2;2;(TTA);;26;8;(TTC);;14;12;(TGC);;3;3;(TAG);;7;3;(TCC);;5;5;(TAG);;7;7;(TCG);;13;12;(TCT);;6;6;(TCT);;5;5;(TAT);;11;7;(TAG);;25;10;(TAG);;11;3;(TCC);;;;150;43;(GTC);;
7;2;(TTC);;422;138;3.06;;6;6;(TGA);;10;3;(TGC);;9;8;(TCG);;9;7;(TCT);;21;19;(TAC);;743;213;;;13;3;(TCT);;17;3;(TTC);;8;7;(TGG);;6;2;(TGG);;20;4;(TTC);;2;2;(TCA);;48;32;(GTT);;13;13;(TAT);;3;2;(TGA);;13;12;(TGC);;293;98;;;6;5;(TGA);;;;;;4;1;(TTG);;11;9;(TGC);;4;3;(TTG);;6;6;(TAC);;35;16;(TGT);;2;2;(TTG);;9;7;(TTC);;5;4;(TCC);;39;21;(TCC);;10;5;(TGT);;6;6;(TCT);;6;6;(TGT);;24;24;(TCA);;6;6;(TGA);;1;1;(TTT);;7;7;(TAT);;14;4;(TTC);;4;1;(TGG);;4;2;(TTT);;3;3;(TTG);;4;3;(TTG);;8;2;(TCC);;7;6;(TGG);;14;7;(TAT);;3;3;(TTC);;3;3;(TCA);;7;5;(TCG);;4;4;(TCA);;9;9;(TGC);;4;3;(TGG);;11;6;(TGC);;5;3;(TTG);;12;6;(TCT);;3;3;(TCA);;;;;;6;6;(TCT);;17;4;(TCC);;9;5;(TGA);;7;5;(TCG);;6;6;(TAT);;11;9;(TAA);;6;2;(TGG);;6;4;(TGG);;5;4;(TAT);;6;6;(TCT);;15;5;(TTC);;17;7;(TTG);;4;2;(TGG);;4;4;(TAT);;3;3;(TCG);;8;8;(TAT);;10;10;(TCT);;8;8;(TGA);;5;5;(TGA);;21;21;(TCA);;9;6;(TAT);;51;25;(TAT);;7;4;(TCG);;;;387;163;(GTG);;
3;3;(TTG);;;;;;9;7;(TGC);;47;6;(TGG);;55;55;(TCT);;10;5;(TGA);;5;5;(TAG);;;;;;14;7;(TGA);;20;5;(TTG);;4;3;(TGT);;4;3;(TGT);;14;3;(TTG);;9;3;(TCC);;13;12;(TAA);;4;4;(TCA);;9;7;(TGC);;7;3;(TGG);;;;;;66;64;(TGC);;;;;;6;3;(TTT);;7;3;(TGG);;11;5;(TTT);;33;33;(TAG);;46;24;(TTC);;4;2;(TTT);;2;2;(TTG);;6;5;(TCG);;17;15;(TCG);;16;4;(TTC);;3;3;(TGA);;8;5;(TTC);;619;616;(TCC);;20;19;(TGC);;83;49;1.69;;2;2;(TCA);;7;7;(TTG);;6;3;(TGT);;155;105;1.48;;3;2;(TTT);;5;2;(TTT);;5;4;(TCG);;7;6;(TGT);;1;1;(TCA);;2;1;(TTG);;6;2;(TCC);;6;6;(TCT);;133;132;(TCC);;5;3;(TGG);;6;5;(TGT);;11;5;(TGG);;9;6;(TTT);;17;7;(TGA);;8;2;(TCC);;;;;;5;5;(TGA);;26;9;(TCG);;21;8;(TGC);;7;3;(TCT);;3;3;(TCA);;10;10;(TAC);;5;4;(TGT);;5;5;(TGT);;1;1;(TCA);;6;5;(TGA);;45;29;(TTG);;57;20;(TTT);;8;5;(TGT);;1;1;(TCA);;4;4;(TCT);;18;18;(TCA);;9;9;(TGA);;8;5;(TGC);;4;4;(TGC);;833;814;(TCC);;1;1;(TCA);;1;1;(TCA);;9;6;(TCT);;;;1045;470;(GTT);;
5;3;(TTT);;;;;;11;8;(TGG);;9;5;(TGT);;5;5;(TGA);;13;6;(TGC);;8;8;(TAT);;;;;;11;4;(TGC);;14;1;(TTT);;3;3;(TTA);;7;5;(TTC);;30;7;(TTT);;4;4;(TCG);;145;116;(TAC);;24;14;(TCC);;4;2;(TGG);;8;6;(TGT);;;;;;7;2;(TGG);;;;;;332;104;3.19;;7;5;(TGT);;485;322;1.51;;9;9;(TAT);;60;13;(TTG);;203;140;1.45;;6;4;(TTT);;5;5;(TCT);;21;19;(TCT);;13;3;(TTG);;5;4;(TGC);;6;4;(TTG);;18;14;(TCG);;10;7;(TGG);;;;;;5;3;(TCC);;13;4;(TTT);;12;6;(TTC);;;;;;252;142;1.77;;258;153;1.69;;6;6;(TCT);;2;2;(TTA);;15;6;(TCC);;3;2;(TTT);;7;7;(TCG);;6;6;(TGA);;6;6;(TCG);;7;6;(TGT);;1;1;(TTA);;25;22;(TGT);;338;188;1.80;;10;1;(TGC);;5;5;(TCG);;;;;;9;9;(TGC);;18;10;(TCT);;23;10;(TGG);;5;3;(TGA);;8;5;(TCC);;4;4;(TAG);;10;5;(TTC);;10;9;(TTC);;10;3;(TCC);;8;7;(TGC);;14;6;(TTT);;1066;427;;;1;1;(TTA);;5;3;(TCC);;4;4;(TGA);;1073;1068;(TCC);;11;9;(TGC);;9;5;(TGG);;32;32;(TGG);;7;7;(TCG);;19;12;(TCC);;80;27;(TCC);;11;5;(TGA);;;;73;54;(TAA);;
211;119;1.77;;;;;;9;8;(TGT);;1;1;(TTA);;42;42;(TGC);;18;10;(TGG);;29;29;(TCA);;;;;;54;6;(TGG);;596;180;;;15;11;(TTC);;5;4;(TTG);;827;220;;;6;6;(TCT);;20;18;(TAG);;5;4;(TCG);;4;3;(TGT);;11;7;(TTC);;;;;;8;7;(TGT);;;;;;;;;;11;6;(TTC);;;;;;18;18;(TCA);;61;31;(TTT);;;;;;283;169;1.67;;5;5;(TGA);;18;15;(TGA);;20;5;(TTT);;5;4;(TGG);;12;8;(TTT);;90;90;(TCT);;9;8;(TGT);;;;;;5;5;(TCG);;481;222;2.17;;4;3;(TTG);;;;;;;;;;;;;;3;2;(TGA);;7;6;(TTC);;5;2;(TCG);;201;149;1.35;;7;7;(TCT);;17;11;(TGC);;22;22;(TCT);;18;9;(TTC);;5;4;(TTC);;14;8;(TTC);;;;;;14;9;(TGG);;6;6;(TCT);;;;;;6;4;(TGG);;20;10;(TGA);;11;6;(TGT);;9;2;(TGC);;6;5;(TCG);;5;5;(TAT);;6;5;(TTG);;5;3;(TTG);;4;1;(TCG);;5;3;(TGG);;448;218;2.06;;;;;;235;205;(TTC);;5;5;(TCG);;7;5;(TGC);;12;12;(TCG);;14;10;(TGG);;7;6;(TGT);;4;4;(TGT);;48;48;(TCT);;6;3;(TCG);;33;8;(TCG);;15;7;(TGC);;;;230;59;(TAC);;
;;;;;;;;1;1;(TTA);;16;9;(TTC);;5;3;(TGG);;10;8;(TGT);;391;385;(TCC);;;;;;15;3;(TGT);;;;;;43;42;(TTG);;15;10;(TTT);;;;;;5;4;(TGA);;23;19;(TAT);;26;25;(TCT);;6;4;(TTC);;5;3;(TTG);;;;;;20;15;(TTC);;;;;;;;;;6;4;(TTG);;;;;;48;46;(TCC);;2489;795;;;;;;;;;;;7;6;(TGC);;24;20;(TGC);;738;237;;;4;4;(TGT);;433;269;;;7;7;(TGA);;1;1;(TTA);;;;;;6;6;(TCT);;;;;;10;7;(TTT);;;;;;;;;;;;;;11;8;(TGC);;37;35;(TTG);;8;6;(TCT);;;;;;6;6;(TGA);;12;9;(TGG);;4;4;(TGA);;5;3;(TTG);;5;4;(TTG);;6;5;(TTG);;;;;;16;7;(TGT);;9;9;(TGA);;;;;;7;7;(TGT);;31;10;(TGC);;1;1;(TTA);;8;2;(TGG);;8;6;(TCT);;2;2;(TCA);;1;1;(TTT);;8;3;(TTT);;8;6;(TCT);;7;6;(TGT);;;;;;;;;;9;6;(TTG);;5;5;(TCT);;1;1;(TGG);;123;122;(TCT);;12;9;(TGT);;13;9;(TTC);;3;3;(TTA);;6;6;(TGA);;6;3;(TCT);;105;53;(TCT);;31;18;(TGG);;;;244;134;(TAG);;
;;;;;;;;11;7;(TTC);;10;4;(TTG);;8;7;(TGT);;15;7;(TTC);;12;11;(TCG);;;;;;36;9;(TTC);;;;;;34;28;(TTT);;498;325;1.53;;;;;;6;5;(TGC);;3;3;(TCA);;15;15;(TGA);;4;2;(TTG);;15;11;(TTT);;;;;;5;3;(TTG);;;;;;;;;;15;8;(TTT);;;;;;1201;1194;(TCG);;;;;;;;;;;;;;7;4;(TGG);;21;15;(TGG);;;;;;6;4;(TTC);;;;;;53;47;(TGC);;11;9;(TTC);;;;;;20;16;(TGA);;;;;;353;209;1.69;;;;;;;;;;;;;;8;5;(TGG);;31;25;(TTT);;8;4;(TGA);;;;;;11;11;(TGC);;18;16;(TGT);;12;12;(TGC);;12;8;(TTT);;11;7;(TTT);;16;7;(TTT);;;;;;16;6;(TTC);;10;10;(TGC);;;;;;1;1;(TTA);;43;14;(TGG);;14;1;(TTC);;5;4;(TGT);;8;8;(TGA);;7;5;(TCC);;407;247;1.65;;375;229;1.64;;13;6;(TGA);;1;1;(TTA);;;;;;;;;;38;23;(TTT);;7;7;(TGA);;4;3;(TGT);;6;6;(TGA);;16;13;(TTC);;10;7;(TTG);;9;7;(TTC);;36;36;(TGC);;8;3;(TGA);;41;19;(TGA);;14;6;(TGT);;;;75;53;(TAT);;
;;;;;;;;43;42;(TTG);;16;6;(TTT);;24;24;(TTA);;15;8;(TTG);;44;44;(TCT);;;;;;40;11;(TTG);;;;;;912;773;;;;;;;;;;;6;3;(TGG);;66;44;(TCC);;15;12;(TGC);;11;7;(TTT);;519;358;1.45;;;;;;18;14;(TTT);;;;;;;;;;494;300;1.65;;;;;;54;54;(TCT);;;;;;;;;;;;;;6;5;(TGT);;30;24;(TGT);;;;;;3;3;(TTG);;;;;;14;12;(TGG);;10;9;(TTG);;;;;;11;11;(TGC);;;;;;;;;;;;;;;;;;;;;;4;3;(TGT);;756;632;;;16;8;(TGC);;;;;;5;3;(TGG);;3;3;(TTA);;6;4;(TGG);;506;281;;;327;203;1.61;;674;401;1.68;;;;;;21;12;(TTG);;6;4;(TGG);;;;;;13;7;(TTC);;19;9;(TGT);;11;1;(TTG);;7;2;(TTC);;9;7;(TGC);;6;6;(TCG);;;;;;;;;;13;5;(TGC);;21;17;(TTC);;;;;;;;;;808;572;1.41;;39;39;(TGC);;2;2;(TTC);;40;37;(TGC);;9;5;(TTG);;20;13;(TTT);;64;51;(TTG);;5;3;(TGG);;37;21;(TGC);;47;18;(TGC);;22;10;(TTC);;;;14;12;(TCA);;
;;;;;;;;55;50;(TTT);;699;268;;;2368;2321;(TTC);;12;9;(TTT);;7;7;(TGA);;;;;;29;9;(TTT);;;;;;;;;;;;;;;;;;7;7;(TGT);;25;22;(TCG);;4;3;(TGG);;384;244;1.57;;;;;;;;;;1119;929;1.20;;;;;;;;;;;;;;;;;;14;13;(TGA);;;;;;;;;;;;;;2;1;(TTA);;1;1;(TTA);;;;;;8;5;(TTT);;;;;;22;17;(TGT);;20;13;(TTT);;;;;;10;7;(TGG);;;;;;;;;;;;;;;;;;;;;;1;1;(TTA);;;;;;11;3;(TGG);;;;;;6;6;(TGT);;16;13;(TTC);;5;4;(TGT);;;;;;;;;;;;;;;;;;12;8;(TTT);;8;8;(TGT);;;;;;6;4;(TTG);;2;1;(TTA);;18;5;(TTT);;10;7;(TTG);;9;6;(TGG);;6;6;(TCT);;;;;;;;;;11;5;(TGG);;8;8;(TTG);;;;;;;;;;;;;;7;5;(TGG);;2;2;(TTG);;8;5;(TGG);;15;11;(TTT);;616;345;1.79;;10;6;(TTT);;6;5;(TGT);;16;8;(TGG);;53;17;(TGG);;22;14;(TTG);;;;47;23;(TCC);;
;;;;;;;;1474;1302;;;;;;;10;8;(TTG);;648;267;2.43;;35;31;(TGC);;;;;;1095;278;;;;;;;;;;;;;;;;;;;1;1;(TTA);;14;14;(TCT);;18;17;(TGT);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;10;9;(TGC);;;;;;;;;;;;;;16;13;(TTC);;51;39;(TTC);;;;;;367;282;1.30;;;;;;2;2;(TTA);;377;318;;;;;;;6;6;(TGT);;;;;;;;;;;;;;;;;;;;;;8;3;(TTC);;;;;;10;7;(TGT);;;;;;3;3;(TTA);;11;8;(TTG);;139;136;(TTC);;;;;;;;;;;;;;;;;;750;312;;;3;3;(TTA);;;;;;12;6;(TTT);;12;9;(TTC);;647;260;2.49;;8;4;(TTT);;4;4;(TGT);;9;9;(TGA);;;;;;;;;;12;8;(TGT);;18;14;(TTT);;;;;;;;;;;;;;6;4;(TGT);;4;1;(TTT);;18;17;(TGT);;614;409;1.50;;;;;;458;323;1.42;;20;20;(TTA);;8;6;(TGT);;91;43;(TGT);;82;68;(TTT);;;;107;50;(TCG);;
;;;;;;;;;;;;;;;;86;82;(TTT);;;;;;9;3;(TGG);;;;;;;;;;;;;;;;;;;;;;;;;;21;18;(TTC);;54;51;(TGA);;1;1;(TTA);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;68;64;(TGG);;;;;;;;;;;;;;11;10;(TTG);;11;8;(TTG);;;;;;;;;;;;;;114;107;(TTC);;;;;;;;;;2;2;(TTA);;;;;;;;;;;;;;;;;;;;;;7;6;(TTG);;;;;;32;30;(TTA);;;;;;14;12;(TTC);;32;25;(TTT);;7;7;(TTG);;;;;;;;;;;;;;;;;;;;;;13;6;(TTC);;;;;;412;256;1.61;;44;21;(TTG);;;;;;430;181;2.38;;1;1;(TTA);;10;9;(TGC);;;;;;;;;;1;1;(TTA);;396;279;1.42;;;;;;;;;;;;;;5;3;(TTC);;279;201;1.39;;2;2;(TTA);;;;;;;;;;;;;;1901;1872;(TTC);;1;1;(TTA);;2;2;(TTA);;1202;601;;;;;252;139;(TCT);;
;;;;;;;;;;;;;;;;7113;6771;;;;;;;10;8;(TGT);;;;;;;;;;;;;;;;;;;;;;;;;;7;7;(TTG);;5898;3009;(TGC);;17;17;(TTC);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;13;12;(TGT);;;;;;;;;;;;;;14;11;(TTT);;63;46;(TTT);;;;;;;;;;;;;;14;11;(TTG);;;;;;;;;;12;10;(TTC);;;;;;;;;;;;;;;;;;;;;;14;6;(TTT);;;;;;22;9;(TTC);;;;;;10;8;(TTG);;859;583;;;22;17;(TTT);;;;;;;;;;;;;;;;;;;;;;14;12;(TTG);;;;;;;;;;24;7;(TTT);;;;;;;;;;24;15;(TTC);;10;6;(TGG);;;;;;;;;;13;5;(TTC);;;;;;;;;;;;;;;;;;4;2;(TTG);;;;;;114;112;(TTC);;;;;;;;;;;;;;16;12;(TTG);;15;10;(TTC);;84;24;(TTC);;;;;;;;209;117;(TGA);;
;;;;;;;;;;;;;;;;;;;;;;;;4;4;(TTA);;;;;;;;;;;;;;;;;;;;;;;;;;16;11;(TTT);;51;44;(TGG);;16;15;(TTG);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;37;36;(TTA);;;;;;;;;;;;;;508;379;1.34;;1497;1045;1.43;;;;;;;;;;;;;;60;46;(TTT);;;;;;;;;;16;15;(TTG);;;;;;;;;;;;;;;;;;;;;;470;285;1.65;;;;;;20;10;(TTG);;;;;;23;15;(TTT);;;;;;1179;1100;1.07;;;;;;;;;;;;;;;;;;;;;;19;13;(TTT);;;;;;;;;;2488;1087;;;;;;;;;;;13;13;(TTG);;6;5;(TGT);;;;;;;;;;11;8;(TTG);;;;;;;;;;;;;;;;;;10;5;(TTT);;;;;;8;6;(TTG);;;;;;;;;;;;;;74;70;(TTT);;10;7;(TTG);;28;8;(TTG);;;;;;;;368;103;(TGC);;
;;;;;;;;;;;;;;;;;;;;;;;;435;424;(TTC);;;;;;;;;;;;;;;;;;;;;;;;;;492;346;1.42;;206;157;(TGT);;36;32;(TTT);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;15;11;(TTC);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;2004;1751;;;;;;;;;;;19;13;(TTT);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;20;13;(TTT);;;;;;508;383;1.33;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;531;357;1.49;;;;;;;;;;;;;;;;;;;;;;23;15;(TTT);;2;2;(TTA);;;;;;;;;;11;8;(TTT);;;;;;;;;;;;;;;;;;804;658;1.22;;;;;;31;26;(TTT);;;;;;;;;;;;;;5873;5642;;;11;6;(TTT);;72;21;(TTT);;;;;;;;205;97;(TGG);;
;;;;;;;;;;;;;;;;;;;;;;;;20;18;(TTG);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;1;1;(TTA);;557;483;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;782;777;(TTG);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;530;398;1.33;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;684;365;1.87;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;613;438;1.40;;18;12;(TTC);;;;;;;;;;628;294;2.14;;;;;;;;;;;;;;;;;;;;;;;;;;2019;1908;;;;;;;;;;;;;;;;;;;583;347;1.68;;2642;1054;;;;;;;;;290;139;(TGT);;
;;;;;;;;;;;;;;;;;;;;;;;;78;68;(TTT);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;66;59;(TTC);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;50;45;(TTT);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;20;17;(TTG);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;6;5;(TTA);;
;;;;;;;;;;;;;;;;;;;;;;;;4057;3737;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;7;6;(TTG);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;3778;3620;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;20;14;(TTT);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;225;97;(TTC);;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;43;38;(TTT);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;613;452;1.36;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;105;46;(TTG);;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;13732;10330;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;525;250;(TTT);;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;12273;5704;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;0;0;(AAA);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;0;0;(AAA);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;;;;;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;;;;;0;0;(AAA);;;;;;;;;;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;;;;;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;;;;;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;;;;;0;0;(AAA);;0;0;(ACA);;0;0;(AAA);;0;0;(AAA);;;;;;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;;;;;0;0;(AAA);;;;;;;;;;;;;;0;0;(AAA);;;;;;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;;;;;0;0;(ACA);;0;0;(AAA);;;;;;;;;;;;;;0;0;(AAA);;0;0;(AAA);;;;;;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;;;;;0;0;(AAA);;;;;;;;;;;;;;;;;;;;;;0;0;(AAA);;0;0;(AAA);;;;;;;;;;;;;;;;;;;;(AAA)
0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;;;;;0;0;(ACA);;;;;;0;0;(ACA);;;;;;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;;;;;;;;;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;;;;;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;;;;;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;;;;;;;;;0;0;(ACC);;;;;;;;;;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;;;;;;;;;0;0;(ACA);;;;;;0;0;(ACA);;;;;;0;0;(ACA);;;;;;0;0;(ACA);;0;0;(ACA);;;;;;0;0;(ACA);;;;;;;;;;0;0;(ACC);;;;;;0;0;(ACA);;;;;;0;0;(ACA);;0;0;(ACA);;;;;;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;;;;;0;0;(ACA);;0;0;(ACA);;;;;;0;0;(ACA);;;;;;;;;;0;0;(ACA);;0;0;(ACA);;;;;;;;;;;;;;;;;;;;;;;;;;;;(ACA)
0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;;;;;0;0;(ACC);;;;;;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;;;;;0;0;(ACC);;0;0;(ACC);;;;;;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;;;;;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;;;;;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;;;;;0;0;(ACC);;;;;;0;0;(ACC);;0;0;(ACT);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;;;;;0;0;(ACC);;;;;;0;0;(ACC);;0;0;(ACC);;;;;;;;;;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACT);;0;0;(ACC);;;;;;0;0;(ACC);;;;;;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;;;;;;;;;;;;;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;;;;;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;;;;;;;(ACC)
0;0;(ACT);;0;0;(ACT);;;;;;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;;;;;0;0;(ACT);;0;0;(ACT);;;;;;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;;;;;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;;;;;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;;;;;0;0;(ACT);;;;;;0;0;(ACT);;;;;;0;0;(ACT);;0;0;(ATA);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;;;;;0;0;(ACT);;0;0;(ACT);;;;;;;;;;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ATA);;0;0;(ACT);;0;0;(ACT);;;;;;0;0;(ACT);;0;0;(ACT);;;;;;;;;;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;;;;;0;0;(ACT);;0;0;(ACT);;;;;;;;;;;;;;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;;;;;;;(ACT)
0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;;;;;;;;;0;0;(ATA);;;;;;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;;;;;;;;;;;;;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;;;;;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;;;;;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;;;;;;;;;;;;;0;0;(ATC);;;;;;0;0;(ATA);;;;;;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;;;;;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;;;;;0;0;(ATA);;0;0;(ATA);;;;;;0;0;(ATA);;;;;;;;;;0;0;(ATC);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;;;;;;;;;0;0;(ATA);;0;0;(ATA);;;;;;;;;;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;;;;;;;;;;;;;0;0;(ATA);;;;;;;;;;0;0;(ATA);;0;0;(ATA);;;;;;;;(ATA)
0;0;(ATC);;0;0;(ATC);;;;;;0;0;(ATC);;;;;;0;0;(ATC);;;;;;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;;;;;0;0;(ATC);;0;0;(ATC);;;;;;;;;;0;0;(ATC);;;;;;;;;;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;;;;;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;;;;;0;0;(ATC);;;;;;0;0;(ATC);;0;0;(ATC);;;;;;0;0;(ATG);;;;;;;;;;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;;;;;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;;;;;;;;;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;;;;;;;;;0;0;(ATG);;;;;;;;;;0;0;(ATC);;;;;;;;;;;;;;;;;;0;0;(ATC);;;;;;;;;;0;0;(ATC);;0;0;(ATC);;;;;;;;;;0;0;(ATC);;;;;;0;0;(ATC);;;;;;;;;;;;;;;;;;0;0;(ATC);;;;;;;;;;;;(ATC)
0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;;;;;;;;;0;0;(ATG);;;;;;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;;;;;;;;;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;;;;;0;0;(ATG);;0;0;(ATG);;;;;;0;0;(ATG);;;;;;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;;;;;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;;;;;0;0;(ATG);;0;0;(ATT);;0;0;(ATG);;0;0;(ATG);;;;;;0;0;(ATG);;;;;;0;0;(ATG);;;;;;;;;;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;;;;;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATT);;0;0;(ATG);;;;;;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;;;;;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;;;;;;;;;0;0;(ATG);;;;;;;;;;;;;;;;0;0;(ATG);;(ATG)
0;0;(ATT);;0;0;(ATT);;;;;;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;;;;;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;;;;;;;;;0;0;(ATT);;;;;;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;;;;;;;;;0;0;(ATT);;;;;;;;;;;;;;0;0;(ATT);;;;;;;;;;;;;;0;0;(ATT);;0;0;(ATT);;;;;;;;;;0;0;(CTA);;;;;;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;;;;;;;;;0;0;(ATT);;;;;;0;0;(ATT);;0;0;(ATT);;;;;;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;;;;;0;0;(CTA);;;;;;0;0;(ATT);;0;0;(ATT);;;;;;;;;;;;;;0;0;(ATT);;0;0;(ATT);;;;;;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;;;;;;;;;;;;;;;;;0;0;(ATT);;0;0;(ATT);;;;;;0;0;(ATT);;;;;;;;;;0;0;(ATT);;;;;;;;(ATT)
0;0;(CTA);;0;0;(CTA);;;;;;0;0;(CTA);;;;;;0;0;(CTA);;;;;;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;;;;;0;0;(CTA);;0;0;(CTA);;;;;;;;;;;;;;;;;;;;;;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;;;;;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;;;;;;;;;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;;;;;0;0;(GAC);;;;;;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;;;;;0;0;(CTA);;0;0;(CTA);;;;;;0;0;(CTA);;;;;;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(GAC);;0;0;(CTA);;;;;;0;0;(CTA);;;;;;;;;;;;;;0;0;(CTA);;;;;;;;;;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;;;;;0;0;(CTA);;;;;;;;;;;;;;;;(CTA)
0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;;;;;;;;;;;;;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;;;;;;;;;0;0;(GAC);;;;;;;;;;0;0;(GAC);;;;;;0;0;(GAC);;0;0;(GAC);;;;;;0;0;(GAC);;0;0;(GAC);;;;;;;;;;;;;;;;;;0;0;(GAC);;;;;;;;;;0;0;(GAC);;;;;;0;0;(GAC);;0;0;(GAG);;;;;;0;0;(GAC);;0;0;(GAC);;;;;;0;0;(GAC);;0;0;(GAC);;;;;;0;0;(GAC);;;;;;;;;;;;;;;;;;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;;;;;;;;;0;0;(GAG);;;;;;;;;;0;0;(GAC);;0;0;(GAC);;;;;;;;;;0;0;(GAC);;0;0;(GAC);;;;;;;;;;0;0;(GAC);;0;0;(GAC);;;;;;;;;;;;;;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;;;;;;;;;0;0;(GAC);;;;;;;;;;;;(GAC)
0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;;;;;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;;;;;;;;;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAT);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAT);;0;0;(GAG);;0;0;(GAG);;;;;;;;;;;;;;;;;;0;0;(GAG);;;;;;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;;;;;0;0;(GAG);;;;;;;;(GAG)
0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;;;;;;;;;;;;;0;0;(GAT);;0;0;(GAT);;;;;;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;;;;;0;0;(GAT);;;;;;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;;;;;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;;;;;0;0;(GAT);;;;;;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;;;;;0;0;(GAT);;0;0;(GAT);;0;0;(GCG);;;;;;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;;;;;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;;;;;0;0;(GAT);;0;0;(GAT);;;;;;;;;;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;;;;;0;0;(GCG);;;;;;0;0;(GAT);;;;;;0;0;(GAT);;;;;;;;;;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;;;;;0;0;(GAT);;;;;;0;0;(GAT);;;;;;;;;;;;;;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;;;;;;;;;0;0;(GAT);;;;;;;;(GAT)
0;0;(GCG);;0;0;(GCG);;;;;;0;0;(GCG);;0;0;(GCG);;;;;;;;;;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;;;;;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;;;;;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GGA);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;;;;;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GGA);;0;0;(GCG);;;;;;0;0;(GCG);;;;;;0;0;(GCG);;;;;;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;;;;;;;;;0;0;(GCG);;;;;;0;0;(GCG);;;;;;0;0;(GCG);;;;;;;;(GCG)
0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;;;;;;;;;;;;;;;;;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;;;;;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;;;;;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;;;;;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGC);;;;;;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;;;;;0;0;(GGA);;;;;;;;;;;;;;;;;;;;;;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;;;;;;;;;0;0;(GGC);;0;0;(GGA);;0;0;(GGA);;;;;;0;0;(GGA);;;;;;;;;;0;0;(GGA);;0;0;(GGA);;;;;;;;;;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;;;;;0;0;(GGA);;0;0;(GGA);;;;;;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;;;;;;;;;;;;;;;;;;;(GGA)
0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;;;;;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;;;;;0;0;(GGC);;;;;;;;;;;;;;;;;;0;0;(GGC);;0;0;(GGC);;;;;;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;;;;;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;;;;;;;;;0;0;(GGC);;;;;;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGG);;;;;;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;;;;;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;;;;;0;0;(GGC);;;;;;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;;;;;;;;;0;0;(GGG);;;;;;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;;;;;;;;;;;;;0;0;(GGC);;;;;;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;;;;;0;0;(GGC);;;;;;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;;;;;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;;;;;;;(GGC)
;;;;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;;;;;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;;;;;;;;;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;;;;;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;;;;;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGT);;;;;;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;;;;;0;0;(GGG);;;;;;0;0;(GGG);;;;;;;;;;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGT);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;;;;;;;;;0;0;(GGG);;0;0;(GGG);;;;;;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;;;;;0;0;(GGG);;0;0;(GGG);;;;;;0;0;(GGG);;;;;;0;0;(GGG);;0;0;(GGG);;;;;;0;0;(GGG);;;;;;;;(GGG)
0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;;;;;0;0;(GGT);;;;;;;;;;0;0;(GGT);;;;;;0;0;(GGT);;0;0;(GGT);;;;;;0;0;(GGT);;;;;;;;;;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;;;;;;;;;0;0;(GGT);;;;;;0;0;(GGT);;0;0;(TCA);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;;;;;0;0;(GGT);;0;0;(GGT);;;;;;0;0;(GGT);;;;;;0;0;(GGT);;;;;;0;0;(GGT);;;;;;0;0;(GGT);;0;0;(TCA);;0;0;(GGT);;;;;;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;;;;;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;;;;;;;;;;;;;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;;;;;;;;;0;0;(GGT);;;;;;;;0;0;(GGT);;(GGT)
0;0;(TTA);;;;;;;;;;;;;;;;;;0;0;(TTA);;;;;;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;;;;;0;0;(TTA);;0;0;(TTA);;;;;;;;;;;;;;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;;;;;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;;;;;;;;;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;;;;;;;;;0;0;(TTA);;;;;;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;;;;;;;;;;;;;;;;;;;;;;;;;0;0;(TTA);;0;0;(TTA);;;;;;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;;;;;0;0;(TTA);;;;;;;;;;;;;;0;0;(TTA);;;;;;;;;;0;0;(TTA);;0;0;(TTA);;;;;;;;;;;;;;;;;;;;;;0;0;(TTA);;0;0;(TTA);;;;;;0;0;(TTA);;0;0;(TTA);;;;;;;;;;;;;;;;;;0;0;(TTA);;;;;;;;(TTA)

C42[modifier | modifier le wikicode]

C42 liste[modifier | modifier le wikicode]

tRNAs;KEGG;Génome
181;ani;Aspergillus nidulans FGSC A4
242;aor;Aspergillus oryzae RIB40
212;bfu;Botrytis cinerea B05.10
125;cal;Candida albicans WO-1
207;cgr;Candida glabrata CBS 138
82;cot;Candida orthopsilosis Co 90-125
143;cneg*;Cryptococcus neoformans var. grubii H99
191;cjd*;Cyberlindnera jadinii NBRC 0988 NBRC0988
214;dha;Debaryomyces hansenii CBS767
46;ecu;Encephalitozoon cuniculi GB-M1
53;ede*;Exophiala dermatitidis NIH/UT8656
273;fve*;Flammulina velutipes KACC42780
270;fgr;Fusarium graminearum CS3005
305;fgr;Fusarium graminearum PH-1 NRRL 31084
285;fvr;Fusarium verticillioides 7600
266;kaf;Kazachstania africana CBS 2517
158;kna*;Kazachstania naganishii CBS 8797
162;kla;Kluyveromyces lactis NRRL Y-1140
123;kpa*;Komagataella pastoris CBS 7435
258;lkl*;Lachancea kluyveri NRRL Y-12651
229;lth;Lachancea thermotolerans CBS 6340
190;mgr;Magnaporthe oryzae 70-15
288;mfa*;Millerozyma farinosa CBS 7064
192;mth*;Myceliophthora thermophila ATCC 42464
270;ncs;Naumovozyma castellii CBS 4309
396;ncr;Neurospora crassa OR74A
80;opa*;Ogataea parapolymorpha DL-1
192;pch*;Penicillium chrysogenum P2niaD18
275;sce;Saccharomyces cerevisiae (S288c Apr 2011)
205;sas*;Saccharomycetaceae sp. Ashbya aceri
170;pic;Scheffersomyces stipitis CBS 6054
168;spo;Schizosaccharomyces pombe 972h-
96;sre*;Sporisorium reilianum SRZ2
328;tbl;Tetrapisispora blattae CBS 6284
206;tpf;Tetrapisispora phaffii CBS 4417
154;ttt;Thielavia terrestris NRRL 8126
192;tdl;Torulaspora delbrueckii CBS 1146
111;uma;Ustilago maydis 521
156;vma*;Valsa mali 03-8
225;vda;Verticillium dahliae VdLs.17
510;yli;Yarrowia lipolytica CLIB122
272;zro;Zygosaccharomyces rouxii CBS 732

C42 décomptes[modifier | modifier le wikicode]

ani;;;;aor;;;;bfu;;;;cal;;;;cgr;;;;cjd;;;;cneg;;;;cot;;;;dha;;;;ecu;;;;ede;;;;fgr;;;;fgr5;;;;fve;;;;fvr;;;;kaf;;;;kpa;;;;kla;;;;kna;;;;lkl;;;;lth;;;;mfa;;;;mgr;;;;mth;;;;ncr;;;;ncs;;;;opa;;;;pch;;;;pic;;;;sas;;;;sce;;;;spo;;;;sre;;;;tbl;;;;tdl;;;;tpf;;;;ttt;;;;uma;;;;vda;;;;vma;;;;yli;;;;zro;;
8;2;(AAC);;10;2;(AAC);;8;8;(AAC);;6;3;(AAC);;10;1;(AAC);;9;2;(AAC);;7;6;(AAC);;4;2;(AAC);;10;2;(AAC);;1;1;(AAC);;2;2;(AAC);;19;8;(AAC);;16;6;(AAC);;2;2;(AAA);;13;2;(AAC);;13;2;(AAC);;5;2;(AAC);;7;1;(AAC);;7;1;(AAC);;14;1;(AAC);;11;2;(AAC);;12;2;(AAC);;6;6;(AAC);;7;3;(AAC);;19;1;(AAC);;13;3;(AAC);;3;1;(AAC);;9;5;(AAC);;7;3;(AAC);;7;2;(AAC);;14;2;(AAC);;9;2;(AAC);;4;4;(AAC);;18;3;(AAC);;12;2;(AAC);;10;1;(AAC);;6;3;(AAC);;4;3;(AAC);;11;9;(AAC);;7;7;(AAC);;24;3;(AAC);;12;2;(AAC)
6;6;(AAG);;10;5;(AAT);;6;5;(AAG);;2;2;(AAG);;9;1;(AAT);;4;1;(AAG);;6;4;(AAG);;1;1;(AAG);;2;2;(AAG);;1;1;(AAG);;1;1;(AAG);;13;2;(AAG);;6;1;(AAG);;7;2;(AAC);;12;5;(AAG);;2;2;(AAG);;2;2;(AAG);;7;1;(AAT);;1;1;(AAG);;12;2;(AAT);;10;1;(AAT);;4;2;(AAG);;7;6;(AAG);;7;7;(AAG);;17;15;(AAG);;2;2;(AAG);;1;1;(AAG);;6;1;(AAG);;3;1;(AAG);;9;1;(AAT);;13;1;(AAT);;5;2;(AAG);;4;4;(AAG);;17;4;(AAT);;8;1;(AAT);;10;1;(AAT);;5;4;(AAG);;4;3;(AAG);;8;2;(AAG);;5;2;(AAG);;21;12;(AAG);;11;2;(AAT)
7;5;(AAT);;1;1;(ACA);;8;8;(AAT);;6;6;(AAT);;4;1;(ACG);;6;1;(AAT);;6;5;(AAT);;4;1;(AAT);;9;1;(AAT);;1;1;(AAT);;2;2;(AAT);;13;5;(AAT);;11;5;(AAT);;6;4;(AAG);;11;7;(AAT);;13;1;(AAT);;5;1;(AAT);;3;1;(ACG);;7;1;(AAT);;5;1;(ACG);;4;2;(ACG);;12;2;(AAT);;8;8;(AAT);;8;8;(AAT);;17;17;(AAT);;12;1;(AAT);;4;1;(AAT);;10;3;(AAT);;7;1;(AAT);;4;1;(ACG);;6;2;(ACG);;8;2;(AAT);;4;4;(AAT);;4;1;(ACG);;4;1;(ACG);;3;1;(ACG);;6;6;(AAT);;4;2;(AAT);;9;1;(AAT);;7;7;(AAT);;26;12;(AAT);;5;2;(ACG)
9;3;(ACG);;12;2;(ACG);;1;1;(ACC);;2;2;(ACG);;9;1;(AGA);;6;3;(ACG);;3;3;(ACG);;2;2;(ACG);;5;2;(ACG);;1;1;(ACG);;2;2;(ACG);;10;2;(ACG);;10;2;(ACG);;11;2;(AAT);;10;2;(ACG);;4;2;(ACG);;2;2;(ACG);;6;1;(AGA);;3;2;(ACG);;11;7;(AGA);;9;1;(AGA);;4;3;(ACG);;6;6;(ACG);;7;7;(ACG);;21;2;(ACG);;5;2;(ACG);;2;2;(ACG);;10;1;(ACG);;3;1;(ACG);;7;1;(AGA);;11;2;(AGA);;8;1;(ACG);;4;4;(ACG);;16;3;(AGA);;7;1;(AGA);;8;1;(AGA);;6;6;(ACG);;4;4;(ACG);;9;5;(ACG);;1;1;(ACC);;1;1;(ACG);;12;1;(AGA)
5;1;(AGA);;7;3;(AGA);;6;5;(ACG);;4;1;(AGA);;10;1;(AGC);;7;1;(AGA);;6;5;(AGA);;2;2;(AGA);;6;1;(AGA);;1;1;(AGA);;1;1;(AGA);;11;6;(AGA);;11;6;(AGA);;13;11;(ACG);;10;4;(AGA);;11;3;(AGA);;4;1;(AGA);;7;1;(AGC);;7;1;(AGA);;13;2;(AGC);;10;1;(AGC);;10;3;(AGA);;4;4;(AGA);;5;4;(AGA);;14;2;(AGA);;12;2;(AGA);;2;1;(AGA);;7;4;(AGA);;6;1;(AGA);;7;1;(AGC);;11;1;(AGC);;7;1;(AGA);;2;2;(AGA);;19;3;(AGC);;8;1;(AGC);;9;2;(AGC);;3;1;(AGA);;3;3;(AGA);;6;3;(AGA);;6;6;(ACG);;21;4;(AGA);;12;1;(AGC)
8;1;(AGC);;10;2;(AGC);;7;1;(AGA);;6;1;(AGC);;1;1;(AGG);;6;1;(AGC);;8;8;(AGC);;3;1;(AGC);;7;1;(AGC);;1;1;(AGC);;2;2;(AGC);;14;9;(AGC);;13;9;(AGC);;7;4;(AGA);;14;13;(AGC);;12;1;(AGC);;5;1;(AGC);;1;1;(AGG);;7;3;(AGC);;1;1;(AGG);;2;1;(AGG);;12;2;(AGC);;9;9;(AGC);;7;7;(AGC);;19;13;(AGC);;12;2;(AGC);;3;1;(AGC);;8;1;(AGC);;7;1;(AGC);;1;1;(AGG);;2;1;(AGG);;6;1;(AGC);;3;3;(AGC);;1;1;(AGG);;1;1;(AGG);;1;1;(AGG);;7;7;(AGC);;5;4;(AGC);;11;9;(AGC);;5;3;(AGA);;30;2;(AGC);;3;2;(AGG)
6;5;(AGG);;9;6;(AGG);;8;1;(AGC);;1;1;(AGG);;9;1;(AGT);;6;1;(AGT);;6;6;(AGG);;1;1;(AGG);;1;1;(AGG);;1;1;(AGG);;2;2;(AGT);;10;6;(AGG);;10;6;(AGG);;13;3;(AGC);;10;9;(AGG);;1;1;(AGG);;2;1;(AGG);;6;1;(AGT);;1;1;(AGG);;12;3;(AGT);;9;2;(AGT);;2;1;(AGG);;5;4;(AGG);;6;6;(AGG);;12;4;(AGG);;1;1;(AGG);;3;1;(AGT);;12;6;(AGT);;1;1;(AGG);;7;2;(AGT);;11;1;(AGT);;6;1;(AGG);;3;3;(AGG);;15;4;(AGT);;9;2;(AGT);;9;3;(AGT);;4;4;(AGG);;4;4;(AGG);;8;4;(AGG);;7;7;(AGC);;21;6;(AGG);;10;1;(AGT)
6;2;(AGT);;10;2;(AGT);;4;4;(AGG);;4;2;(AGT);;8;5;(CAA);;7;1;(CAA);;5;5;(AGT);;4;1;(AGT);;8;2;(AGT);;1;1;(AGT);;1;1;(CAA);;11;4;(AGT);;11;4;(AGT);;4;4;(AGG);;11;7;(AGT);;11;3;(AGT);;5;2;(AGT);;7;3;(CAA);;7;1;(AGT);;11;7;(CAA);;8;7;(CAA);;10;1;(AGT);;6;5;(AGT);;6;5;(AGT);;12;3;(AGT);;11;1;(AGT);;3;1;(CAA);;3;1;(CAC);;7;1;(AGT);;7;3;(CAA);;10;5;(CAA);;7;2;(AGT);;4;4;(AGT);;9;6;(CAA);;8;5;(CAA);;2;1;(CAA);;4;4;(AGT);;4;1;(AGT);;8;2;(AGT);;1;1;(AGG);;22;1;(AGT);;10;10;(CAA)
2;2;(CAA);;1;1;(ATA);;6;4;(AGT);;6;5;(CAA);;1;1;(CAC);;3;1;(CAC);;3;3;(CAA);;1;1;(CAA);;4;1;(CAA);;1;1;(CAA);;1;1;(CAC);;3;3;(CAA);;3;3;(CAA);;7;7;(AGT);;1;1;(ATC);;2;2;(CAA);;3;3;(CAA);;2;2;(CAC);;5;3;(CAA);;3;1;(CAC);;3;1;(CAC);;14;2;(CAA);;2;2;(CAA);;2;2;(CAA);;5;5;(CAA);;9;9;(CAA);;1;1;(CAC);;3;3;(CAG);;8;1;(CAA);;4;3;(CAC);;2;1;(CAC);;4;1;(CAA);;1;1;(CAC);;1;1;(CAC);;2;1;(CAC);;1;1;(CAC);;1;1;(CAA);;1;1;(CAC);;1;1;(ATA);;4;4;(AGT);;3;3;(CAA);;4;1;(CAC)
2;2;(CAC);;3;3;(CAC);;5;5;(CAA);;1;1;(CAC);;7;2;(CAT);;1;1;(CAG);;2;2;(CAC);;1;1;(CAC);;1;1;(CAC);;1;1;(CAC);;1;1;(CAG);;3;3;(CAC);;3;3;(CAC);;1;1;(ATC);;1;1;(ATT);;1;1;(CAC);;1;1;(CAC);;6;3;(CAT);;2;2;(CAC);;10;2;(CAT);;3;3;(CAG);;4;2;(CAC);;2;2;(CAC);;3;3;(CAC);;4;4;(CAC);;2;1;(CAC);;1;1;(CAG);;11;10;(CAT);;1;1;(CAC);;1;1;(CAG);;10;2;(CAT);;1;1;(CAC);;2;2;(CAG);;11;6;(CAT);;7;2;(CAT);;8;4;(CAT);;3;3;(CAC);;2;2;(CAG);;2;2;(CAA);;3;3;(CAA);;8;5;(CAC);;9;2;(CAT)
3;3;(CAG);;4;4;(CAG);;2;2;(CAC);;1;1;(CAG);;5;5;(CCA);;7;4;(CAT);;1;1;(CAG);;1;1;(CAG);;1;1;(CAG);;1;1;(CAG);;2;2;(CAT);;5;3;(CAG);;5;3;(CAG);;1;1;(ATT);;4;4;(CAA);;9;4;(CAT);;2;2;(CAG);;4;3;(CCA);;4;2;(CAT);;5;4;(CCA);;8;4;(CAT);;2;1;(CAG);;4;4;(CAG);;4;4;(CAG);;6;6;(CAG);;9;2;(CAT);;4;2;(CAT);;1;1;(CCC);;1;1;(CAG);;10;6;(CAT);;6;1;(CCA);;1;1;(CAG);;4;4;(CAT);;7;6;(CCA);;4;1;(CCA);;4;3;(CCA);;4;4;(CAG);;4;4;(CAT);;2;2;(CAC);;2;2;(CAC);;13;7;(CAG);;6;4;(CCA)
7;5;(CAT);;8;8;(CAT);;1;1;(CAG);;4;2;(CAT);;1;1;(CCC);;4;1;(CCA);;7;6;(CAT);;4;4;(CAT);;10;9;(CAT);;2;2;(CAT);;2;2;(CCC);;6;6;(CAT);;5;5;(CAT);;4;4;(CAA);;3;3;(CAC);;6;2;(CCA);;4;3;(CAT);;1;1;(CCC);;4;4;(CCA);;2;1;(CCC);;5;3;(CCA);;10;5;(CAT);;8;6;(CAT);;8;7;(CAT);;17;8;(CAT);;7;7;(CCA);;2;2;(CCA);;2;1;(CCG);;6;5;(CAT);;5;2;(CCA);;2;2;(CCC);;7;4;(CAT);;2;2;(CCA);;1;1;(CCC);;1;1;(CCC);;1;1;(CCC);;5;5;(CAT);;2;2;(CCA);;4;4;(CAG);;4;4;(CAG);;18;7;(CAT);;2;2;(CCC)
3;1;(CCA);;4;1;(CCA);;8;5;(CAT);;2;2;(CCA);;1;1;(CCG);;1;1;(CCC);;3;3;(CCA);;1;1;(CCA);;4;1;(CCA);;1;1;(CCA);;1;1;(CCG);;4;4;(CCA);;4;4;(CCA);;3;2;(CAC);;5;4;(CAG);;1;1;(CCC);;3;2;(CCA);;1;1;(CCG);;2;1;(CCC);;1;1;(CCG);;2;2;(CCC);;6;1;(CCA);;4;1;(CCA);;4;3;(CCA);;7;2;(CCA);;2;1;(CCC);;1;1;(CCG);;2;2;(CCT);;4;1;(CCA);;2;2;(CCC);;1;1;(CCG);;3;1;(CCA);;1;1;(CCC);;1;1;(CCG);;1;1;(CCG);;1;1;(CCG);;4;3;(CCA);;1;1;(CCC);;9;5;(CAT);;8;5;(CAT);;13;8;(CCA);;1;1;(CCG)
1;1;(CCC);;1;1;(CCC);;6;2;(CCA);;1;1;(CCC);;1;1;(CCT);;1;1;(CCG);;2;2;(CCC);;1;1;(CCG);;1;1;(CCC);;1;1;(CCC);;1;1;(CCT);;1;1;(CCC);;1;1;(CCC);;2;1;(CAG);;8;6;(CAT);;1;1;(CCG);;1;1;(CCC);;1;1;(CCT);;1;1;(CCG);;1;1;(CCT);;1;1;(CCG);;2;1;(CCC);;3;3;(CCC);;2;2;(CCC);;6;6;(CCC);;2;2;(CCG);;1;1;(CCT);;2;2;(CGA);;1;1;(CCC);;2;1;(CCG);;1;1;(CCT);;1;1;(CCC);;1;1;(CCT);;1;1;(CCT);;1;1;(CCT);;1;1;(CCT);;2;2;(CCC);;1;1;(CCT);;3;3;(CCA);;3;3;(CCA);;1;1;(CCT);;2;1;(CCT)
2;2;(CCG);;3;3;(CCG);;2;2;(CCC);;1;1;(CCG);;1;1;(CGA);;1;1;(CGA);;1;1;(CCG);;1;1;(CCT);;1;1;(CCG);;1;1;(CCT);;1;1;(CGA);;1;1;(CCG);;1;1;(CCG);;15;7;(CAT);;5;5;(CCA);;1;1;(CCT);;1;1;(CCG);;1;1;(CGA);;1;1;(CCT);;1;1;(CGA);;1;1;(CCT);;2;1;(CCG);;2;2;(CCG);;2;2;(CCG);;3;2;(CCG);;1;1;(CCT);;1;1;(CGA);;2;2;(CGC);;1;1;(CCG);;1;1;(CCT);;1;1;(CGA);;1;1;(CCG);;2;2;(CGA);;2;2;(CGA);;1;1;(CGA);;1;1;(CGA);;3;2;(CCG);;3;3;(CGA);;3;3;(CCC);;2;2;(CCC);;4;3;(CGA);;2;2;(CGA)
2;2;(CCT);;2;2;(CCT);;2;2;(CCG);;1;1;(CCT);;1;1;(CGT);;1;1;(CGT);;3;3;(CCT);;1;1;(CGA);;1;1;(CCT);;1;1;(CGA);;1;1;(CGC);;3;3;(CCT);;3;3;(CCT);;4;4;(CCA);;1;1;(CCC);;1;1;(CGA);;1;1;(CCT);;1;1;(CGT);;1;1;(CGA);;1;1;(CGT);;2;2;(CGA);;2;1;(CCT);;3;3;(CCT);;2;2;(CCT);;5;4;(CCT);;1;1;(CGA);;1;1;(CGT);;1;1;(CGG);;1;1;(CCT);;3;3;(CGA);;1;1;(CGT);;1;1;(CCT);;1;1;(CGC);;1;1;(CGT);;1;1;(CGT);;1;1;(CGT);;2;2;(CCT);;1;1;(CGC);;2;2;(CCG);;2;2;(CCG);;2;1;(CGC);;2;2;(CGT)
2;2;(CGA);;3;3;(CGA);;1;1;(CCT);;1;1;(CGA);;3;1;(CTC);;9;1;(CTC);;1;1;(CGA);;1;1;(CGT);;1;1;(CGA);;1;1;(CGC);;1;1;(CGG);;2;2;(CGA);;2;2;(CGA);;8;7;(CCC);;1;1;(CCG);;1;1;(CGT);;1;1;(CGA);;2;1;(CTC);;1;1;(CGC);;3;2;(CTC);;2;2;(CGC);;2;1;(CGA);;3;3;(CGA);;3;2;(CGA);;4;3;(CGA);;2;2;(CGT);;3;2;(CTC);;2;2;(CGT);;2;2;(CGA);;2;2;(CGC);;2;1;(CTC);;1;1;(CGA);;1;1;(CGG);;1;1;(CTC);;4;2;(CTC);;1;1;(CTC);;3;3;(CGA);;1;1;(CGG);;2;2;(CCT);;3;3;(CCT);;2;2;(CGG);;4;1;(CTC)
3;1;(CGC);;4;3;(CGC);;2;2;(CGA);;1;1;(CGT);;2;1;(CTG);;2;2;(CTG);;2;2;(CGC);;1;1;(CTC);;1;1;(CGC);;1;1;(CGG);;1;1;(CGT);;2;2;(CGC);;3;3;(CGC);;2;2;(CCG);;2;2;(CCT);;2;1;(CTC);;1;1;(CGG);;1;1;(CTG);;1;1;(CGT);;1;1;(CTG);;1;1;(CGT);;2;1;(CGC);;2;2;(CGC);;3;3;(CGC);;5;5;(CGC);;1;1;(CTC);;1;1;(CTG);;10;1;(CTC);;1;1;(CGT);;2;2;(CGT);;1;1;(CTG);;1;1;(CGC);;1;1;(CGT);;1;1;(CTG);;2;1;(CTG);;1;1;(CTG);;3;3;(CGC);;1;1;(CGT);;4;3;(CGA);;3;3;(CGA);;2;2;(CGT);;3;2;(CTG)
2;2;(CGG);;2;2;(CGT);;2;2;(CGC);;1;1;(CTC);;12;1;(CTT);;8;1;(CTT);;1;1;(CGG);;1;1;(CTG);;1;1;(CGT);;1;1;(CGT);;2;2;(CTC);;2;2;(CGG);;2;2;(CGG);;6;4;(CCT);;3;3;(CGA);;1;1;(CTG);;1;1;(CGT);;9;2;(CTT);;3;1;(CTC);;14;1;(CTT);;11;3;(CTC);;2;1;(CGT);;2;2;(CGG);;3;3;(CGG);;4;4;(CGG);;1;1;(CTG);;3;1;(CTT);;5;1;(CTG);;2;1;(CTC);;8;1;(CTC);;14;1;(CTT);;1;1;(CGG);;4;4;(CTC);;15;2;(CTT);;10;3;(CTT);;9;2;(CTT);;3;3;(CGG);;5;5;(CTC);;4;2;(CGC);;2;2;(CGC);;27;16;(CTC);;14;1;(CTT)
2;2;(CGT);;11;3;(CTC);;1;1;(CGG);;1;1;(CTG);;6;1;(GAA);;8;4;(GAA);;1;1;(CGT);;3;3;(CTT);;1;1;(CTC);;1;1;(CTC);;1;1;(CTG);;3;2;(CGT);;3;2;(CGT);;3;3;(CGA);;3;2;(CGC);;12;1;(CTT);;4;1;(CTC);;5;1;(GAA);;2;2;(CTG);;8;4;(GAA);;5;1;(CTG);;8;2;(CTC);;2;2;(CGT);;3;3;(CGT);;3;3;(CGT);;14;1;(CTT);;3;1;(GAA);;9;1;(CTT);;2;2;(CTG);;4;3;(CTG);;10;5;(GAA);;1;1;(CGT);;2;2;(CTG);;12;7;(GAA);;6;4;(GAA);;9;3;(GAA);;2;2;(CGT);;3;3;(CTG);;2;2;(CGG);;1;1;(CGG);;15;15;(CTG);;8;4;(GAA)
8;3;(CTC);;7;4;(CTG);;9;9;(CTC);;2;2;(CTT);;1;1;(GAG);;1;1;(GAT);;10;10;(CTC);;2;2;(GAA);;1;1;(CTG);;1;1;(CTG);;1;1;(GAA);;19;7;(CTC);;13;5;(CTC);;5;2;(CGC);;2;2;(CGG);;9;7;(GAA);;2;2;(CTG);;1;1;(GAG);;7;1;(CTT);;1;1;(GAG);;15;2;(CTT);;4;1;(CTG);;9;9;(CTC);;8;8;(CTC);;1;1;(CTA);;10;7;(GAA);;1;1;(GCA);;5;2;(GAA);;9;3;(CTT);;9;1;(CTT);;1;1;(GAG);;6;1;(CTC);;5;5;(CTT);;6;2;(GAG);;1;1;(GAG);;1;1;(GAG);;7;6;(CTC);;5;5;(CTT);;3;3;(CGT);;2;2;(CGT);;34;24;(CTT);;1;1;(GAG)
5;4;(CTG);;11;3;(CTT);;2;2;(CTG);;5;4;(GAA);;3;1;(GCA);;3;2;(GCA);;3;1;(CTG);;2;1;(GCC);;10;4;(CTT);;1;1;(CTT);;1;1;(GAG);;7;1;(CTG);;7;1;(CTG);;2;2;(CGG);;2;2;(CGT);;5;1;(GCA);;5;2;(CTT);;3;1;(GCA);;6;5;(GAA);;5;2;(GCA);;7;7;(GAA);;10;2;(CTT);;6;6;(CTG);;5;5;(CTG);;24;12;(CTC);;4;1;(GCA);;4;1;(GCC);;1;1;(GAG);;6;2;(GAA);;7;4;(GAA);;4;1;(GCA);;2;1;(CTG);;4;4;(GAA);;23;1;(GCC);;3;1;(GCA);;4;1;(GCA);;4;4;(CTG);;3;2;(GAA);;12;2;(CTC);;9;9;(CTC);;17;11;(GAA);;1;1;(GAT)
8;1;(CTT);;7;6;(GAA);;10;9;(CTT);;2;2;(GCA);;12;1;(GCC);;11;1;(GCC);;7;2;(CTT);;1;1;(GCT);;9;4;(GAA);;1;1;(GAA);;1;1;(GCA);;16;4;(CTT);;12;4;(CTT);;4;2;(CGT);;16;12;(CTC);;17;1;(GCC);;5;1;(GAA);;7;1;(GCC);;4;3;(GCA);;15;1;(GCC);;2;1;(GAG);;10;1;(GAA);;9;7;(CTT);;9;9;(CTT);;11;10;(CTG);;13;1;(GCC);;2;1;(GCT);;3;3;(GCA);;3;1;(GCA);;1;1;(GAG);;16;1;(GCC);;9;3;(CTT);;2;2;(GCA);;6;6;(GCT);;11;1;(GCC);;13;1;(GCC);;6;6;(CTT);;2;2;(GCA);;6;3;(CTG);;4;4;(CTG);;8;1;(GCA);;4;1;(GCA)
5;3;(GAA);;1;1;(GAC);;7;5;(GAA);;5;1;(GCC);;3;2;(GCT);;3;1;(GCT);;5;5;(GAA);;3;2;(GTA);;1;1;(GAT);;1;1;(GCA);;2;2;(GCC);;11;8;(GAA);;9;7;(GAA);;12;11;(CTC);;8;2;(CTG);;4;2;(GCT);;2;1;(GCA);;2;2;(GCT);;9;2;(GCC);;4;4;(GCT);;4;2;(GCA);;4;2;(GCA);;7;5;(GAA);;5;4;(GAA);;24;4;(CTT);;4;3;(GCT);;2;2;(GTA);;11;1;(GCC);;10;1;(GCC);;1;1;(GAT);;4;2;(GCT);;5;2;(GAA);;6;5;(GCC);;9;7;(GTA);;3;1;(GCT);;3;3;(GCT);;5;5;(GAA);;6;6;(GCC);;12;1;(CTT);;9;7;(CTT);;30;1;(GCC);;17;2;(GCC)
3;2;(GCA);;4;4;(GCA);;5;5;(GCA);;2;2;(GCT);;6;1;(GTA);;6;4;(GTA);;3;3;(GCA);;5;1;(GTC);;4;1;(GCA);;1;1;(GCC);;1;1;(GCT);;5;3;(GCA);;5;3;(GCA);;6;6;(CTG);;15;5;(CTT);;9;3;(GTA);;5;2;(GCC);;5;1;(GTA);;3;1;(GCT);;1;1;(GGG);;15;2;(GCC);;16;1;(GCC);;3;3;(GCA);;1;1;(GAT);;12;4;(GAA);;9;2;(GTA);;3;1;(GTC);;4;3;(GCT);;2;2;(GCT);;3;2;(GCA);;8;2;(GTA);;3;2;(GCA);;2;2;(GTA);;19;3;(GTC);;7;4;(GTA);;6;2;(GTA);;3;2;(GCA);;2;1;(GCT);;7;5;(GAA);;4;3;(GAA);;6;6;(GCT);;5;5;(GCT)
11;1;(GCC);;15;1;(GCC);;8;8;(GCC);;4;4;(GTA);;9;1;(GTC);;8;3;(GTC);;9;5;(GCC);;1;1;(GTG);;11;1;(GCC);;1;1;(GCT);;1;1;(GTA);;14;12;(GCC);;15;13;(GCC);;11;9;(CTT);;10;9;(GAA);;13;1;(GTC);;2;2;(GCT);;8;1;(GTC);;5;4;(GTA);;7;7;(GTA);;3;3;(GCT);;6;3;(GCT);;14;14;(GCC);;3;2;(GCA);;1;1;(GAT);;14;1;(GTC);;2;1;(GTG);;5;3;(GTA);;5;4;(GTA);;11;1;(GCC);;16;2;(GTC);;8;1;(GCC);;3;3;(GTC);;7;1;(GTG);;9;1;(GTC);;12;2;(GTC);;10;3;(GCC);;3;1;(GTA);;5;4;(GCA);;3;2;(GCA);;14;10;(GTA);;7;1;(GTA)
4;4;(GCT);;6;5;(GCT);;5;5;(GCT);;6;1;(GTC);;6;2;(GTG);;6;2;(GTG);;2;2;(GCT);;3;1;(GTT);;3;2;(GCT);;1;1;(GTA);;2;2;(GTC);;8;7;(GCT);;8;7;(GCT);;15;15;(GAA);;5;4;(GCA);;6;1;(GTG);;4;4;(GTA);;4;1;(GTG);;8;2;(GTC);;13;1;(GTC);;6;5;(GTA);;10;2;(GTA);;3;3;(GCT);;11;2;(GCC);;7;2;(GCA);;8;1;(GTG);;2;1;(GTT);;9;2;(GTC);;8;1;(GTC);;4;3;(GCT);;7;1;(GTG);;3;1;(GCT);;2;2;(GTG);;11;1;(GTT);;4;1;(GTG);;5;1;(GTG);;3;3;(GCT);;5;3;(GTC);;13;1;(GCC);;9;9;(GCC);;28;25;(GTC);;14;4;(GTC)
6;5;(GTA);;13;11;(GTA);;6;5;(GTA);;3;3;(GTG);;9;3;(GTT);;7;2;(GTT);;4;4;(GTA);;3;1;(TAA);;6;3;(GTA);;1;1;(GTC);;2;2;(GTG);;8;4;(GTA);;6;3;(GTA);;4;4;(GCA);;14;3;(GCC);;10;1;(GTT);;6;1;(GTC);;6;1;(GTT);;4;1;(GTG);;6;1;(GTG);;10;1;(GTC);;14;1;(GTC);;5;5;(GTA);;5;5;(GCT);;26;2;(GCC);;10;2;(GTT);;1;1;(TAA);;11;5;(GTG);;4;1;(GTG);;5;3;(GTA);;10;1;(GTT);;4;3;(GTA);;4;4;(GTT);;12;2;(TAA);;7;2;(GTT);;9;2;(GTT);;4;4;(GTA);;1;1;(GTG);;5;3;(GCT);;3;3;(GCT);;12;5;(GTG);;6;2;(GTG)
8;6;(GTC);;13;8;(GTC);;9;6;(GTC);;3;3;(GTT);;3;1;(TAA);;1;1;(TAA);;2;2;(GTC);;1;1;(TAC);;10;2;(GTC);;1;1;(GTG);;1;1;(GTT);;14;1;(GTC);;10;1;(GTC);;11;11;(GCC);;7;6;(GCT);;14;3;(TAA);;3;1;(GTG);;3;2;(TAA);;6;1;(GTT);;9;1;(GTT);;5;3;(GTG);;8;1;(GTG);;10;5;(GTC);;6;4;(GTA);;6;6;(GCT);;7;2;(TAA);;1;1;(TAG);;6;2;(GTT);;7;2;(GTT);;11;2;(GTC);;7;1;(TAA);;8;1;(GTC);;1;1;(TAC);;2;2;(TAC);;3;1;(TAA);;9;1;(TAA);;6;6;(GTC);;4;3;(GTT);;1;1;(GGA);;5;3;(GTA);;16;9;(GTT);;9;2;(GTT)
5;2;(GTG);;8;7;(GTG);;4;4;(GTG);;5;2;(TAA);;2;2;(TAC);;2;2;(TAC);;4;4;(GTG);;1;1;(TAT);;6;2;(GTG);;2;2;(GTT);;1;1;(TAA);;7;5;(GTG);;7;5;(GTG);;4;1;(GCT);;8;7;(GTA);;2;2;(TAC);;4;1;(GTT);;1;1;(TAC);;3;1;(TAA);;3;1;(TAA);;7;1;(GTT);;12;4;(GTT);;4;1;(GTG);;10;10;(GTC);;10;6;(GTA);;2;2;(TAC);;1;1;(TAT);;2;2;(TAA);;3;1;(TAA);;6;3;(GTG);;2;1;(TAC);;4;1;(GTG);;1;1;(TAG);;2;2;(TAG);;1;1;(TAC);;2;1;(TAC);;3;3;(GTG);;1;1;(TAC);;6;6;(GTA);;6;5;(GTC);;1;1;(TAA);;4;1;(TAA)
6;6;(GTT);;8;4;(GTT);;6;5;(GTT);;1;1;(TAC);;4;1;(TAG);;3;2;(TAG);;4;4;(GTT);;1;1;(TCC);;9;2;(GTT);;1;1;(TAA);;1;1;(TAC);;9;6;(GTT);;9;5;(GTT);;6;6;(GTA);;14;1;(GTC);;2;2;(TAG);;1;1;(TAA);;2;2;(TAG);;1;1;(TAC);;1;1;(TAC);;2;1;(TAA);;4;2;(TAA);;140;13;(GTT);;4;4;(GTG);;18;8;(GTC);;3;3;(TAG);;2;2;(TCC);;1;1;(TAC);;2;2;(TAC);;8;2;(GTT);;3;2;(TAG);;6;2;(GTT);;1;1;(TAT);;2;2;(TAT);;4;4;(TAG);;2;2;(TAG);;3;3;(GTT);;2;2;(TAG);;10;6;(GTC);;6;6;(GTG);;2;1;(TAC);;2;2;(TAC)
1;1;(TAA);;3;3;(TAA);;2;2;(TAA);;1;1;(TAT);;2;2;(TAT);;1;1;(TAT);;1;1;(TAA);;2;1;(TCT);;10;2;(TAA);;1;1;(TAC);;1;1;(TAG);;2;2;(TAA);;1;1;(TAA);;7;7;(GTC);;6;5;(GTG);;2;2;(TAT);;1;1;(TAC);;1;1;(TAT);;3;2;(TAG);;3;3;(TAG);;1;1;(TAC);;2;1;(TAC);;1;1;(TAA);;6;2;(GTT);;9;6;(GTG);;2;2;(TAT);;3;1;(TCT);;2;2;(TAT);;1;1;(TAT);;3;2;(TAA);;2;2;(TAT);;2;2;(TAA);;1;1;(TCA);;3;2;(TCC);;1;1;(TAT);;2;1;(TAT);;7;7;(TAA);;1;1;(TAT);;6;1;(GTG);;5;5;(GTT);;2;2;(TAG);;5;5;(TAG)
1;1;(TAC);;2;2;(TAC);;2;2;(TAC);;2;1;(TCC);;2;1;(TCC);;1;1;(TCA);;1;1;(TAT);;2;2;(TGA);;2;2;(TAC);;1;1;(TAG);;1;1;(TAT);;2;2;(TAC);;2;2;(TAC);;7;7;(GTG);;8;5;(GTT);;4;3;(TCC);;1;1;(TAG);;2;2;(TCC);;2;2;(TAT);;1;1;(TAT);;3;3;(TAG);;4;3;(TAT);;1;1;(TAC);;1;1;(TAA);;12;3;(GTT);;3;1;(TCC);;1;1;(TGA);;1;1;(TCA);;3;2;(TCC);;3;2;(TAC);;3;1;(TCC);;2;1;(TAC);;2;2;(TCC);;13;3;(TCT);;2;1;(TCC);;2;2;(TCC);;1;1;(TAC);;2;2;(TCA);;6;6;(GTT);;1;1;(TAC);;1;1;(TAT);;1;1;(TAT)
2;2;(TAG);;1;1;(TAG);;1;1;(TAG);;5;1;(TCT);;9;1;(TCT);;4;2;(TCC);;3;2;(TCC);;2;1;(TGC);;1;1;(TAG);;1;1;(TAT);;1;1;(TCA);;2;2;(TAG);;2;2;(TAG);;12;8;(GTT);;2;2;(TAA);;11;2;(TCT);;1;1;(TAT);;7;2;(TCT);;1;1;(TCC);;2;1;(TCC);;1;1;(TAT);;6;2;(TCC);;1;1;(TAG);;2;2;(TAC);;1;1;(TAA);;10;1;(TCT);;2;1;(TGC);;5;4;(TCC);;7;2;(TCT);;4;3;(TAG);;11;1;(TCT);;1;1;(TAG);;1;1;(TCG);;4;1;(TGA);;7;2;(TCT);;8;2;(TCT);;1;1;(TAG);;2;2;(TCC);;1;1;(TAA);;3;3;(TAG);;11;10;(TCC);;5;1;(TCC)
1;1;(TAT);;2;2;(TAT);;1;1;(TAT);;3;2;(TGA);;2;1;(TGA);;7;2;(TCT);;5;1;(TCG);;3;3;(TGG);;2;2;(TAT);;1;1;(TCC);;1;1;(TCC);;3;3;(TAT);;3;3;(TAT);;1;1;(TAA);;2;2;(TAC);;4;1;(TGA);;3;3;(TCC);;2;1;(TGA);;6;2;(TCT);;12;2;(TCT);;3;1;(TCC);;10;1;(TCT);;1;1;(TAT);;1;1;(TAG);;2;2;(TAC);;4;2;(TGA);;3;2;(TGG);;2;2;(TCG);;2;1;(TGA);;1;1;(TAT);;3;1;(TGA);;1;1;(TAT);;1;1;(TCT);;5;2;(TGC);;2;1;(TGA);;2;1;(TGA);;1;1;(TAT);;3;3;(TCG);;1;1;(TAC);;1;1;(TAT);;25;11;(TCG);;8;1;(TCT)
3;3;(TCC);;4;2;(TCC);;7;4;(TCC);;2;2;(TGC);;5;1;(TGC);;3;3;(TGA);;1;1;(TCT);;2;1;(TGT);;1;1;(TCA);;1;1;(TCG);;2;2;(TCG);;1;1;(TCA);;1;1;(TCA);;3;3;(TAC);;2;2;(TAG);;5;2;(TGC);;1;1;(TCG);;3;1;(TGC);;1;1;(TGA);;2;1;(TGA);;9;3;(TCT);;4;1;(TGA);;3;3;(TCC);;1;1;(TAT);;2;2;(TAG);;5;2;(TGC);;1;1;(TGT);;1;1;(TGA);;3;1;(TGC);;1;1;(TCA);;5;1;(TGC);;3;3;(TCC);;1;1;(TGA);;13;13;(TGG);;4;1;(TGC);;3;1;(TGC);;2;2;(TCC);;1;1;(TCT);;1;1;(TAG);;3;1;(TCC);;4;1;(TCT);;3;3;(TGA)
2;2;(TCG);;2;1;(TCG);;4;3;(TCG);;4;4;(TGG);;7;2;(TGG);;3;2;(TGC);;1;1;(TGA);;2;2;(TTC);;5;3;(TCC);;1;1;(TCT);;1;1;(TGA);;6;6;(TCC);;5;5;(TCC);;2;2;(TAG);;1;1;(TAT);;10;9;(TGG);;4;2;(TCT);;7;6;(TGG);;1;1;(TGC);;4;1;(TGC);;2;1;(TGA);;8;2;(TGC);;2;2;(TCG);;1;1;(TCA);;1;1;(TAT);;10;8;(TGG);;2;1;(TTC);;2;2;(TGC);;6;4;(TGG);;2;1;(TCC);;10;7;(TGG);;1;1;(TCG);;1;1;(TGC);;3;2;(TGT);;6;2;(TGG);;7;7;(TGG);;1;1;(TCG);;1;1;(TGA);;1;1;(TCA);;2;1;(TCG);;2;2;(TGA);;9;3;(TGC)
2;1;(TCT);;2;2;(TCT);;5;5;(TCT);;2;1;(TGT);;3;1;(TGT);;7;1;(TGG);;1;1;(TGC);;3;3;(TTG);;10;3;(TCT);;1;1;(TGA);;1;1;(TGC);;9;7;(TCG);;9;7;(TCG);;2;2;(TAT);;5;2;(TCC);;3;1;(TGT);;2;1;(TGA);;2;1;(TGT);;6;4;(TGG);;10;5;(TGG);;3;3;(TGC);;8;6;(TGG);;1;1;(TCT);;4;3;(TCC);;4;2;(TCC);;3;2;(TGT);;2;1;(TTG);;3;3;(TGT);;2;1;(TGT);;7;2;(TCT);;4;2;(TGT);;2;2;(TCT);;1;1;(TGG);;16;5;(TTC);;2;1;(TGT);;2;2;(TGT);;1;1;(TCT);;1;1;(TGC);;3;3;(TCC);;1;1;(TCT);;4;1;(TGC);;10;1;(TGG)
1;1;(TGA);;1;1;(TGA);;4;3;(TGA);;6;5;(TTC);;9;1;(TTC);;3;2;(TGT);;1;1;(TGG);;4;1;(TTT);;4;3;(TGA);;1;1;(TGC);;1;1;(TGG);;3;3;(TCT);;3;3;(TCT);;9;5;(TCC);;7;6;(TCG);;15;1;(TTC);;2;1;(TGC);;8;1;(TTC);;2;2;(TGT);;2;1;(TGT);;8;7;(TGG);;4;1;(TGT);;2;2;(TGA);;1;1;(TCG);;2;2;(TCG);;13;2;(TTC);;2;2;(TTT);;1;1;(TTA);;8;1;(TTC);;3;3;(TGA);;14;2;(TTC);;2;2;(TGA);;1;1;(TGT);;10;3;(TTG);;8;1;(TTC);;11;3;(TTC);;1;1;(TGA);;1;1;(TGG);;2;2;(TCG);;1;1;(TGA);;3;1;(TGG);;2;1;(TGT)
2;2;(TGC);;3;2;(TGC);;5;5;(TGC);;5;5;(TTG);;6;1;(TTG);;5;2;(TTC);;1;1;(TGT);;81;55;1.47;;5;2;(TGC);;1;1;(TGG);;1;1;(TGT);;2;2;(TGA);;2;2;(TGA);;8;4;(TCG);;2;2;(TCT);;9;2;(TTG);;4;1;(TGG);;6;3;(TTG);;6;2;(TTC);;13;1;(TTC);;2;2;(TGT);;8;2;(TTC);;3;3;(TGC);;1;1;(TCT);;5;4;(TCT);;9;1;(TTG);;80;47;1.70;;3;3;(TTC);;5;2;(TTG);;6;5;(TGC);;9;3;(TTG);;2;1;(TGC);;2;2;(TTC);;9;3;(TTT);;6;2;(TTG);;7;2;(TTG);;2;2;(TGC);;1;1;(TGT);;3;3;(TCT);;2;2;(TGC);;3;3;(TGT);;10;2;(TTC)
2;2;(TGG);;3;3;(TGG);;8;8;(TGG);;5;2;(TTT);;3;1;(TTT);;6;1;(TTG);;3;3;(TTC);;;;;;7;5;(TGG);;1;1;(TGT);;1;1;(TTC);;4;4;(TGC);;3;3;(TGC);;2;2;(TCT);;2;2;(TGA);;8;7;(TTT);;1;1;(TGT);;4;2;(TTT);;4;1;(TTG);;10;2;(TTG);;6;2;(TTC);;8;2;(TTG);;2;2;(TGG);;3;3;(TGA);;3;3;(TGA);;8;6;(TTT);;;;;;3;3;(TTG);;3;3;(TTT);;8;5;(TGG);;7;2;(TTT);;2;2;(TGG);;3;3;(TTG);;328;118;2.78;;5;3;(TTT);;6;2;(TTT);;2;2;(TGG);;2;2;(TTC);;3;3;(TGA);;2;2;(TGG);;6;3;(TTC);;10;1;(TTG)
2;2;(TGT);;2;2;(TGT);;3;3;(TGT);;125;85;1.47;;207;57;3.63;;5;3;(TTT);;2;2;(TTG);;;;;;3;3;(TGT);;1;1;(TTC);;1;1;(TTG);;3;3;(TGG);;3;3;(TGG);;2;2;(TGA);;3;2;(TGC);;267;86;3.10;;5;2;(TTC);;162;62;2.61;;4;3;(TTT);;5;4;(TTT);;5;3;(TTG);;6;4;(TTT);;2;2;(TGT);;2;2;(TGC);;3;3;(TGC);;270;95;2.84;;;;;;1;1;(TTT);;170;66;2.58;;3;3;(TGT);;275;70;;;2;2;(TGT);;1;1;(TTT);;;;;;193;66;2.92;;206;71;2.90;;1;1;(TGT);;2;2;(TTG);;2;2;(TGC);;3;3;(TGT);;3;3;(TTG);;7;2;(TTT)
3;3;(TTC);;6;5;(TTC);;6;6;(TTC);;;;;;;;;;193;71;2.72;;1;1;(TTT);;;;;;9;2;(TTC);;1;1;(TTG);;1;1;(TTT);;4;3;(TGT);;4;3;(TGT);;9;6;(TGC);;3;3;(TGG);;;;;;3;1;(TTG);;;;;;159;74;2.15;;258;87;2.97;;4;2;(TTT);;288;80;3.60;;3;2;(TTC);;2;2;(TGG);;4;3;(TGG);;;;;;;;;;197;97;2.03;;;;;;4;2;(TTC);;;;;;4;1;(TTC);;96;95;1.01;;;;;;;;;;;;;;2;2;(TTC);;1;1;(TTT);;3;3;(TGG);;3;3;(TTC);;4;4;(TTT);;272;87;3.13
2;2;(TTG);;4;3;(TTG);;6;4;(TTG);;;;;;;;;;;;;;148;126;1.17;;;;;;7;2;(TTG);;1;1;(TTT);;55;55;1.00;;5;4;(TTC);;4;3;(TTC);;4;3;(TGG);;4;3;(TGT);;;;;;3;3;(TTT);;;;;;;;;;;;;;230;98;2.35;;;;;;2;2;(TTG);;2;2;(TGT);;3;3;(TGT);;;;;;;;;;;;;;;;;;4;1;(TTG);;;;;;4;2;(TTG);;;;;;;;;;;;;;;;;;2;2;(TTG);;109;94;1.16;;3;3;(TGT);;2;2;(TTG);;510;247;2.06;;;;
2;2;(TTT);;3;3;(TTT);;3;3;(TTT);;;;;;;;;;;;;;;;;;;;;;8;3;(TTT);;46;46;1.00;;;;;;5;5;(TTG);;5;5;(TTG);;3;3;(TGT);;5;5;(TTC);;;;;;123;67;1.84;;;;;;;;;;;;;;;;;;;;;;2;1;(TTT);;2;2;(TTC);;5;2;(TTC);;;;;;;;;;;;;;;;;;4;3;(TTT);;;;;;3;2;(TTT);;;;;;;;;;;;;;;;;;2;2;(TTT);;;;;;2;2;(TTC);;165;147;1.12;;;;;;;;
181;112;1.62;;246;143;1.72;;214;175;1.22;;;;;;;;;;;;;;;;;;;;;;219;89;2.46;;;;;;;;;;3;3;(TTT);;2;2;(TTT);;6;5;(TTC);;4;4;(TTG);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;324;175;1.85;;2;2;(TTG);;3;3;(TTG);;;;;;;;;;;;;;;;;;212;96;2.21;;;;;;168;68;2.47;;;;;;;;;;;;;;;;;;156;139;1.12;;;;;;2;2;(TTG);;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;308;182;1.69;;273;170;1.61;;4;4;(TTG);;2;2;(TTT);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;3;2;(TTT);;2;2;(TTT);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;2;2;(TTT);;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;6;6;(TTT);;287;183;1.57;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;193;165;1.17;;401;207;1.94;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;229;137;1.67;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;286;214;1.34;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;0;0;(AAA);;;;;;0;0;(AAA);;0;0;(AAA);;;;;;;;;;;;;;;;;;;;;;0;0;(AAA);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;0;0;(AAA);;;;;;;;;;;;;;;;;;;;;;0;0;(AAA);;;;;;;;;;;;;;;;;;0;0;(AAA);;;;;;;;;;;;;;;;
0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(ACA);;0;0;(AAA);;0;0;(ACA);;0;0;(ACA);;0;0;(AAA);;0;0;(AAA);;;;;;0;0;(AAA);;0;0;(AAA);;0;0;(ACA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(ACA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(ACA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(ACA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA)
0;0;(ACA);;;;;;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACC);;0;0;(ACA);;0;0;(ACC);;0;0;(ACC);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACC);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACC);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACC);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACC);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA)
0;0;(ACC);;0;0;(ACC);;;;;;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACT);;0;0;(ACC);;0;0;(ACT);;0;0;(ACT);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACT);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACT);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACT);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACT);;0;0;(ACC);;;;;;0;0;(ACC);;0;0;(ACC)
0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ATA);;0;0;(ACT);;0;0;(ATA);;0;0;(ATA);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ATA);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ATA);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ATA);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ATA);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT)
0;0;(ATA);;;;;;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATC);;0;0;(ATA);;0;0;(ATC);;0;0;(ATC);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATC);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATC);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATC);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATC);;;;;;0;0;(ATA);;0;0;(ATA);;0;0;(ATA)
0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATG);;0;0;(ATC);;0;0;(ATG);;0;0;(ATG);;0;0;(ATC);;0;0;(ATC);;;;;;;;;;0;0;(ATC);;0;0;(ATG);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATG);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATG);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATG);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC)
0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATT);;0;0;(ATG);;0;0;(ATT);;0;0;(ATT);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATT);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATT);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATT);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATT);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG)
0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(CTA);;0;0;(ATT);;0;0;(CTA);;0;0;(CTA);;0;0;(ATT);;0;0;(ATT);;;;;;;;;;0;0;(ATT);;0;0;(CTA);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(CTA);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(CTA);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(CTA);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT)
0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(GAC);;0;0;(CTA);;0;0;(GAC);;0;0;(GAC);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(GAC);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;;;;;0;0;(CTA);;0;0;(GAC);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(GAC);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(GAC);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA)
0;0;(GAC);;;;;;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAG);;0;0;(GAC);;0;0;(GAG);;;;;;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAG);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAG);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAG);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAG);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC);;0;0;(GAC)
0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;;;;;0;0;(GAG);;0;0;(GAG);;0;0;(GAT);;0;0;(GAG);;0;0;(GAT);;0;0;(GAT);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAT);;;;;;0;0;(GAG);;;;;;;;;;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;0;0;(GAT);;;;;;0;0;(GAG);;;;;;;;;;0;0;(GAG);;0;0;(GAT);;;;;;;;;;;;;;0;0;(GAG);;0;0;(GAT);;0;0;(GAG);;0;0;(GAG);;0;0;(GAG);;;;
0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;;;;;0;0;(GAT);;0;0;(GCG);;;;;;0;0;(GCG);;0;0;(GCG);;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;0;0;(GCG);;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;;;;;;;;;0;0;(GAT);;0;0;(GCG);;0;0;(GAT);;0;0;(GAT);;;;;;0;0;(GAT);;0;0;(GAT);;0;0;(GCG);;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;0;0;(GCG);;0;0;(GAT);;0;0;(GAT);;0;0;(GAT);;;;
0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GGA);;0;0;(GCG);;0;0;(GGA);;0;0;(GGA);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GGA);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GGA);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GGA);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GGA);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG)
0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGC);;0;0;(GGA);;0;0;(GGC);;0;0;(GGC);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGC);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGC);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGC);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGA);;0;0;(GGC);;;;;;0;0;(GGA);;0;0;(GGA);;0;0;(GGA)
0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGG);;0;0;(GGC);;0;0;(GGG);;0;0;(GGG);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGG);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGG);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGG);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGG);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC);;0;0;(GGC)
0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGT);;0;0;(GGG);;0;0;(GGT);;0;0;(GGT);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGT);;0;0;(GGG);;0;0;(GGG);;;;;;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGT);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGT);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGT);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG);;0;0;(GGG)
0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(TCA);;0;0;(GGT);;0;0;(TCA);;;;;;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(TCA);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(TCA);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;;;;;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;;;;;0;0;(GGT);;0;0;(GGT);;0;0;(GGT);;0;0;(GGT)
0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;;;;;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA)

B42[modifier | modifier le wikicode]

B42 liste[modifier | modifier le wikicode]

tRNAs;KEGG;Génome
75;bae;Bacillus atrophaeus 1942
91;bcef;Bacillus cereus FT9
84;bcoh*;Bacillus coagulans HM-08
39;bbd;Belliella baltica
111;blr;Brevibacillus laterosporus LMG 15441
81;cbl;Clostridium botulinum A3 Loch Maree
88;dzc;Dickeya zeae EC1
85;eclx;Enterobacter cloacae 34399
83;eno;Enterobacter cloacae subsp. cloacae ENHKU01
85;eal;Escherichia albertii KF1
87;eco;Escherichia coli K-12 MG1655
91;gmc;Geobacillus sp Y41MC1
109;hmo;Heliobacterium modesticaldum Ice1 ATCC 51547
49;hmr;Hippea maritima
78;ksk;Kitasatospora setae KM-6054
86;kpn;Klebsiella pneumoniae subsp. pneumoniae MGH 78578
81;ksa;Kosakonia sacchari SP1
73;lpl;Lactobacillus plantarum WCFS1
81;mme;Marinomonas mediterranea MMB-1
131;mvs;Moritella viscosa
109;ppoy;Paenibacillus polymyxa Sb3-1
83;pdi;Parabacteroides distasonis ATCC 8503
90;pdix;Peptoclostridium difficile 630 cultivar NCTC_13307_/strain
84;pge;Pluralibacter gergoviae FB2
106;pha;Pseudoalteromonas haloplanktis TAC125
88;pse;Pseudogulbenkiania sp NH8B
85;sbz;Salmonella bongori N268-08
79;sty;Salmonella enterica subsp. enterica serovar Typhi CT18
108;sbn;Shewanella baltica OS195
97;sfr;Shewanella frigidimarina NCIMB 400
147;spl;Shewanella pealeana ATCC 700345
61;sep;Singulisphaera acidiphila
71;saci;Staphylococcus epidermidis ATCC 12228
71;sma;Streptomyces avermitilis MA-4680
73;sho;Streptomyces hygroscopicus subsp. jinggangensis TL01
105;vag;Vibrio alginolyticus NBRC 15630 ATCC 17749
93;vau;Vibrio anguillarum NB10
121;vha;Vibrio campbellii ATCC BAA-1116 BB120
130;vpf;Vibrio parahaemolyticus O1_Kuk str.FDA_R31
112;vvm;Vibrio vulnificus MO6-24/O
70;ype;Yersinia pestis CO92 (biovar Orientalis)
82;yrb;Yersinia ruckeri Big Creek 74

B42 décomptes[modifier | modifier le wikicode]

cbl;;;;spl;;;;pdi;;;;ppoy;;;;sbn;;;;eal;;;;eco;;;;sbz;;;;eno;;;;kpn;;;;bcef;;;;bcoh;;;;blr;;;;dzc;;;;eclx;;;;gmc;;;;ksa;;;;mme;;;;mvs;;;;pge;;;;pha;;;;pse;;;;sfr;;;;vag;;;;vau;;;;vha;;;;vvm;;;;yrb;;;;bae;;;;saci;;;;sep;;;;hmr;;;;bbd;;;;lpl;;;;sty;;;;sma;;;;sho;;;;ksk;;;;ype;;;;pdix;;;;hmo;;;;vpf;;
1;1;(ACG);;2;2;(ACC);;3;3;(ACG);;4;1;(ACG);;1;1;(AAA);;3;1;(ACG);;4;1;(ACG);;4;1;(ACG);;4;1;(ACG);;4;1;(ACG);;3;2;(ACG);;3;1;(ACG);;5;2;(ACG);;3;1;(ACG);;4;2;(ACG);;4;3;(ACG);;4;1;(ACG);;3;1;(ACG);;5;2;(ACG);;4;1;(ACG);;4;1;(ACG);;3;2;(ACG);;4;2;(ACG);;6;1;(ACG);;5;3;(ACG);;7;1;(ACG);;6;2;(ACG);;3;1;(ACG);;2;1;(ACG);;1;1;(ACA);;2;2;(ACG);;2;2;(CAA);;1;1;(ACG);;1;1;(AAG);;4;2;(ACG);;1;1;(ACG);;1;1;(ACG);;2;1;(ACG);;2;2;(ACG);;1;1;(ACG);;1;1;(AAA);;7;1;(ACG)
1;1;(CAA);;7;2;(ACG);;1;1;(CAA);;3;2;(CAA);;6;1;(ACG);;1;1;(CAA);;1;1;(CAA);;1;1;(CAA);;1;1;(CAA);;1;1;(CAA);;1;1;(CAA);;1;1;(AGG);;3;2;(CAA);;1;1;(CAA);;2;2;(CAA);;1;1;(ATA);;1;1;(CAA);;2;1;(CAA);;1;1;(CAA);;1;1;(CAA);;1;1;(CAA);;1;1;(CAA);;1;1;(ATA);;1;1;(CAA);;1;1;(CAA);;1;1;(CAA);;1;1;(CAA);;1;1;(CAA);;1;1;(CAA);;1;1;(ACG);;1;1;(CAA);;1;1;(CAC);;1;1;(CAA);;2;1;(ACG);;1;1;(CAA);;1;1;(AGA);;2;2;(ATC);;1;1;(AGT);;1;1;(CAA);;1;1;(CAA);;3;1;(ACG);;2;2;(CAA)
7;5;(CAT);;2;2;(ATG);;2;1;(CAG);;3;2;(CAG);;1;1;(CAA);;4;2;(CAG);;4;3;(CAG);;4;2;(CAG);;4;3;(CAG);;4;2;(CAG);;8;6;(CAT);;2;1;(CAA);;1;1;(CAG);;8;2;(CAG);;4;3;(CAG);;1;1;(CAA);;4;4;(CAG);;11;8;(CAT);;11;3;(CAT);;4;1;(CAG);;7;3;(CAT);;2;1;(CAC);;1;1;(CAA);;7;3;(CAT);;8;4;(CAT);;10;5;(CAT);;10;4;(CAT);;4;2;(CAG);;6;3;(CAT);;2;2;(CAA);;4;3;(CAT);;1;1;(CAG);;3;3;(CAT);;1;1;(AGT);;4;2;(CAG);;1;1;(CAA);;1;1;(CAA);;1;1;(CAA);;2;2;(CAG);;10;5;(CAT);;1;1;(CAA);;11;4;(CAT)
1;1;(CCA);;1;1;(CAA);;4;3;(CAT);;7;6;(CAT);;2;2;(CAG);;9;5;(CAT);;8;5;(CAT);;6;3;(CAT);;6;3;(CAT);;7;3;(CAT);;2;2;(CCA);;1;1;(CAG);;8;5;(CAT);;6;4;(CAT);;8;4;(CAT);;1;1;(CAG);;6;3;(CAT);;1;1;(CCA);;2;1;(CCA);;7;3;(CAT);;2;1;(CCA);;3;1;(CAG);;1;1;(CAG);;2;1;(CCA);;2;1;(CCA);;2;1;(CCA);;2;1;(CCA);;7;3;(CAT);;2;2;(CCA);;1;1;(CAC);;1;1;(CCA);;3;3;(CAT);;1;1;(CCA);;1;1;(CAA);;6;3;(CAT);;4;4;(CAC);;2;1;(CAC);;2;1;(CAC);;6;3;(CAT);;1;1;(CCA);;1;1;(CAC);;2;1;(CCA)
1;1;(CCC);;13;5;(CAT);;2;2;(CCA);;1;1;(CCA);;10;6;(CAT);;1;1;(CCA);;1;1;(CCA);;1;1;(CCA);;1;1;(CCA);;1;1;(CCA);;1;1;(CCG);;6;3;(CAT);;2;2;(CCA);;1;1;(CCA);;1;1;(CCA);;6;4;(CAT);;1;1;(CCA);;1;1;(CCG);;1;1;(CCG);;1;1;(CCA);;1;1;(CCG);;4;3;(CAT);;9;5;(CAT);;1;1;(CCG);;1;1;(CCG);;1;1;(CCG);;1;1;(CCG);;1;1;(CCA);;1;1;(CCG);;2;2;(CAG);;1;1;(CCG);;1;1;(CCA);;1;1;(CCT);;1;1;(CAG);;1;1;(CCA);;1;1;(CAG);;1;1;(CAG);;1;1;(CAG);;1;1;(CCA);;3;1;(GAA);;4;3;(CAG);;1;1;(CCG)
1;1;(CCT);;2;1;(CCA);;1;1;(CCC);;1;1;(CCG);;1;1;(CCA);;1;1;(CCC);;1;1;(CCC);;1;1;(CCC);;2;2;(CCC);;1;1;(CCC);;3;2;(GAA);;1;1;(CCA);;1;1;(CCG);;1;1;(CCC);;1;1;(CCC);;1;1;(CCA);;1;1;(CCC);;1;1;(CCT);;1;1;(CCT);;1;1;(CCC);;1;1;(CCT);;1;1;(CCA);;1;1;(CCA);;1;1;(CCT);;1;1;(CCT);;1;1;(CCT);;1;1;(CCT);;1;1;(CCC);;2;2;(CCT);;6;2;(CAT);;1;1;(CGT);;1;1;(CCC);;1;1;(GAA);;5;4;(CAT);;1;1;(CCC);;6;3;(CAT);;8;5;(CAT);;5;3;(CAT);;1;1;(CCC);;1;1;(GAT);;8;4;(CAT);;1;1;(CCT)
1;1;(CTC);;1;1;(CCG);;1;1;(CCG);;1;1;(CGA);;1;1;(CCG);;1;1;(CCG);;1;1;(CCG);;1;1;(CCG);;1;1;(CCG);;1;1;(CCG);;1;1;(GAG);;1;1;(CCC);;3;2;(GAA);;1;1;(CCG);;1;1;(CCG);;1;1;(CCC);;1;1;(CCG);;2;1;(GAA);;4;1;(GAA);;1;1;(CCG);;3;2;(GAA);;1;1;(CCC);;1;1;(CCG);;4;2;(GAA);;3;2;(GAA);;4;2;(GAA);;4;2;(GAA);;1;1;(CCG);;3;2;(GAA);;1;1;(CCA);;2;2;(GAA);;1;1;(CCG);;1;1;(GAG);;2;2;(CCA);;1;1;(CCG);;1;1;(CCA);;1;1;(CCA);;1;1;(CCA);;1;1;(CCG);;2;1;(GCA);;2;2;(CCA);;4;2;(GAA)
1;1;(CTG);;1;1;(CCT);;1;1;(CCT);;1;1;(CGT);;1;1;(CCT);;1;1;(CCT);;1;1;(CCT);;2;2;(CCT);;1;1;(CCT);;1;1;(CCT);;4;1;(GAT);;1;1;(CCG);;2;2;(GAC);;1;1;(CCT);;1;1;(CCT);;1;1;(CCG);;1;1;(CCT);;1;1;(GAC);;2;2;(GAC);;1;1;(CCT);;2;2;(GAC);;1;1;(CCG);;1;1;(CCT);;2;2;(GAC);;2;2;(GAC);;2;2;(GAC);;2;2;(GAC);;1;1;(CCT);;1;1;(GAC);;1;1;(CCC);;1;1;(GAG);;1;1;(CCT);;1;1;(GAT);;1;1;(CCC);;2;2;(CCT);;1;1;(CCC);;1;1;(CCC);;2;2;(CCC);;1;1;(CCT);;2;1;(GCC);;1;1;(CCC);;2;2;(GAC)
2;2;(CTT);;4;1;(GAA);;1;1;(CGA);;1;1;(CTT);;3;1;(GAA);;1;1;(CGA);;1;1;(CGA);;1;1;(CGA);;1;1;(CGT);;1;1;(CGA);;1;1;(GCA);;1;1;(CCT);;1;1;(GAG);;1;1;(CGA);;1;1;(CGT);;1;1;(CGA);;1;1;(CGA);;1;1;(GAG);;1;1;(GAG);;1;1;(CGA);;1;1;(GAG);;1;1;(CCT);;2;1;(GAA);;2;2;(GAG);;1;1;(GAG);;2;1;(GAG);;2;1;(GAG);;1;1;(CGA);;1;1;(GAG);;1;1;(CCG);;2;1;(GAT);;1;1;(CGA);;1;1;(GCA);;1;1;(CCG);;2;2;(CGA);;1;1;(CCG);;1;1;(CCG);;1;1;(CCG);;1;1;(CTG);;2;1;(GCT);;2;2;(CCG);;2;1;(GAG)
3;1;(GAA);;2;1;(GAC);;1;1;(CGC);;3;1;(GAA);;2;1;(GAC);;1;1;(CGG);;1;1;(CGG);;1;1;(CGG);;2;2;(CTG);;1;1;(CGG);;4;2;(GCC);;1;1;(CGA);;4;2;(GAT);;1;1;(CGG);;2;2;(CTG);;1;1;(CGC);;1;1;(CGG);;3;1;(GAT);;11;1;(GAT);;1;1;(CGG);;2;1;(GAT);;1;1;(CGA);;2;1;(GAC);;7;1;(GAT);;3;1;(GAT);;5;1;(GAT);;8;1;(GAT);;1;1;(CTG);;3;2;(GAT);;1;1;(CCT);;1;1;(GCA);;1;1;(CGC);;1;1;(GCC);;1;1;(CCT);;1;1;(CGG);;2;2;(CCT);;2;2;(CCT);;1;1;(CCT);;1;1;(CTT);;1;1;(GGA);;1;1;(CCT);;3;1;(GAT)
1;1;(GAG);;1;1;(GAG);;1;1;(CGG);;1;1;(GAC);;1;1;(GAG);;1;1;(CGT);;2;2;(CGT);;1;1;(CGT);;2;1;(GAA);;1;1;(CGT);;2;1;(GCT);;1;1;(CGC);;2;2;(GCA);;1;1;(CGT);;2;1;(GAA);;1;1;(CGG);;1;1;(CGT);;2;1;(GCA);;3;1;(GCA);;1;1;(CGT);;2;1;(GCA);;1;1;(CGC);;1;1;(GAG);;4;1;(GCA);;2;2;(GCA);;5;3;(GCA);;3;2;(GCA);;1;1;(CTT);;1;1;(GCA);;2;2;(CGA);;2;1;(GCC);;1;1;(CGG);;1;1;(GCT);;1;1;(CGA);;1;1;(CGT);;4;4;(CGA);;2;2;(CGA);;1;1;(CGA);;2;1;(GAA);;3;1;(GTA);;1;1;(CGA);;4;2;(GCA)
2;2;(GAT);;3;1;(GAT);;1;1;(CGT);;2;2;(GAG);;3;1;(GAT);;2;1;(CTG);;2;1;(CTG);;2;1;(CTG);;2;2;(GAC);;2;1;(CTG);;1;1;(GGA);;1;1;(CGG);;5;1;(GCC);;2;1;(CTG);;2;2;(GAC);;1;1;(CGT);;2;2;(CTG);;4;1;(GCC);;5;1;(GCC);;3;1;(CTG);;6;2;(GCC);;2;1;(CGG);;4;2;(GAT);;9;1;(GCC);;7;2;(GCC);;10;1;(GCC);;8;1;(GCC);;2;1;(GAA);;2;1;(GCC);;3;2;(CGC);;1;1;(GCT);;1;1;(CGT);;1;1;(GGA);;1;1;(CGC);;1;1;(CTG);;1;1;(CGC);;1;1;(CGC);;1;1;(CGC);;2;2;(GAC);;4;2;(GTC);;1;1;(CGC);;11;1;(GCC)
2;2;(GCA);;4;1;(GCA);;1;1;(CTC);;3;2;(GAT);;2;1;(GCA);;2;1;(GAA);;2;1;(GAA);;2;1;(GAA);;1;1;(GAG);;2;1;(GAA);;1;1;(GGT);;1;1;(CGT);;2;1;(GCT);;1;1;(CTT);;1;1;(GAG);;2;1;(GAA);;2;1;(GAA);;1;1;(GCT);;2;1;(GCT);;1;1;(CTT);;2;1;(GCT);;1;1;(CGT);;2;2;(GCA);;2;1;(GCT);;2;1;(GCT);;2;1;(GCT);;2;1;(GCT);;3;1;(GAC);;2;1;(GCT);;1;1;(CGT);;1;1;(GGA);;1;1;(CTC);;1;1;(GGC);;1;1;(CGG);;2;1;(GAA);;1;1;(CGG);;1;1;(CGG);;1;1;(CGG);;1;1;(GAG);;2;1;(GTG);;2;2;(CGG);;2;1;(GCT)
3;1;(GCC);;8;1;(GCC);;2;1;(CTG);;2;2;(GCA);;6;1;(GCC);;2;2;(GAC);;2;2;(GAC);;2;2;(GAC);;3;1;(GAT);;3;3;(GAC);;3;1;(GTA);;1;1;(CTT);;2;2;(GGA);;2;1;(GAA);;3;1;(GAT);;1;1;(GAC);;2;2;(GAC);;1;1;(GGA);;1;1;(GGA);;2;2;(GAA);;1;1;(GGA);;1;1;(CTT);;5;2;(GCC);;1;1;(GGA);;1;1;(GGA);;1;1;(GGA);;1;1;(GGA);;1;1;(GAG);;1;1;(GGA);;1;1;(CTC);;2;1;(GTA);;1;1;(CTG);;1;1;(GGG);;1;1;(CGT);;2;2;(GAC);;1;1;(CGT);;1;1;(CGT);;2;2;(CGT);;3;1;(GAT);;4;2;(GTT);;1;1;(CGT);;1;1;(GGA)
2;1;(GCT);;3;1;(GCT);;2;2;(CTT);;5;2;(GCC);;2;1;(GCT);;1;1;(GAG);;1;1;(GAG);;1;1;(GAG);;1;1;(GCA);;1;1;(GAG);;6;1;(GTC);;3;3;(GAA);;1;1;(GGC);;2;2;(GAC);;1;1;(GCA);;1;1;(GAG);;1;1;(GAG);;1;1;(GGC);;1;1;(GGC);;3;3;(GAC);;1;1;(GGC);;2;1;(GAA);;2;1;(GCT);;1;1;(GGC);;1;1;(GGC);;1;1;(GGC);;1;1;(GGG);;3;1;(GAT);;1;1;(GGC);;1;1;(CTG);;3;3;(GTC);;1;1;(CTT);;1;1;(GGT);;2;2;(CTA);;1;1;(GAG);;3;1;(CTC);;3;2;(CTC);;3;1;(CTC);;1;1;(GCA);;5;2;(TAA);;3;2;(GAA);;1;1;(GGC)
1;1;(GGA);;1;1;(GGA);;2;2;(GAA);;3;2;(GCT);;1;1;(GGA);;3;1;(GAT);;3;1;(GAT);;3;1;(GAT);;4;1;(GCC);;3;1;(GAT);;1;1;(GTG);;1;1;(GAC);;1;1;(GGG);;1;1;(GAG);;4;1;(GCC);;4;3;(GAT);;3;1;(GAT);;1;1;(GGG);;1;1;(GGT);;1;1;(GAG);;1;1;(GGG);;1;1;(GAC);;1;1;(GGA);;2;2;(GGT);;1;1;(GGG);;2;2;(GGT);;2;2;(GGT);;1;1;(GCA);;1;1;(GGT);;1;1;(CTT);;2;2;(GTG);;1;1;(GAA);;1;1;(GTA);;1;1;(CTC);;3;1;(GAT);;2;2;(CTG);;2;2;(CTG);;2;2;(CTG);;2;1;(GCC);;6;4;(TAC);;4;1;(GAC);;2;2;(GGT)
1;1;(GGT);;2;1;(GGC);;1;1;(GAC);;3;1;(GGA);;2;1;(GGC);;1;1;(GCA);;1;1;(GCA);;1;1;(GCA);;1;1;(GCT);;1;1;(GCA);;5;2;(GTT);;1;1;(GAG);;2;2;(GGT);;3;1;(GAT);;1;1;(GCT);;2;2;(GCA);;1;1;(GCA);;1;1;(GGT);;5;1;(GTA);;3;1;(GAT);;1;1;(GGT);;1;1;(GAG);;2;2;(GGC);;3;1;(GTA);;2;2;(GGT);;5;1;(GTA);;4;1;(GTA);;4;1;(GCC);;2;1;(GTA);;1;1;(GAA);;3;2;(GTT);;1;1;(GAC);;3;2;(GTC);;1;1;(CTG);;1;1;(GCA);;3;1;(CTT);;3;1;(CTT);;4;1;(CTT);;1;1;(GCT);;3;2;(TAG);;2;1;(GAG);;7;2;(GTA)
2;1;(GTA);;1;1;(GGG);;1;1;(GAG);;1;1;(GGC);;1;1;(GGG);;3;1;(GCC);;4;1;(GCC);;4;1;(GCC);;2;1;(GGA);;4;1;(GCC);;2;1;(TAA);;3;2;(GAT);;4;1;(GTA);;1;1;(GCA);;2;1;(GGA);;5;3;(GCC);;4;1;(GCC);;2;1;(GTA);;5;1;(GTC);;1;1;(GCA);;3;1;(GTA);;8;1;(GAT);;1;1;(GGG);;6;1;(GTC);;5;1;(GTA);;6;1;(GTC);;7;1;(GTC);;1;1;(GCT);;4;1;(GTC);;3;2;(GAC);;2;1;(TAA);;1;1;(GAG);;1;1;(GTG);;1;1;(CTT);;3;1;(GCC);;1;1;(GAA);;1;1;(GAA);;1;1;(GAA);;2;2;(GGA);;1;1;(TCA);;4;1;(GAT);;7;1;(GTC)
4;2;(GTC);;1;1;(GGT);;7;1;(GAT);;1;1;(GGG);;2;2;(GGT);;1;1;(GCT);;1;1;(GCT);;1;1;(GCT);;2;1;(GGC);;1;1;(GCT);;5;1;(TAC);;1;1;(GCA);;6;2;(GTC);;4;1;(GCC);;2;2;(GGC);;2;2;(GCT);;1;1;(GCT);;7;2;(GTC);;4;3;(GTG);;4;1;(GCC);;11;1;(GTC);;1;1;(GCA);;1;1;(GGT);;2;2;(GTG);;5;1;(GTC);;2;1;(GTG);;2;1;(GTG);;2;2;(GGA);;2;1;(GTG);;2;2;(GAG);;3;2;(TAC);;2;1;(GAT);;1;1;(GTT);;2;1;(GAA);;1;1;(GCT);;3;3;(GAC);;3;2;(GAC);;4;3;(GAC);;2;1;(GGC);;5;1;(TCC);;3;3;(GCA);;2;1;(GTG)
2;1;(GTG);;6;1;(GTA);;2;2;(GCA);;1;1;(GGT);;4;1;(GTA);;2;1;(GGA);;2;1;(GGA);;2;1;(GGA);;1;1;(GGG);;2;1;(GGA);;2;1;(TAG);;4;1;(GCC);;3;2;(GTG);;1;1;(GCT);;1;1;(GGG);;1;1;(GGA);;2;2;(GGA);;1;1;(GTG);;6;1;(GTT);;1;1;(GCT);;2;2;(GTG);;2;1;(GCC);;4;1;(GTA);;5;1;(GTT);;2;1;(GTG);;5;3;(GTT);;5;1;(GTT);;2;1;(GGC);;4;2;(GTT);;2;2;(GAT);;1;1;(TAG);;1;1;(GCA);;1;1;(TAA);;3;1;(GAT);;2;1;(GGA);;2;1;(GAG);;2;2;(GAG);;2;1;(GAG);;1;1;(GGG);;4;2;(TCT);;7;5;(GCC);;5;3;(GTT)
3;2;(GTT);;6;1;(GTC);;3;1;(GCC);;4;1;(GTA);;4;1;(GTC);;2;1;(GGC);;2;1;(GGC);;2;1;(GGC);;2;1;(GGT);;2;1;(GGC);;4;2;(TCC);;2;2;(GCT);;5;2;(GTT);;2;1;(GGA);;2;1;(GGT);;1;1;(GGC);;2;1;(GGC);;2;1;(GTT);;5;2;(TAA);;2;1;(GGA);;4;1;(GTT);;1;1;(GCT);;4;2;(GTC);;3;2;(TAA);;4;1;(GTT);;3;1;(TAA);;2;2;(TAA);;2;2;(GGG);;2;2;(TAA);;2;2;(GCA);;5;4;(TCC);;1;1;(GCC);;2;1;(TAC);;1;1;(GCA);;2;1;(GGC);;1;1;(GAT);;1;1;(GAT);;1;1;(GAT);;2;2;(GGT);;3;1;(TGA);;2;1;(GCT);;3;2;(TAA)
2;1;(TAA);;2;1;(GTG);;1;1;(GCT);;5;1;(GTC);;2;1;(GTG);;1;1;(GGG);;1;1;(GGG);;1;1;(GGG);;3;2;(GTA);;1;1;(GGG);;3;3;(TGA);;1;1;(GGA);;2;2;(TAA);;6;1;(GGC);;3;3;(GTA);;1;1;(GGT);;1;1;(GGG);;2;1;(TAA);;7;1;(TAC);;2;1;(GGC);;3;1;(TAA);;1;1;(GGA);;2;1;(GTG);;2;1;(TAC);;2;1;(TAA);;4;1;(TAC);;1;1;(TAC);;2;2;(GGT);;3;1;(TAC);;2;2;(GCC);;1;1;(TCT);;1;1;(GCG);;1;1;(TAG);;2;1;(GCC);;1;1;(GGG);;2;2;(GCA);;2;2;(GCA);;4;4;(GCA);;2;1;(GTA);;5;1;(TGC);;2;2;(GGA);;4;1;(TAC)
5;1;(TAC);;7;1;(GTT);;2;1;(GGA);;2;1;(GTG);;5;1;(GTT);;2;2;(GGT);;2;2;(GGT);;2;2;(GGT);;3;1;(GTC);;2;1;(GGT);;5;2;(TGC);;1;1;(GGC);;5;1;(TAC);;1;1;(GGG);;3;1;(GTC);;2;1;(GTA);;2;1;(GGT);;6;1;(TAC);;5;1;(TAG);;1;1;(GGG);;7;2;(TAC);;3;2;(GGC);;5;3;(GTT);;3;2;(TAG);;2;1;(TAC);;5;2;(TAG);;7;3;(TAG);;3;1;(GTA);;2;1;(TAG);;1;1;(GCG);;3;2;(TGA);;1;1;(GCT);;1;1;(TCC);;1;1;(GCT);;2;2;(GGT);;3;2;(GCC);;3;1;(GCC);;4;2;(GCC);;3;2;(GTC);;3;1;(TGG);;5;1;(GGC);;11;3;(TAG)
2;1;(TAG);;4;1;(TAA);;1;1;(GGC);;6;1;(GTT);;3;1;(TAA);;3;2;(GTA);;3;2;(GTA);;3;2;(GTA);;1;1;(GTG);;3;1;(GTA);;3;2;(TGG);;1;1;(GGT);;4;1;(TAG);;2;2;(GGT);;1;1;(GTG);;4;3;(GTC);;3;2;(GTA);;2;1;(TAG);;4;3;(TCC);;2;1;(GGT);;4;2;(TAG);;1;1;(GGG);;3;2;(TAA);;2;1;(TCC);;4;3;(TAG);;4;2;(TCC);;2;1;(TCC);;3;2;(GTC);;3;2;(TCC);;2;2;(GCT);;3;1;(TGC);;1;1;(GGA);;1;1;(TCG);;1;1;(GGA);;2;2;(GTA);;2;2;(GCT);;1;1;(GCT);;1;1;(GCT);;1;1;(GTG);;5;1;(TGT);;3;2;(GGG);;2;1;(TCC)
1;1;(TCA);;11;1;(TAC);;1;1;(GGG);;1;1;(TAA);;4;1;(TAC);;3;1;(GTC);;3;1;(GTC);;3;1;(GTC);;4;1;(GTT);;3;1;(GTC);;3;2;(TGT);;2;2;(GTA);;4;1;(TCC);;2;1;(GTA);;5;2;(GTT);;2;1;(GTG);;3;1;(GTC);;1;1;(TCC);;1;1;(TCT);;3;2;(GTA);;1;1;(TCC);;2;2;(GGT);;6;2;(TAC);;1;1;(TCT);;2;1;(TCC);;1;1;(TCT);;2;2;(TCT);;1;1;(GTG);;1;1;(TCT);;2;2;(GGA);;2;2;(TGG);;1;1;(GGC);;1;1;(TCT);;1;1;(GGT);;3;1;(GTC);;1;1;(GGA);;1;1;(GGA);;1;1;(GGA);;3;1;(GTT);;5;1;(TTC);;3;2;(GGT);;1;1;(TCT)
4;1;(TCC);;5;1;(TAG);;1;1;(GGT);;6;2;(TAC);;2;2;(TAG);;1;1;(GTG);;1;1;(GTG);;1;1;(GTG);;1;1;(TAA);;1;1;(GTG);;7;2;(TTC);;4;4;(GTC);;2;1;(TCT);;3;1;(GTC);;1;1;(TAA);;4;3;(GTT);;1;1;(GTG);;1;1;(TCT);;8;2;(TGA);;3;1;(GTC);;1;1;(TCT);;2;1;(GTA);;2;2;(TAG);;4;1;(TGA);;2;2;(TCT);;4;1;(TGA);;3;1;(TGA);;3;1;(GTT);;2;2;(TGA);;1;1;(GGC);;3;2;(TGT);;1;1;(GGG);;1;1;(TGA);;2;1;(GTA);;1;1;(GTG);;2;1;(GGC);;2;1;(GGC);;4;2;(GGC);;1;1;(TAA);;3;1;(TTG);;4;2;(GTA);;4;1;(TGA)
1;1;(TCG);;1;1;(TCA);;3;1;(GTA);;2;1;(TAG);;1;1;(TCA);;4;1;(GTT);;4;1;(GTT);;4;1;(GTT);;4;2;(TAC);;4;1;(GTT);;5;2;(TTG);;2;2;(GTG);;3;1;(TGA);;1;1;(GTG);;4;2;(TAC);;2;1;(TAA);;4;1;(GTT);;1;1;(TGA);;11;1;(TGC);;1;1;(GTG);;4;2;(TGA);;7;2;(GTC);;1;1;(TCC);;8;1;(TGC);;3;1;(TGA);;7;2;(TGC);;9;3;(TGC);;1;1;(TAA);;3;2;(TGC);;2;1;(GGG);;3;3;(TTC);;1;1;(GGT);;1;1;(TGC);;3;1;(GTC);;5;2;(GTT);;3;1;(GGG);;3;1;(GGG);;1;1;(GGG);;3;1;(TAC);;5;1;(TTT);;4;2;(GTC);;5;1;(TGC)
3;1;(TCT);;1;1;(TCC);;3;2;(GTC);;4;2;(TCC);;1;1;(TCC);;1;1;(TAA);;1;1;(TAA);;1;1;(TAA);;1;1;(TAG);;1;1;(TAA);;6;2;(TTT);;4;2;(GTT);;4;2;(TGC);;3;1;(GTT);;1;1;(TAG);;4;2;(TAC);;1;1;(TAA);;3;1;(TGC);;4;1;(TGG);;4;1;(GTT);;3;1;(TGC);;2;1;(GTG);;1;1;(TCT);;3;1;(TGG);;4;2;(TGC);;3;1;(TGG);;3;1;(TGG);;3;1;(TAC);;1;1;(TGG);;1;1;(GGT);;2;2;(TTG);;1;1;(GTA);;2;2;(TGG);;2;1;(GTG);;1;1;(TAA);;2;2;(GGT);;2;2;(GGT);;2;1;(GGT);;1;1;(TAG);;90;39;2.31;;2;2;(GTG);;3;1;(TGG)
2;1;(TGA);;1;1;(TCT);;2;1;(GTG);;2;1;(TCT);;1;1;(TCT);;4;3;(TAC);;5;1;(TAC);;4;1;(TAC);;1;1;(TCA);;5;1;(TAC);;92;47;1.96;;2;2;(TAA);;4;2;(TGG);;1;1;(TAA);;1;1;(TCA);;2;2;(TAG);;4;1;(TAC);;2;1;(TGG);;4;1;(TGT);;1;1;(TAA);;3;1;(TGG);;3;1;(GTT);;3;1;(TGA);;5;1;(TGT);;3;1;(TGG);;5;1;(TGT);;4;1;(TGT);;1;1;(TAG);;3;3;(TGT);;1;1;(GTA);;3;2;(TTT);;1;1;(GTC);;1;1;(TGT);;5;3;(GTT);;3;2;(TAC);;1;1;(GTA);;1;1;(GTA);;1;1;(GTA);;1;1;(TCA);;;;;;4;1;(GTT);;5;1;(TGT)
3;1;(TGC);;4;2;(TGA);;3;2;(GTT);;1;1;(TGA);;4;2;(TGA);;1;1;(TAG);;1;1;(TAG);;1;1;(TAG);;1;1;(TCC);;1;1;(TAG);;;;;;4;3;(TAC);;6;1;(TGT);;8;1;(TAC);;1;1;(TCC);;3;2;(TCC);;1;1;(TAG);;4;2;(TGT);;4;1;(TTG);;4;1;(TAC);;3;1;(TGT);;1;1;(TAA);;3;1;(TGC);;3;1;(TTC);;4;2;(TGT);;5;1;(TTC);;1;1;(TTC);;1;1;(TCA);;6;2;(TTC);;2;1;(GTC);;61;48;1.27;;1;1;(GTG);;2;1;(TTC);;2;1;(TAA);;1;1;(TAG);;2;1;(GTC);;2;1;(GTC);;2;1;(GTC);;1;1;(TCC);;;;;;1;1;(TAA);;6;1;(TTC)
3;1;(TGG);;3;1;(TGC);;1;1;(TAA);;5;3;(TGC);;3;1;(TGC);;1;1;(TCA);;1;1;(TCA);;1;1;(TCA);;1;1;(TCT);;1;1;(TCA);;;;;;2;2;(TAG);;6;1;(TTC);;1;1;(TAG);;1;1;(TCT);;2;1;(TCT);;1;1;(TCA);;3;1;(TTC);;7;1;(TTT);;1;1;(TAG);;7;2;(TTC);;5;2;(TAC);;4;1;(TGG);;1;1;(TTG);;4;1;(TTC);;2;2;(TTG);;5;1;(TTG);;1;1;(TCC);;4;3;(TTG);;2;2;(GTG);;;;;;1;1;(GTT);;1;1;(TTG);;3;1;(TAC);;1;1;(TCA);;1;1;(GTG);;1;1;(GTG);;1;1;(GTG);;1;1;(TCT);;;;;;2;1;(TAC);;6;2;(TTG)
4;3;(TGT);;3;1;(TGG);;3;1;(TAC);;4;2;(TGG);;3;1;(TGG);;2;1;(TCC);;1;1;(TCC);;1;1;(TCC);;2;2;(TGA);;1;1;(TCC);;;;;;2;1;(TCC);;4;2;(TTG);;1;1;(TCC);;2;1;(TGA);;2;1;(TGA);;1;1;(TCC);;3;1;(TTG);;132;41;3.22;;1;1;(TCA);;4;1;(TTG);;1;1;(TAG);;2;1;(TGT);;2;1;(TTT);;2;2;(TTG);;4;1;(TTT);;1;1;(TTT);;1;1;(TCT);;3;1;(TTT);;2;1;(GTT);;;;;;1;1;(TAA);;2;1;(TTT);;1;1;(TAG);;1;1;(TCC);;2;1;(GTT);;2;1;(GTT);;2;2;(GTT);;2;2;(TGA);;;;;;1;1;(TAG);;4;1;(TTT)
3;2;(TTC);;4;1;(TGT);;1;1;(TAG);;4;2;(TGT);;3;1;(TGT);;2;2;(TCT);;1;1;(TCT);;2;2;(TCT);;3;1;(TGC);;1;1;(TCT);;;;;;1;1;(TCT);;6;1;(TTT);;1;1;(TCG);;3;1;(TGC);;5;2;(TGC);;1;1;(TCT);;4;1;(TTT);;;;;;1;1;(TCC);;8;2;(TTT);;1;1;(TCA);;6;1;(TTC);;105;41;2.56;;2;1;(TTT);;121;47;2.57;;112;46;2.43;;2;2;(TGA);;75;48;1.56;;1;1;(TAA);;;;;;1;1;(TAC);;40;36;1.11;;3;2;(TCC);;2;2;(TCT);;1;1;(TAA);;1;1;(TAA);;1;1;(TAA);;3;1;(TGC);;;;;;1;1;(TCA);;131;47;2.79
2;1;(TTG);;13;1;(TTC);;2;1;(TCC);;6;1;(TTC);;7;1;(TTC);;1;1;(TGA);;1;1;(TGA);;2;2;(TGA);;2;1;(TGG);;1;1;(TGA);;;;;;2;2;(TGA);;113;53;2.13;;1;1;(TCT);;2;1;(TGG);;3;1;(TGG);;1;1;(TGA);;81;42;1.93;;;;;;1;1;(TCT);;106;44;2.41;;1;1;(TCC);;3;1;(TTG);;;;;;93;49;1.90;;;;;;;;;;3;1;(TGC);;;;;;1;1;(TAC);;;;;;1;1;(TAG);;;;;;1;1;(TCT);;1;1;(TGA);;1;1;(TAC);;1;1;(TAC);;1;1;(TAC);;2;1;(TGG);;;;;;1;1;(TCC);;;;
4;1;(TTT);;5;1;(TTG);;1;1;(TCT);;4;1;(TTG);;3;2;(TTG);;3;1;(TGC);;3;1;(TGC);;3;1;(TGC);;1;1;(TGT);;3;1;(TGC);;;;;;4;2;(TGC);;;;;;1;1;(TGA);;1;1;(TGT);;3;2;(TGT);;3;1;(TGC);;;;;;;;;;1;1;(TGA);;;;;;1;1;(TCT);;6;1;(TTT);;;;;;;;;;;;;;;;;;2;1;(TGG);;;;;;1;1;(TAG);;;;;;1;1;(TCC);;;;;;1;1;(TGA);;3;1;(TGC);;1;1;(TAG);;1;1;(TAG);;1;1;(TAG);;2;1;(TGT);;;;;;1;1;(TCT);;;;
81;47;1.72;;12;1;(TTT);;2;2;(TGA);;6;2;(TTT);;10;4;(TTT);;1;1;(TGG);;1;1;(TGG);;1;1;(TGG);;4;1;(TTC);;1;1;(TGG);;;;;;2;2;(TGG);;;;;;3;1;(TGC);;4;1;(TTC);;5;1;(TTC);;1;1;(TGG);;;;;;;;;;3;1;(TGC);;;;;;1;1;(TGA);;97;50;1.94;;;;;;;;;;;;;;;;;;2;1;(TGT);;;;;;1;1;(TCC);;;;;;1;1;(TCG);;;;;;2;1;(TGC);;1;1;(TGG);;3;3;(TCC);;1;1;(TCA);;1;1;(TCC);;3;1;(TTC);;;;;;1;1;(TGA);;;;
;;;;147;44;3.34;;7;2;(TGC);;109;55;1.98;;108;49;2.20;;2;1;(TGT);;1;1;(TGT);;1;1;(TGT);;2;1;(TTG);;1;1;(TGT);;;;;;2;2;(TGT);;;;;;1;1;(TGG);;2;1;(TTG);;4;3;(TTG);;1;1;(TGT);;;;;;;;;;1;1;(TGG);;;;;;8;1;(TGC);;;;;;;;;;;;;;;;;;;;;;4;1;(TTC);;;;;;2;2;(TCG);;;;;;1;1;(TCT);;;;;;2;1;(TGG);;1;1;(TGT);;1;1;(TCT);;2;2;(TCC);;3;1;(TCG);;1;1;(TTG);;;;;;2;1;(TGC);;;;
;;;;;;;;1;1;(TGG);;;;;;;;;;4;2;(TTC);;4;1;(TTC);;4;1;(TTC);;5;1;(TTT);;4;1;(TTC);;;;;;4;2;(TTC);;;;;;1;1;(TGT);;5;1;(TTT);;4;2;(TTT);;4;1;(TTC);;;;;;;;;;1;1;(TGT);;;;;;1;1;(TGG);;;;;;;;;;;;;;;;;;;;;;2;1;(TTG);;;;;;1;1;(TCT);;;;;;1;1;(TGA);;;;;;1;1;(TGT);;4;1;(TTC);;2;2;(TGA);;1;1;(TCT);;1;1;(TCT);;4;2;(TTT);;;;;;1;1;(TGG);;;;
;;;;;;;;3;1;(TGT);;;;;;;;;;2;1;(TTG);;2;1;(TTG);;2;1;(TTG);;83;48;1.73;;2;1;(TTG);;;;;;3;3;(TTG);;;;;;4;1;(TTC);;86;52;1.65;;91;61;1.49;;2;1;(TTG);;;;;;;;;;4;2;(TTC);;;;;;1;1;(TGT);;;;;;;;;;;;;;;;;;;;;;5;1;(TTT);;;;;;1;1;(TGA);;;;;;2;1;(TGC);;;;;;2;1;(TTC);;2;1;(TTG);;1;1;(TGC);;1;1;(TGA);;1;1;(TGA);;70;48;1.46;;;;;;2;2;(TGT);;;;
;;;;;;;;2;2;(TTC);;;;;;;;;;4;1;(TTT);;6;1;(TTT);;5;1;(TTT);;;;;;6;1;(TTT);;;;;;4;2;(TTT);;;;;;1;1;(TTG);;;;;;;;;;5;1;(TTT);;;;;;;;;;1;1;(TTG);;;;;;5;4;(TTC);;;;;;;;;;;;;;;;;;;;;;83;47;1.77;;;;;;2;2;(TGC);;;;;;1;1;(TGG);;;;;;2;2;(TTG);;4;2;(TTT);;1;1;(TGG);;1;1;(TGC);;1;1;(TGC);;;;;;;;;;6;2;(TTC);;;;
;;;;;;;;1;1;(TTG);;;;;;;;;;85;52;1.63;;87;50;1.74;;85;49;1.73;;;;;;86;45;1.91;;;;;;84;64;1.31;;;;;;3;1;(TTT);;;;;;;;;;82;49;1.67;;;;;;;;;;5;1;(TTT);;;;;;1;1;(TTG);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;1;1;(TGG);;;;;;1;1;(TGT);;;;;;2;1;(TTT);;81;53;1.53;;1;1;(TGT);;1;1;(TGG);;1;1;(TGG);;;;;;;;;;4;1;(TTG);;;;
;;;;;;;;2;2;(TTT);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;89;47;1.89;;;;;;;;;;;;;;;;;;;;;;85;48;1.77;;;;;;2;1;(TTT);;;;;;;;;;;;;;;;;;;;;;;;;;;;;;1;1;(TGT);;;;;;1;1;(TTC);;;;;;70;50;1.40;;;;;;1;1;(TTC);;1;1;(TGT);;1;1;(TGT);;;;;;;;;;5;1;(TTT);;;;
;;;;;;;;83;56;1.48;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;89;52;1.71;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;2;1;(TTC);;;;;;1;1;(TTG);;;;;;;;;;;;;;1;1;(TTG);;1;1;(TTC);;1;1;(TTC);;;;;;;;;;109;65;1.68;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;3;3;(TTG);;;;;;1;1;(TTT);;;;;;;;;;;;;;1;1;(TTT);;1;1;(TTG);;1;1;(TTG);;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;71;61;1.16;;;;;;49;47;1.04;;;;;;;;;;;;;;77;63;1.22;;1;1;(TTT);;1;1;(TTT);;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;74;59;1.25;;77;58;1.33;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;;;;;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;;;;;0;0;(AAA)
0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC)
0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;;;;;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG)
0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT)
0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA)
0;0;(ACC);;;;;;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC)
0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT)
0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;;;;;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA)
0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC)
0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG)
0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;;;;;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;;;;;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT)
0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA)
0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;;;;;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC)
0;0;(ATG);;;;;;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG)
0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT)
0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;;;;;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA)
0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG);;0;0;(GCG)
0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA)

B42 Les introns[modifier | modifier le wikicode]

Génome;KEGG;tRNA;total;aaa;aac;aag;aat;aca;acc;acg;act;aga;agc;agg;agt;ata;atc;atg;att;caa;cac;cag;cat;cca;ccc;ccg;cct;cga;cgc;cgg;cgt;cta;ctc;ctg;ctt;gaa;gac;gag;gat;gca;gcc;gcg;gct;gga;ggc;ggg;ggt;gta;gtc;gtg;gtt;taa;tac;tag;tat;tca;tcc;tcg;tct;tga;tgc;tgg;tgt;tta;ttc;ttg;ttt
Aspergillus nidulans FGSC A4;ani;181;93;2;6;0;0;2;0;2;1;0;4;2;0;1;0;3;4;2;0;5;0;2;0;1;6;2;0;2;0;2;0;3;6;2;8;1;0;0;0;0;0;2;0;1;0;0;0;1;0;0;6;0;0;1;0;2;0;0;3;0;0;1;5;2;0
Aspergillus oryzae RIB40;aor;242;114;3;0;11;0;2;0;2;0;2;6;2;0;2;0;4;0;4;7;0;0;3;0;0;9;0;0;1;0;1;0;4;0;3;13;0;0;0;0;1;0;0;0;0;0;1;1;3;0;0;13;0;0;1;0;3;0;0;4;0;1;0;7;0;0
Botrytis cinerea B05.10;bfu;212;161;1;6;8;0;2;0;0;3;5;5;0;0;1;0;4;8;0;4;0;0;8;0;1;4;4;0;0;4;1;0;1;6;6;9;9;0;5;0;2;0;0;8;2;0;2;0;2;8;0;6;0;0;4;0;2;0;0;5;1;0;2;7;5;0
Candida albicans WO-1;cal;125;67;1;3;2;0;0;0;1;0;0;2;1;0;1;0;0;6;5;3;0;0;4;0;0;1;0;0;1;2;0;0;0;2;6;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;4;0;0;0;0;1;0;0;2;2;0;5;5;6;0
Candida glabrata CBS 138;cgr;207;45;3;0;0;0;0;0;0;0;0;3;0;0;2;0;0;0;0;0;0;0;7;0;0;0;0;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;6;0;0;0;0;1;0;0;0;5;0;0;6;8;0
Candida orthopsilosis Co 90-125;cot;82;35;0;0;3;0;0;0;1;0;0;1;0;0;1;0;2;0;3;1;1;0;3;0;0;1;0;0;0;2;0;0;0;1;1;0;1;0;0;0;0;0;0;0;0;0;1;0;1;0;0;3;0;0;2;0;1;0;0;0;1;0;3;0;1;0
Cryptococcus neoformans var. grubii H99;cneg*;143;136;1;4;7;0;1;0;1;5;1;2;3;0;1;0;6;6;2;2;0;0;1;0;1;6;5;0;1;3;0;0;1;6;3;2;10;0;1;0;2;8;1;5;2;0;0;0;2;7;0;4;0;0;1;0;1;6;0;3;3;0;1;5;3;0
Cyberlindnera jadinii NBRC 0988 NBRC0988;cjd*;191;25;4;0;0;0;0;0;0;0;0;3;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;2;0;1;0;0;0;4;0;0;0;0;0
Debaryomyces hansenii CBS767;dha;214;54;7;0;10;0;0;0;0;0;0;3;0;0;2;0;4;0;0;0;0;0;7;0;0;0;0;0;1;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;6;0;0;0;0;1;0;0;0;0;0;0;8;0;0
Encephalitozoon cuniculi GB-M1;ecu;46;2;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Exophiala dermatitidis NIH/UT8656;ede*;53;47;1;1;0;0;0;0;0;2;0;1;1;0;1;0;3;2;1;2;1;0;1;0;1;0;2;0;1;1;1;1;0;1;1;2;0;0;1;0;1;2;0;2;1;0;1;0;1;0;0;1;0;0;1;0;1;1;2;1;0;0;1;1;1;0
Flammulina velutipes KACC42780;fve*;273;201;6;12;11;1;2;0;0;5;0;0;6;0;2;0;6;0;4;7;6;0;4;0;2;4;5;0;2;11;2;0;2;6;4;7;10;1;8;0;1;2;3;10;7;0;2;0;3;0;0;6;0;0;2;0;3;3;0;1;3;0;1;12;4;2
Fusarium graminearum CS3005;fgr;270;187;2;9;12;0;0;0;0;0;2;8;1;0;3;0;5;11;5;7;0;0;3;0;2;10;9;0;0;0;2;0;5;6;4;0;13;0;3;0;3;12;4;15;1;0;1;0;1;0;0;6;0;0;2;0;2;0;1;0;4;0;1;9;3;0
Fusarium graminearum PH-1 NRRL 31084;fgr;305;209;2;9;16;0;0;0;0;0;2;8;1;0;3;0;6;13;5;7;0;0;3;0;2;10;9;0;0;0;2;0;5;13;4;0;19;0;3;0;2;13;4;14;1;0;1;0;1;0;0;8;0;0;2;0;2;0;1;0;4;0;1;10;3;0
Fusarium verticillioides 7600;fvr;285;197;2;8;15;1;0;0;0;4;1;7;0;0;1;0;5;11;4;6;0;0;0;0;2;10;7;0;0;0;2;0;5;12;5;0;16;1;3;0;3;14;2;14;0;0;1;0;1;0;0;8;0;0;2;0;3;0;0;0;5;0;2;10;4;0
Kazachstania africana CBS 2517;kaf;266;53;8;0;0;0;0;0;0;0;0;4;0;0;2;0;0;0;0;0;0;0;10;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;9;0;0;0;0;1;0;0;0;6;0;0;9;2;0
Kazachstania naganishii CBS 8797;kna*;158;40;4;0;0;0;0;0;0;0;0;3;0;0;2;0;0;0;0;0;0;0;6;0;0;0;0;0;0;0;3;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;1;0;0;0;4;0;0;6;5;0
Kluyveromyces lactis NRRL Y-1140;kla;162;39;4;0;0;0;0;0;0;0;0;2;0;0;1;0;0;0;0;0;1;0;7;0;0;0;0;0;0;3;2;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;5;0;0;0;0;1;0;0;0;4;0;0;0;7;0
Komagataella pastoris CBS 7435;kpa*;123;29;3;0;0;0;0;0;0;0;0;2;0;0;1;0;2;0;0;0;0;0;0;0;0;0;0;0;0;2;1;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;4;0;0;2;0;0;0;0;0;3;0;0;5;3;0
Lachancea kluyveri NRRL Y-12651;lkl*;258;72;5;0;0;0;0;0;0;0;0;4;0;0;1;0;0;0;0;0;1;0;10;0;0;0;0;0;0;5;3;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;7;0;0;0;0;1;11;0;0;5;0;0;8;11;0
Lachancea thermotolerans CBS 6340;lth;229;57;4;0;0;0;0;0;0;0;0;3;0;0;1;0;0;0;0;0;0;0;8;0;0;0;0;0;0;4;3;0;3;0;0;0;0;0;3;0;0;0;0;0;0;0;0;0;0;0;0;6;0;0;0;0;2;0;0;0;5;0;0;7;8;0
Magnaporthe oryzae 70-15;mgr;190;157;0;6;6;0;2;0;2;4;1;3;3;0;1;0;4;8;2;0;6;0;2;0;2;5;2;0;0;6;1;0;4;7;1;0;9;0;3;0;2;9;3;14;3;0;1;0;2;6;0;5;0;0;2;0;3;4;0;3;0;0;1;7;2;0
Millerozyma farinosa CBS 7064;mfa*;288;68;6;0;10;0;0;0;0;0;0;6;0;0;4;0;6;0;0;0;0;0;8;0;0;0;0;0;2;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;10;0;0;0;0;0;0;0;0;0;0;0;10;0;0
Myceliophthora thermophila ATCC 42464;mth*;192;127;0;0;9;0;2;0;2;2;1;5;2;0;1;0;4;8;2;4;3;0;2;0;3;6;0;0;2;5;1;0;4;7;0;8;8;0;2;0;3;7;0;0;2;0;1;0;3;0;0;6;0;0;2;0;0;0;0;0;2;0;1;5;2;0
Naumovozyma castellii CBS 4309;ncs;270;63;8;0;0;0;0;0;0;0;0;4;0;0;2;0;0;0;0;0;0;0;10;0;0;0;0;0;0;0;3;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;9;0;0;0;0;1;0;0;0;7;0;0;10;9;0
Neurospora crassa OR74A;ncr;396;232;2;1;5;0;3;0;3;2;1;6;5;0;1;1;7;17;3;9;11;0;1;0;4;11;1;0;0;0;2;0;6;16;1;18;24;0;3;0;5;19;0;0;6;0;2;0;1;0;0;10;1;0;2;0;4;0;0;0;0;0;1;12;5;0
Ogataea parapolymorpha DL-1;opa*;80;7;2;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;1;0;0;0;1;0;0;0;0;0
Penicillium chrysogenum P2niaD18;pch*;192;100;1;1;0;0;2;0;1;6;0;4;1;0;2;0;10;0;3;11;0;0;0;0;1;0;1;0;0;0;0;1;3;6;1;8;0;0;0;0;2;0;4;0;1;0;1;0;3;8;1;5;0;0;1;0;2;3;1;3;0;0;2;0;0;0
Saccharomyces cerevisiae (S288c Apr 2011);sce;275;61;7;0;0;0;0;0;0;0;0;4;0;0;2;0;0;0;0;0;0;0;10;0;0;0;0;0;0;0;3;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;8;0;0;0;0;1;0;0;0;6;0;0;10;10;0
Saccharomycetaceae sp. Ashbya aceri;sas*;205;52;3;0;0;0;0;0;0;0;0;3;0;0;1;0;0;0;0;0;4;0;7;0;0;0;0;0;0;4;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;3;0;0;0;5;0;0;6;7;0
Scheffersomyces stipitis CBS 6054;pic;170;42;3;0;9;0;0;0;0;0;0;2;0;0;1;0;3;0;0;0;0;0;6;0;0;1;0;0;0;3;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;5;0;0;0;0;2;0;0;0;0;0;0;6;0;0
Schizosaccharomyces pombe 972h-;spo;168;44;0;0;9;0;0;0;0;0;0;3;1;0;1;0;3;0;0;0;0;0;0;0;1;0;0;0;1;0;1;0;1;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;9;0;4;0;0;2;0;1;0;0;0;0;0;2;0;4;0
Sporisorium reilianum SRZ2;sre*;96;91;1;0;5;0;1;0;1;1;1;0;1;0;1;0;4;4;3;3;2;0;1;0;1;3;2;0;0;4;1;0;2;4;2;3;4;0;1;0;1;3;1;6;1;0;1;0;1;4;0;2;0;0;1;0;2;2;1;2;2;0;1;4;0;0
Tetrapisispora blattae CBS 6284;tbl;328;71;9;0;0;0;0;0;0;0;0;6;0;0;2;0;0;0;0;0;0;0;13;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;9;0;0;0;0;2;0;0;0;7;0;0;12;9;0
Tetrapisispora phaffii CBS 4417;tpf;206;42;6;0;0;0;0;0;0;0;0;3;0;0;2;0;0;0;0;0;0;0;7;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;6;0;0;0;0;1;0;0;0;4;0;0;9;2;0
Thielavia terrestris NRRL 8126;ttt;154;117;1;3;6;0;1;0;2;4;0;3;2;0;1;0;2;6;2;3;4;0;2;0;3;4;1;0;1;6;1;0;4;5;0;6;7;0;2;0;3;7;1;0;2;0;1;0;3;0;0;4;0;0;1;0;0;0;0;0;0;0;7;5;1;0
Torulaspora delbrueckii CBS 1146;tdl;192;45;5;0;0;0;0;0;0;0;0;3;0;0;1;0;0;0;0;0;0;0;6;0;0;0;0;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;7;0;0;0;0;1;0;0;0;4;0;0;6;8;0
Ustilago maydis 521;uma;111;101;1;0;5;0;1;0;1;0;1;2;1;0;1;0;4;4;2;2;3;0;1;0;1;4;3;0;0;4;1;0;2;4;2;5;4;0;1;0;1;5;2;6;1;0;1;0;1;4;0;3;0;0;1;0;3;3;2;2;2;0;1;3;0;0
Valsa mali 03-8;vma*;156;130;0;3;9;0;3;0;2;3;0;3;2;0;1;0;3;7;2;4;3;0;2;0;1;1;2;0;2;5;3;0;4;5;2;3;8;0;2;0;2;7;0;8;1;1;1;0;2;5;0;4;0;0;1;0;2;2;0;0;3;0;0;4;2;0
Verticillium dahliae VdLs.17;vda;225;115;2;6;0;0;3;0;3;0;2;2;1;0;0;0;4;0;2;6;0;0;3;0;0;8;0;0;0;4;1;0;0;8;2;5;0;0;2;0;1;11;2;0;1;0;1;0;2;8;0;6;0;0;3;1;1;0;1;1;3;0;1;7;1;0
Yarrowia lipolytica CLIB122;yli;510;316;4;16;34;0;3;0;1;0;0;6;0;0;1;0;0;26;3;4;14;0;0;0;2;21;25;0;0;0;2;0;11;21;0;28;27;0;0;0;0;0;11;0;0;0;0;0;3;0;0;14;0;0;2;0;4;0;0;0;13;0;0;17;3;0
Zygosaccharomyces rouxii CBS 732;zro;272;54;7;0;0;0;0;0;0;0;0;5;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;7;0;0;3;0;2;0;0;0;6;0;0;8;10;0
  ;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
total;;;;131;94;202;2;30;0;25;42;20;144;36;0;59;1;104;141;59;92;65;0;168;0;31;125;80;0;17;91;68;2;71;143;50;125;170;2;43;0;36;119;42;102;33;1;25;1;37;59;1;250;1;0;43;1;66;35;9;30;124;1;35;261;151;2
;;;;aaa;aac;aag;aat;aca;acc;acg;act;aga;agc;agg;agt;ata;atc;atg;att;caa;cac;cag;cat;cca;ccc;ccg;cct;cga;cgc;cgg;cgt;cta;ctc;ctg;ctt;gaa;gac;gag;gat;gca;gcc;gcg;gct;gga;ggc;ggg;ggt;gta;gtc;gtg;gtt;taa;tac;tag;tat;tca;tcc;tcg;tct;tga;tgc;tgg;tgt;tta;ttc;ttg;ttt
zéros;;;;6;26;21;40;27;42;27;29;30;4;24;42;1;41;18;26;22;23;27;42;9;42;24;22;26;42;30;20;10;40;22;21;24;27;26;40;26;42;24;28;28;31;26;41;21;41;22;33;41;0;41;42;18;41;5;33;35;30;12;41;23;7;10;40
42−zér;;;;36;16;21;2;15;0;15;13;12;38;18;0;41;1;24;16;20;19;15;0;33;0;18;20;16;0;12;22;32;2;20;21;18;15;16;2;16;0;18;14;14;11;16;1;21;1;20;9;1;42;1;0;24;1;37;9;7;12;30;1;19;35;32;2

E79 Les introns[modifier | modifier le wikicode]

génome;KEGG;tRNA;total;aaa;aac;aag;aat;aca;acc;acg;act;aga;agc;agg;agt;ata;atc;atg;att;caa;cac;cag;cat;cca;ccc;ccg;cct;cga;cgc;cgg;cgt;cta;ctc;ctg;ctt;gaa;gac;gag;gat;gca;gcc;gcg;gct;gga;ggc;ggg;ggt;gta;gtc;gtg;gtt;taa;tac;tag;tat;tca;tcc;tcg;tct;tga;tgc;tgg;tgt;tta;ttc;ttg;ttt
Ailuropoda melanoleuca (panda) (BGI-Shenzhen AilMel 1.0 Dec 2009);aml;1463;96;3;1;45;0;0;0;0;0;5;0;2;0;5;0;0;0;3;0;3;0;1;0;1;0;3;1;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;11;1;0;1;0;0;0;0;0;0;0;0;0;9;0
Anolis carolinensis (lizard) (Broad AnoCar2.0 May 2010);acs;211;11;0;0;0;0;0;0;0;0;2;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;6;0;0;0;0;0;0;0;0;0;0;0;0;2;0
Anopheles gambiae;aga;414;27;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;22;0;0;0;0;0;0;0;0;0;0;0;0;3;0
Arabidopsis thaliana (TAIR10 Feb 2011);ath;684;83;0;0;0;0;0;0;0;0;0;0;0;0;0;2;11;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;70;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Balaenoptera acutorostrata scammoni (Minke whale Oct. 2013 BalAcu1.0/balAcu1);bacu;7080;50;0;0;0;0;0;0;0;0;5;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;12;0;1;1;0;0;0;0;3;0;2;0;0;0;0;0;0;13;0;0;0;1;0;0;0;0;1;0;0;0;6;0
Bos taurus (Cow Jun. 2014 Bos_taurus_UMD_3.1.1/bosTau8);bta;4040;57;0;0;1;0;0;0;1;0;6;0;0;0;5;0;0;0;1;0;1;0;0;0;0;0;0;0;0;0;1;0;0;1;1;0;1;0;0;0;0;1;3;1;5;2;0;0;0;0;0;17;0;0;0;0;0;0;0;2;1;0;0;0;6;0
Brachypodium distachyon (JGI v1.0 8X);bdi;639;36;0;0;0;0;0;0;0;1;0;3;1;0;0;0;17;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;12;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Caenorhabditis brenneri (WUGSC 6.0.1 Feb 2008);cbr*;1095;52;0;0;0;0;0;0;0;0;0;0;0;0;6;1;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;26;0;2;0;0;0;0;0;0;0;0;0;1;14;0
Caenorhabditis briggsae (C. briggsae Jan. 2007 WUGSC 1.0/cb3);cbr;743;34;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;19;0;0;0;0;0;0;0;0;0;0;0;0;10;0
Caenorhabditis elegans (WS220 Oct 2010);cel;596;34;0;0;0;0;2;0;0;0;0;0;0;0;3;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;19;0;0;0;0;0;0;0;0;0;0;0;0;7;0
Caenorhabditis japonica (WUGSC 3.0.2 Mar 2008);cja*;827;35;0;0;0;0;0;0;0;0;0;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;24;0;0;0;0;0;0;0;0;0;0;0;0;7;0
Callithrix jacchus (marmoset) (WUGSC 3.2 Mar 2009);cjc;408;29;0;0;0;0;0;0;0;0;5;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;11;0;0;0;0;0;0;0;3;0;0;0;0;5;0
Callorhinchus milii (Elephant shark Dec. 2013 Callorhinchus_milii-6.1.3/calMil1);cmk;13727;177;35;0;0;0;0;0;0;3;12;0;0;0;17;0;0;0;0;0;0;0;13;3;8;12;22;0;0;0;1;0;1;0;2;0;0;0;0;0;1;0;0;0;0;0;1;0;1;0;0;34;0;1;0;0;0;0;0;0;0;1;0;0;9;0
Canis familiaris (dog) (CanFam3.1 Sept 2011);cfa;906;68;2;0;33;0;0;0;0;0;4;0;1;0;5;0;0;0;3;0;1;0;1;0;0;0;1;0;0;0;0;0;1;0;1;0;2;0;0;0;0;1;0;0;0;0;0;0;0;0;0;8;0;0;0;0;0;0;0;0;0;0;0;0;4;0
Cavia porcellus (Guinea pig) (Broad Feb 2008);cpo*;383;28;0;0;0;0;0;0;0;0;4;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;15;0;0;0;0;0;0;0;0;0;0;0;0;5;0
Ceratotherium simum (White rhinoceros May 2012 CerSimSim1.0/cerSim1);csi*;518;27;0;0;0;0;0;0;0;0;5;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;11;0;0;0;0;0;0;0;0;0;0;0;0;6;0
Chrysemys picta bellii (Painted turtle Dec. 2011 v3.0.1/chrPic1);cpic;554;36;0;0;0;0;0;0;0;0;10;1;0;0;12;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;7;0
Cricetulus griseus cell line CHO-K1 (Chinese hamster ovary CriGri 1.0 Aug 2011);cge;498;23;0;0;0;0;0;0;0;0;4;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;11;0;0;0;0;0;0;0;0;0;0;0;0;4;0
Dasypus novemcinctus (Armadillo Dec. 2011 Baylor/dasNov3);dno*;1119;31;0;0;1;0;0;0;0;0;5;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;2;0;1;0;0;0;0;9;0;0;0;0;0;0;0;1;0;0;0;0;6;0
Drosophila melanogaster (D. melanogaster Aug. 2014 BDGP Release 6 + ISO1 MT/dm6);dme;289;15;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;9;0;0;0;0;0;0;0;0;0;0;0;0;4;0
Drosophila simulans (D. simulans Apr. 2005 WUGSC mosaic 1.0);dsi;256;15;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;10;0;0;0;0;0;0;0;0;0;0;0;0;4;0
Drosophila yakuba (D. yakuba Nov. 2005 WUGSC 7.1);dya;326;15;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;9;0;0;0;0;0;0;0;0;0;0;0;0;4;0
Equus caballus (horse) (Sep 2007);ecb;494;32;0;0;0;0;0;0;0;0;5;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;14;0;1;0;0;0;0;0;0;0;0;0;0;6;0
Erinaceus europaeus (Hedgehog May 2012 EriEur2.0/eriEur2);eeu*;485;30;0;0;2;0;0;0;0;1;4;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;13;0;0;0;0;0;0;0;0;0;0;0;0;6;0
Felis catus (cat) (Felis_catus-6.2 Sept 2011);fca;3729;487;4;2;214;1;0;0;1;0;5;0;9;0;6;0;0;0;75;2;7;0;7;1;1;0;102;0;2;0;0;0;0;0;0;0;7;0;1;0;1;0;2;0;1;1;0;0;0;0;3;10;4;0;4;0;0;0;2;0;2;0;3;0;7;0
Gadus morhua (Atlantic cod May 2010 Genofisk GadMor_May2010/gadMor1);gmo*;1492;105;1;0;0;0;2;0;0;0;19;0;0;0;16;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;50;0;0;1;0;0;0;0;0;0;0;0;0;12;2
Gallus gallus (galGal4 Nov 2011);gga;283;22;0;0;0;0;0;0;0;0;2;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;15;0;0;0;0;0;0;0;0;0;0;0;0;3;0
Gasterosteus aculeatus (stickleback) (Broad 1.0 Feb 2006);gac*;2489;146;0;0;0;0;0;0;0;0;62;0;0;0;58;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;17;0;0;0;0;0;0;0;0;0;0;3;0;5;0
Geospiza fortis (Medium ground finch Apr. 2012 GeoFor_1.0/geoFor1);gfr;203;14;0;0;0;0;0;0;0;0;1;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;9;0;0;0;0;0;0;0;0;0;0;0;0;2;0
Glycine max (soybean) (Wm82.a2);gmx;738;39;0;0;0;0;0;0;0;0;0;0;0;0;0;0;18;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;20;0;0;1;0;0;0;0;0;0;0;0;0;0;0
Gorilla gorilla gorilla (gorilla) (gorGor3.1 May 2011);ggo;435;34;0;0;0;0;0;0;2;0;4;0;0;0;5;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;13;0;1;0;0;0;0;0;1;0;0;0;0;6;0
Heterocephalus glaber (Naked mole-rat Jan. 2012 Broad HetGla_female_1.0/hetGla2);hgl;367;22;0;0;0;0;0;0;0;1;4;0;0;0;3;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;7;0;0;0;0;0;0;0;1;0;0;0;0;4;0
Homo sapiens (hg38 - GRCh38 Dec 2013);hsa;622;34;0;0;0;0;0;0;1;0;5;0;0;0;5;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;13;1;1;0;0;0;0;0;1;0;1;0;0;5;0
Latimeria chalumnae (Coelacanth Aug. 2011 Broad/latCha1);lcm;373;21;0;0;0;0;0;0;0;0;4;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;7;0;0;0;0;0;0;0;0;0;0;1;0;4;0
Leishmania major;lma;82;3;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;3;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Loxodonta africana (elephant) (Broad/July 2009);lav;2002;60;0;0;0;0;0;0;0;0;9;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;3;0;0;0;0;0;0;0;0;19;0;1;0;0;0;0;0;0;0;0;6;0;17;0
Macaca mulatta (Rhesus Oct. 2010 BGI CR_1.0/rheMac3);mcc;458;34;0;0;0;0;0;0;0;0;5;0;0;0;6;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;13;1;1;0;0;0;0;0;0;0;0;0;0;8;0
Macropus eugenii (Wallaby Sep. 2009 TWGS Meug_1.1/macEug2);meu*;353;26;0;0;0;0;0;0;0;0;4;0;0;0;6;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;8;0;1;0;0;0;0;0;0;0;0;0;0;7;0
Medicago truncatula (March 2009 Version 3.0);mtr;582;40;2;0;0;1;0;0;0;0;0;1;0;0;4;0;13;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;3;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;9;0;1;0;0;0;0;1;0;0;0;2;0;0;0
Meleagris gallopavo (turkey) (TGC Turkey_2.01 Dec 2009);mgp;155;10;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;6;0;0;0;0;0;0;0;0;0;0;0;0;2;0
Melopsittacus undulatus (Budgerigar Sep. 2011 WUSTL v6.3/melUnd1);mun*;191;12;0;0;0;0;0;0;0;0;2;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;0;1;0;0;0;0;0;0;0;0;3;0
Microcebus murinus (Mouse lemur) (Jun 2003);mmr*;258;18;0;0;0;0;0;0;0;0;4;0;0;0;3;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;8;0;0;0;0;0;0;0;0;0;0;0;0;3;0
Monodelphis domestica (opossum) (Broad Oct 2006);mdo;481;30;0;0;0;0;0;0;0;0;5;0;0;0;6;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;14;0;0;1;0;0;0;0;0;0;0;0;0;4;0
Mus musculus (mm10 Dec 2011);mmu;469;25;0;0;0;0;0;0;0;0;5;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;10;0;0;0;0;0;2;0;0;0;0;0;0;4;0
Mustela putorius furo (Ferret Apr. 2011 MusPutFur1.0/musFur1);mpu*;749;66;1;1;25;1;0;0;0;0;8;0;1;0;5;0;0;0;2;0;1;0;1;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;9;1;0;1;0;0;0;0;0;0;0;0;0;6;0
Myotis lucifugus (Microbat Jul. 2010 Broad Institute Myoluc2.0/myoLuc2);mlu*;252;21;0;0;0;0;0;0;0;0;4;0;0;0;3;0;0;0;0;1;1;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;3;0
Nomascus leucogenys (Gibbon Oct. 2012 GGSC Nleu3.0/nomLeu3);nle;421;31;0;0;0;0;0;0;0;0;5;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;13;1;0;0;0;0;0;0;0;0;0;0;0;5;1
Ochotona princeps (Pika May 2012 OchPri3.0/ochPri3);opr*;338;22;0;0;0;0;0;0;0;0;4;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;10;0;0;0;0;0;0;0;0;0;0;0;0;4;0
Oreochromis niloticus (Nile tilapia Jan. 2011 Broad oreNil1.1/oreNil2);oni*;674;76;0;0;0;0;0;0;0;2;22;0;0;0;24;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;17;0;3;0;0;0;0;0;0;0;0;0;0;7;0
Ornithorhynchus anatinus (platypus) (WUGSC 5.0.1 Mar 2007);oaa;856;54;0;0;0;0;0;0;0;0;5;0;0;0;9;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;26;0;0;0;0;2;0;0;0;1;0;0;1;10;0
Oryctolagus cuniculus (rabbit) (Broad Apr 2009);ocu;506;27;0;0;0;0;0;0;0;0;5;0;0;0;7;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;11;0;0;0;0;0;0;0;0;0;0;0;0;3;0
Oryza sativa;osa;738;36;0;0;0;0;1;0;0;0;0;2;0;0;0;0;15;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;13;0;1;1;0;0;0;0;2;0;0;0;0;0;0
Otolemur garnettii (Bushbaby Mar. 2011 Broad/otoGar3);oga*;326;41;0;0;0;0;0;0;0;0;3;0;0;1;10;9;0;3;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;8;0;0;0;0;0;0;0;0;0;0;0;0;5;1
Ovis aries (sheep) (Feb 2010);oas;1176;29;0;0;0;0;0;0;0;1;4;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;3;2;0;0;0;0;0;0;8;0;0;0;0;0;0;0;0;0;0;0;0;4;0
Pan troglodytes (Chimp Feb. 2011 CSAC 2.1.4/panTro4);ptr;503;34;0;0;0;0;0;0;1;0;5;0;0;0;5;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;13;1;1;0;0;0;0;0;1;0;0;0;0;5;0
Papio anubis (Baboon Mar. 2012 Baylor Panu_2.0/papAnu2);pan*;476;35;0;0;0;0;0;0;0;0;5;0;0;0;6;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;14;0;2;0;0;0;0;0;0;0;0;0;0;8;0
Papio hamadryas (baboon) (Nov 2008);pha*;411;31;0;0;0;0;0;0;0;0;5;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;15;0;0;0;0;0;0;0;0;0;0;0;0;7;0
Petromyzon marinus (Lamprey Sep. 2010 WUGSC 7.0/petMar2);pma*;2485;133;6;3;0;0;0;0;0;0;2;0;0;0;9;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;2;86;0;0;0;0;0;0;0;0;0;0;0;0;22;0
Physcomitrella patens ;ppp;418;21;0;0;0;0;0;0;0;0;0;0;0;0;0;0;11;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;8;1;0;0;0;0;0;0;0;0;0;0;0;0;0
Plasmodium falciparum;pfa;35;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Pongo pygmaeus abelii (Orangutan July 2007 WUGSC 2.0.2/ponAbe2);ppy*;517;40;0;0;0;0;0;0;1;0;7;0;0;0;6;0;0;0;0;0;1;0;0;0;0;1;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;15;0;1;0;1;0;0;0;1;0;0;0;0;5;0
Populus trichocarpa (Jan 2010 Version 2.0) ;pop;618;74;0;0;0;0;0;0;0;0;0;0;0;0;1;0;13;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;35;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;17;0;0;0;0;0;0;0;0;0;0;0;0;0;6
Rattus norvegicus (rn5 Mar 2012);rno;407;15;0;0;0;0;0;0;0;1;5;0;0;0;3;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;1;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;1
Saimiri boliviensis (Squirrel monkey Oct. 2011 Broad/saiBol1);sbq;334;26;0;0;0;0;0;0;0;0;5;0;0;0;5;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;8;0;0;0;0;0;0;0;0;0;0;0;0;6;0
Sarcophilus harrisii (Tasmanian devil Feb. 2011 WTSI Devil_ref v7.0/sarHar1);shr;446;22;0;0;0;0;0;0;0;0;4;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;11;0;0;0;0;0;0;0;0;0;0;0;0;3;0
Sorex araneus (Shrew Aug. 2008 Broad/sorAra2);san*;374;25;0;0;0;0;0;0;0;0;4;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;9;1;0;0;0;0;0;0;1;0;0;0;0;4;0
Sorghum bicolor (Version 1.0);sbi;578;32;0;0;0;0;0;0;0;0;0;0;0;0;0;0;17;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;12;0;1;1;0;0;0;0;0;0;0;0;0;0;0
Spermophilus tridecemlineatus (Squirrel Nov. 2011 Broad/speTri2);str*;804;24;0;0;0;0;0;0;0;0;4;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;1;1;0;0;0;0;0;0;1;0;0;8;0;0;0;0;0;0;0;0;0;0;0;0;4;0
Strongylocentrotus purpuratus (Sea urchin) ;spu;1065;38;0;0;0;0;0;0;0;0;0;0;0;1;13;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;24;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Sus scrofa (Pig Aug. 2011 SGSC Sscrofa10.2/susScr3);ssc;807;56;0;1;0;1;0;0;0;0;6;1;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;17;0;1;0;0;0;0;0;2;0;0;0;0;0;0;0;16;0;0;0;0;0;0;0;0;0;0;0;0;6;0
Taeniopygia guttata (Zebra finch Feb. 2013 WashU taeGut324/taeGut2);tgu;230;18;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;13;0;0;0;0;0;0;0;0;0;0;0;0;2;0
Takifugu rubripes (Fugu Oct. 2011 FUGU5/fr3);tru;575;43;0;0;0;0;0;0;0;0;12;0;0;0;5;0;0;0;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;15;0;0;0;0;0;0;0;0;0;0;0;0;9;0
Tarsius syrichta (Tarsier Sep. 2013 Tarsius_syrichta-2.0.1/tarSyr2);tsy*;455;114;0;0;0;0;0;0;0;0;4;0;0;0;4;0;0;0;60;0;0;1;26;1;1;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;3;8;0;0;2;0;0;0;0;0;0;0;0;0;3;0
Tetraodon nigroviridis (tetraodon) (Genoscope 8.0 Mar 2007);tng;540;58;0;0;0;0;0;0;0;0;8;0;0;0;5;0;0;0;0;1;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;11;0;3;0;20;0;0;0;0;0;0;1;0;7;0
Trichechus manatus latirostris (Manatee Oct. 2011 Broad v1.0/triMan1);tma*;2017;41;0;0;0;0;0;0;0;0;7;0;0;0;7;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;3;1;0;0;0;0;0;0;0;14;0;0;0;0;0;0;0;0;0;0;0;0;8;0
Tursiops truncatus (Dolphin Oct. 2011 Baylor Ttru_1.4/turTru2);ttr*;5845;47;0;0;0;0;0;0;0;0;5;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;7;1;1;0;0;0;0;0;3;0;2;0;0;0;0;0;0;17;0;0;0;0;0;0;0;0;0;0;0;0;5;0
Vitis vinifera (Grapevine 12X);vvi;499;32;0;0;0;0;0;0;0;0;0;0;0;0;1;1;11;0;0;0;2;0;0;0;0;2;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;10;0;2;0;0;0;0;0;0;0;0;1;0;0;0
Xenopus tropicalis (frog) (JGI 4.2 Nov 2009);xtr;2639;275;0;0;0;0;0;0;0;0;103;0;0;0;43;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;105;1;0;0;0;0;0;0;0;0;0;1;0;19;0
Zea mays (Version 5b.60);zma;1198;37;0;0;0;0;0;0;0;0;0;1;0;0;0;0;22;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;13;0;0;0;0;0;0;0;0;0;0;0;0;0;0
  ;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
total;;;;54;8;321;4;5;0;7;10;469;9;14;2;454;14;149;5;148;11;17;6;50;5;11;18;131;3;4;0;2;1;7;45;28;18;13;4;2;1;4;4;21;7;15;4;5;0;6;3;8;1239;13;24;13;23;2;2;3;14;5;2;18;2;400;11
;;;;aaa;aac;aag;aat;aca;acc;acg;act;aga;agc;agg;agt;ata;atc;atg;att;caa;cac;cag;cat;cca;ccc;ccg;cct;cga;cgc;cgg;cgt;cta;ctc;ctg;ctt;gaa;gac;gag;gat;gca;gcc;gcg;gct;gga;ggc;ggg;ggt;gta;gtc;gtg;gtt;taa;tac;tag;tat;tca;tcc;tcg;tct;tga;tgc;tgg;tgt;tta;ttc;ttg;ttt
zéros;;;;71;74;72;75;76;79;73;72;21;73;74;77;10;74;68;76;71;70;71;76;72;76;75;73;72;76;77;79;77;78;72;69;71;77;73;76;77;78;75;75;70;75;72;76;74;79;73;77;76;0;69;62;70;75;78;77;77;69;75;77;71;77;14;74
79−zér;;;;8;5;7;4;3;0;6;7;58;6;5;2;69;5;11;3;8;9;8;3;7;3;4;6;7;3;2;0;2;1;7;10;8;2;6;3;2;1;4;4;9;4;7;3;5;0;6;2;3;79;10;17;9;4;1;2;2;10;4;2;8;2;65;5
  ;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
Danio rerio (Zebrafish) (Zv8 Apr 2009);dre;;;aaa;aac;aag;aat;aca;acc;acg;act;aga;agc;agg;agt;ata;atc;atg;att;caa;cac;cag;cat;cca;ccc;ccg;cct;cga;cgc;cgg;cgt;cta;ctc;ctg;ctt;gaa;gac;gag;gat;gca;gcc;gcg;gct;gga;ggc;ggg;ggt;gta;gtc;gtg;gtt;taa;tac;tag;tat;tca;tcc;tcg;tct;tga;tgc;tgg;tgt;tta;ttc;ttg;ttt
intron;;;813;3;;;;;;;;247;;;;61;;2;1;;;;;;;;7;;;;;8;;;4;;1;;;;;;;2;;3;;;;;2;;225;;4;;;;;;;;;8;;234;1
tRNAs;;12258;;525;1,045;953;24;290;10;66;359;252;424;104;14;75;10;522;258;105;387;266;10;205;2;180;315;107;24;59;203;244;4;300;270;225;150;245;1;368;4;112;92;47;836;268;11;230;6;227;232;0;236;0;5;209;2;80;336;14;136;44;9;73;197;241;10

A10[modifier | modifier le wikicode]

A10 liste[modifier | modifier le wikicode]

introns;tRNAs;KEGG;Génome
2;49;fpl;Ferroglobus placidus DSM 10642
3;52;hbo;Halogeometricum borinquense DSM 11551 PR 3
2;59;mru;Methanobrevibacter ruminantium M1
6;55;mmet;Methanococcoides methylutens MM1
4;58;mac;Methanosarcina acetivorans C2A
4;62;mbw;Methanosarcina barkeri str. Wiesmoor
4;60;mhor;Methanosarcina horonobensis HB-1 JCM 15518
4;57;mls;Methanosarcina lacustris Z-7289
3;56;mpl;Methanosphaerula palustris E1-9c
3;54;nou;Natronococcus occultus SP4
;;;
71;46;pcl;Pyrobaculum calidifontis JCM 11548

A10 décomptes[modifier | modifier le wikicode]

fpl;;;;hbo;;;;mac;;;;mbw;;;;mhor;;;;mls;;;;mmet;;;;mpl;;;;mru;;;;nou;;
1;1;(CAA);;1;1;(CAA);;1;1;(CAA);;1;1;(CAA);;2;2;(CAA);;1;1;(CAA);;1;1;(CAA);;1;1;(CAA);;1;1;(ACG);;1;1;(CAA)
1;1;(CAC);;1;1;(CAC);;1;1;(CAC);;1;1;(CAC);;1;1;(CAC);;1;1;(CAC);;1;1;(CAC);;1;1;(CAC);;2;2;(CAA);;1;1;(CAC)
1;1;(CAG);;1;1;(CAG);;1;1;(CAG);;1;1;(CAG);;2;2;(CAG);;2;2;(CAG);;1;1;(CAG);;1;1;(CAG);;3;3;(CAT);;1;1;(CAG)
3;3;(CAT);;3;3;(CAT);;4;3;(CAT);;5;3;(CAT);;4;4;(CAT);;4;3;(CAT);;4;3;(CAT);;3;3;(CAT);;2;2;(CCA);;4;4;(CAT)
1;1;(CCA);;1;1;(CCA);;1;1;(CCA);;1;1;(CCA);;1;1;(CCA);;1;1;(CCA);;1;1;(CCA);;1;1;(CCA);;1;1;(CCT);;1;1;(CCA)
1;1;(CCC);;1;1;(CCC);;1;1;(CCC);;1;1;(CCC);;1;1;(CCC);;1;1;(CCC);;1;1;(CCC);;1;1;(CCC);;1;1;(CTG);;1;1;(CCC)
1;1;(CCG);;1;1;(CCG);;1;1;(CCG);;1;1;(CCG);;1;1;(CCG);;1;1;(CCG);;1;1;(CCG);;1;1;(CCG);;1;1;(CTT);;1;1;(CCG)
1;1;(CCT);;1;1;(CCT);;1;1;(CCT);;1;1;(CCT);;1;1;(CCT);;1;1;(CCT);;1;1;(CCT);;1;1;(CCT);;2;2;(GAA);;1;1;(CCT)
1;1;(CGA);;1;1;(CGA);;1;1;(CGA);;1;1;(CGA);;1;1;(CGA);;1;1;(CGA);;1;1;(CGC);;1;1;(CGA);;2;2;(GAC);;1;1;(CGA)
1;1;(CGC);;1;1;(CGC);;1;1;(CGC);;1;1;(CGC);;1;1;(CGC);;1;1;(CGC);;1;1;(CGG);;1;1;(CGC);;1;1;(GAG);;1;1;(CGC)
1;1;(CGG);;1;1;(CGG);;1;1;(CGG);;1;1;(CGG);;1;1;(CGG);;1;1;(CGG);;1;1;(CGT);;1;1;(CGG);;2;2;(GAT);;1;1;(CGG)
1;1;(CGT);;1;1;(CGT);;1;1;(CGT);;1;1;(CGT);;1;1;(CGT);;1;1;(CGT);;1;1;(CTC);;1;1;(CGT);;1;1;(GCA);;1;1;(CGT)
1;1;(CTC);;1;1;(CTC);;1;1;(CTC);;1;1;(CTC);;1;1;(CTC);;1;1;(CTC);;1;1;(CTG);;1;1;(CTC);;1;1;(GCC);;1;1;(CTC)
2;2;(CTG);;1;1;(CTG);;1;1;(CTG);;1;1;(CTG);;1;1;(CTG);;1;1;(CTG);;2;1;(CTT);;1;1;(CTG);;1;1;(GCG);;1;1;(CTG)
1;1;(CTT);;1;1;(CTT);;1;1;(CTT);;1;1;(CTT);;1;1;(CTT);;1;1;(CTT);;2;2;(GAA);;1;1;(CTT);;2;2;(GCT);;1;1;(CTT)
1;1;(GAA);;1;1;(GAA);;2;1;(GAA);;2;1;(GAA);;2;1;(GAA);;2;1;(GAA);;1;1;(GAC);;1;1;(GAA);;2;2;(GGA);;1;1;(GAA)
1;1;(GAC);;1;1;(GAC);;2;1;(GAC);;2;1;(GAC);;2;1;(GAC);;2;1;(GAC);;2;1;(GAG);;1;1;(GAC);;1;1;(GGC);;1;1;(GAC)
2;2;(GAG);;1;1;(GAG);;2;2;(GAG);;2;1;(GAG);;2;2;(GAG);;2;2;(GAG);;1;1;(GAT);;1;1;(GAG);;1;1;(GGT);;1;1;(GAG)
1;1;(GAT);;1;1;(GAT);;2;1;(GAT);;2;1;(GAT);;2;2;(GAT);;2;1;(GAT);;4;3;(GCA);;1;1;(GAT);;2;2;(GTA);;1;1;(GAT)
1;1;(GCA);;1;1;(GCA);;3;3;(GCA);;4;3;(GCA);;4;4;(GCA);;3;3;(GCA);;1;1;(GCC);;8;6;(GCA);;2;2;(GTC);;1;1;(GCA)
1;1;(GCC);;2;1;(GCC);;3;1;(GCC);;3;2;(GCC);;3;2;(GCC);;2;2;(GCC);;1;1;(GCG);;1;1;(GCC);;1;1;(GTG);;2;1;(GCC)
1;1;(GCG);;2;1;(GCG);;1;1;(GCG);;1;1;(GCG);;1;1;(GCG);;1;1;(GCG);;1;1;(GCT);;1;1;(GCG);;2;2;(GTT);;1;1;(GCG)
1;1;(GCT);;1;1;(GCT);;1;1;(GCT);;1;1;(GCT);;1;1;(GCT);;1;1;(GCT);;1;1;(GGA);;1;1;(GCT);;2;2;(TAA);;1;1;(GCT)
1;1;(GGA);;1;1;(GGA);;1;1;(GGA);;1;1;(GGA);;1;1;(GGA);;1;1;(GGA);;1;1;(GGC);;1;1;(GGA);;2;1;(TAC);;1;1;(GGA)
1;1;(GGC);;1;1;(GGC);;1;1;(GGC);;1;1;(GGC);;1;1;(GGC);;1;1;(GGC);;1;1;(GGG);;1;1;(GGC);;2;2;(TAG);;1;1;(GGC)
1;1;(GGG);;1;1;(GGG);;1;1;(GGG);;1;1;(GGG);;1;1;(GGG);;1;1;(GGG);;1;1;(GGT);;1;1;(GGG);;2;2;(TCC);;1;1;(GGG)
1;1;(GGT);;1;1;(GGT);;1;1;(GGT);;1;1;(GGT);;1;1;(GGT);;1;1;(GGT);;1;1;(GTA);;1;1;(GGT);;1;1;(TCG);;2;2;(GGT)
1;1;(GTA);;2;1;(GTA);;1;1;(GTA);;1;1;(GTA);;1;1;(GTA);;1;1;(GTA);;2;1;(GTC);;1;1;(GTA);;2;2;(TCT);;1;1;(GTA)
1;1;(GTC);;2;1;(GTC);;1;1;(GTC);;1;1;(GTC);;1;1;(GTC);;1;1;(GTC);;1;1;(GTG);;1;1;(GTC);;2;2;(TGA);;2;2;(GTC)
1;1;(GTG);;1;1;(GTG);;1;1;(GTG);;1;1;(GTG);;1;1;(GTG);;1;1;(GTG);;1;1;(GTT);;1;1;(GTG);;3;2;(TGC);;1;1;(GTG)
1;1;(GTT);;1;1;(GTT);;2;1;(GTT);;2;1;(GTT);;2;1;(GTT);;2;1;(GTT);;1;1;(TAA);;1;1;(GTT);;2;2;(TGG);;1;1;(GTT)
1;1;(TAA);;1;1;(TAA);;1;1;(TAA);;3;3;(TAA);;1;1;(TAA);;1;1;(TAA);;1;1;(TAC);;1;1;(TAA);;1;1;(TGT);;1;1;(TAA)
1;1;(TAC);;1;1;(TAC);;1;1;(TAC);;1;1;(TAC);;1;1;(TAC);;1;1;(TAC);;1;1;(TAG);;1;1;(TAC);;2;2;(TTC);;1;1;(TAC)
1;1;(TAG);;1;1;(TAG);;1;1;(TAG);;1;1;(TAG);;1;1;(TAG);;1;1;(TAG);;1;1;(TCC);;1;1;(TAG);;2;2;(TTG);;1;1;(TAG)
1;1;(TCC);;2;2;(TCC);;1;1;(TCC);;1;1;(TCC);;1;1;(TCC);;1;1;(TCC);;1;1;(TCG);;1;1;(TCC);;2;2;(TTT);;1;1;(TCC)
2;2;(TCG);;1;1;(TCG);;1;1;(TCG);;1;1;(TCG);;1;1;(TCG);;1;1;(TCG);;1;1;(TCT);;1;1;(TCG);;0;0;(CAC);;1;1;(TCG)
1;1;(TCT);;1;1;(TCT);;1;1;(TCT);;1;1;(TCT);;1;1;(TCT);;1;1;(TCT);;1;1;(TGA);;1;1;(TCT);;0;0;(CAG);;1;1;(TCT)
1;1;(TGA);;1;1;(TGA);;1;1;(TGA);;1;1;(TGA);;1;1;(TGA);;1;1;(TGA);;3;1;(TGC);;1;1;(TGA);;0;0;(CCC);;1;1;(TGA)
1;1;(TGC);;2;1;(TGC);;1;1;(TGC);;1;1;(TGC);;1;1;(TGC);;1;1;(TGC);;1;1;(TGG);;1;1;(TGC);;0;0;(CCG);;4;1;(TGC)
1;1;(TGG);;1;1;(TGG);;1;1;(TGG);;1;1;(TGG);;1;1;(TGG);;1;1;(TGG);;1;1;(TGT);;1;1;(TGG);;0;0;(CGA);;1;1;(TGG)
1;1;(TGT);;1;1;(TGT);;1;1;(TGT);;2;2;(TGT);;1;1;(TGT);;1;1;(TGT);;1;1;(TTC);;4;2;(TGT);;0;0;(CGC);;1;1;(TGT)
1;1;(TTC);;1;1;(TTC);;2;1;(TTC);;2;1;(TTC);;2;1;(TTC);;2;1;(TTC);;1;1;(TTG);;1;1;(TTC);;0;0;(CGG);;1;1;(TTC)
1;1;(TTG);;1;1;(TTG);;2;2;(TTG);;1;1;(TTG);;1;1;(TTG);;1;1;(TTG);;1;1;(TTT);;1;1;(TTG);;0;0;(CGT);;1;1;(TTG)
1;1;(TTT);;1;1;(TTT);;1;1;(TTT);;1;1;(TTT);;1;1;(TTT);;1;1;(TTT);;0;0;(CGA);;1;1;(TTT);;0;0;(CTC);;1;1;(TTT)
49;49;;;52;47;;;58;50;;;62;52;;;60;55;;;57;51;;;55;48;;;56;52;;;59;57;;;53;49;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA);;0;0;(AAA)
0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC);;0;0;(AAC)
0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG);;0;0;(AAG)
0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT);;0;0;(AAT)
0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA);;0;0;(ACA)
0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC);;0;0;(ACC)
0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT);;0;0;(ACT)
0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA);;0;0;(AGA)
0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC);;0;0;(AGC)
0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG);;0;0;(AGG)
0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT);;0;0;(AGT)
0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA);;0;0;(ATA)
0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC);;0;0;(ATC)
0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG);;0;0;(ATG)
0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT);;0;0;(ATT)
0;0;(ACG);;0;0;(ACG);;0;0;(ACG);;0;0;(ACG);;0;0;(ACG);;0;0;(ACG);;0;0;(ACG);;0;0;(ACG);;;;;;0;0;(ACG)
0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA);;0;0;(TTA)
0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA);;0;0;(CTA)
0;0;(TCA);;0;0;(TCA);;0;0;(TCA);;0;0;(TCA);;0;0;(TCA);;0;0;(TCA);;0;0;(TCA);;0;0;(TCA);;0;0;(TCA);;0;0;(TCA)
0;0;(TAT);;0;0;(TAT);;0;0;(TAT);;0;0;(TAT);;0;0;(TAT);;0;0;(TAT);;0;0;(TAT);;0;0;(TAT);;0;0;(TAT);;0;0;(TAT)

Tableaux des effectifs[modifier | modifier le wikicode]

E79 effectifs[modifier | modifier le wikicode]

dre;;;;;E79;acs;;aga;;aml;;ath;;bacu;;bdi;;bta;;cbr;;cbre;;cel;;cfa;;cge;;cjap;;cjc;;cmk;;cpic;;cpo;;csi;;dme;;dno;;dsi;;dya;;ecb;;eeu;;fca;;gac;;gfr;;gga;;ggo;;gmo;;gmx;;hgl;;hsa-18;;lav;;lcm;;lma;;mcc;;mdo;;meu;;mgp;;mlu;;mmr;;mmu;;mpu;;mtr;;mun;;nle;;oaa;;oas;;ocu;;oga;;oni;;opr;;osa;;pan;;pfa;;pha;;pma;;pop;;ppp;;ppy;;ptr;;rno;;san;;sbi;;sbq;;shr;;spu;;ssc;;str;;tgu;;tma;;tng;;tru;;tsy;;ttr;;vvi;;xtr;;zma;
tot;diff;;aa;gène;tRNA;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff
10;10;;Phe;ttt;AAA;0;0;0;0;0;0;0;0;0;0;0;0;6;6;0;0;0;0;0;0;0;0;0;0;1;1;0;0;3;3;2;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;6;6;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;1;1;0;0;1;1;1;1;1;1;0;0;1;1;0;0;0;0;0;0;1;1;0;0;0;0;2;2;6;5;2;2;0;0;0;0;1;1;0;0;0;0;0;0;0;0;2;2;0;0;1;1;2;2;1;1;1;1;1;1;0;0;0;0;2;2;2;2;1;1
232;86;;Val;gtt;AAC;5;3;31;7;10;2;15;3;14;9;16;5;20;13;25;7;33;3;19;4;6;4;13;9;23;4;7;4;22;16;16;15;6;2;11;6;6;2;12;8;7;2;7;2;12;5;7;4;8;4;21;12;2;2;7;5;9;7;21;13;22;7;12;11;10;6;41;34;3;3;2;1;10;7;9;3;8;3;3;3;5;2;4;2;8;6;8;5;17;6;4;3;11;7;23;16;7;4;12;8;6;3;8;2;7;5;18;7;9;5;1;1;9;4;166;70;17;4;13;3;10;6;11;5;8;5;7;2;16;7;6;4;8;1;20;3;10;6;18;14;9;8;11;8;10;7;19;11;6;5;8;7;15;7;55;19;22;11
270;146;;Leu;ctt;AAG;4;2;5;2;7;5;12;3;6;2;14;7;11;5;26;5;32;3;20;6;4;1;5;2;26;4;8;4;20;14;2;2;5;2;6;3;4;1;5;2;5;1;5;1;7;2;6;2;6;1;49;18;4;3;3;3;9;5;33;22;16;1;5;3;9;4;22;18;4;3;3;1;9;7;8;3;5;3;1;1;3;2;5;2;5;3;6;2;9;6;3;3;10;6;8;5;6;3;5;3;4;1;14;9;5;3;15;4;8;4;1;1;9;5;112;56;49;36;6;1;16;10;11;6;1;1;6;2;15;4;7;3;9;3;18;13;8;3;6;3;2;2;8;5;15;13;11;8;6;3;6;1;10;5;38;18;29;10
258;129;;Ile;att;AAT;6;2;12;2;12;5;17;2;12;6;20;7;18;4;21;4;33;2;21;2;9;5;13;3;26;6;13;8;31;23;11;9;10;3;13;6;10;2;12;6;9;3;10;2;20;7;9;2;10;2;101;17;6;2;7;1;14;9;26;21;31;19;8;3;15;10;43;30;7;6;3;1;12;8;13;1;6;2;3;2;10;4;4;2;12;5;10;4;23;9;5;2;13;9;27;17;6;3;11;5;10;4;25;13;8;2;18;4;14;9;1;1;12;7;110;63;20;6;12;3;16;9;17;11;12;7;15;8;17;3;11;5;11;1;69;12;13;1;14;8;40;35;13;8;18;10;12;3;8;3;11;6;15;6;63;18;69;37
9;9;;Cys;tgt;ACA;0;0;0;0;0;0;0;0;2;2;0;0;143;134;0;0;2;2;0;0;0;0;0;0;0;0;0;0;1;1;5;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;1;1;5;5;0;0;2;2;4;4;0;0;0;0;0;0;1;1;1;1;0;0;1;1;0;0;1;1;0;0;16;16;0;0;0;0;1;1;0;0;1;1;4;4;0;0;2;2;0;0;1;1;0;0;0;0;1;1;0;0;0;0;0;0;1;1;0;0;0;0;1;1;0;0;1;1;5;5;0;0;0;0;1;1;6;5;1;1;2;2;1;1
11;11;;Gly;ggt;ACC;0;0;0;0;0;0;0;0;12;11;0;0;20;20;0;0;0;0;0;0;0;0;1;1;0;0;0;0;2;2;0;0;0;0;0;0;0;0;24;24;0;0;0;0;0;0;0;0;2;2;0;0;0;0;0;0;0;0;0;0;0;0;4;4;0;0;4;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;2;0;0;1;1;0;0;0;0;2;2;5;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;7;7;1;1;9;9;0;0;0;0;0;0;19;18;0;0;0;0;0;0
203;56;;Arg;cgt;ACG;4;2;10;1;8;3;11;7;9;6;16;4;13;6;22;5;32;4;18;4;6;5;6;3;21;4;6;2;9;5;7;5;7;3;10;6;10;1;10;5;9;1;12;1;10;4;6;3;9;4;49;12;6;5;8;4;7;4;31;23;13;2;5;3;7;2;14;10;4;2;4;1;6;3;5;5;7;5;2;2;6;5;6;4;6;3;6;3;12;7;3;2;7;3;12;8;2;2;7;3;6;4;16;4;7;3;24;7;7;3;0;0;7;4;85;30;12;8;8;3;7;3;7;2;6;3;9;5;15;4;6;2;4;4;29;9;7;2;6;3;6;4;8;5;14;4;16;3;6;3;7;5;11;10;33;13;35;10
14;11;;Ser;agt;ACT;0;0;0;0;2;2;0;0;0;0;0;0;4;4;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;3;3;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;2;0;0;0;0;0;0;0;0;1;1;0;0;2;2;0;0;3;3;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;18;11;0;0;0;0;2;2;2;2;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;3;3;1;1;0;0;0;0;0;0;0;0;26;9;0;0;0;0;3;2;5;5;1;1;0;0;0;0;0;0;0;0;0;0;0;0
336;176;;Ser;tct;AGA;5;1;6;2;10;4;37;11;10;7;11;3;13;5;17;3;20;4;15;4;10;5;6;1;19;5;9;4;26;14;24;22;8;2;13;5;8;3;10;3;8;3;9;3;12;4;7;2;8;3;52;14;2;1;9;5;11;5;30;18;15;5;7;5;9;4;29;20;3;3;1;1;9;4;12;6;8;2;5;3;6;2;7;6;10;5;8;3;12;5;4;4;10;7;0;0;2;1;10;3;6;4;10;4;7;2;12;5;10;4;1;1;9;3;22;8;14;6;13;3;11;8;12;6;11;9;8;4;11;3;9;3;10;3;0;0;10;4;15;9;3;1;14;10;14;9;11;6;7;4;12;9;13;9;40;17;13;5
92;26;;Ala;gct;AGC;12;6;17;4;17;14;16;3;20;18;19;3;31;19;29;7;35;2;22;6;14;11;22;17;31;8;15;13;75;56;11;10;28;24;23;16;12;2;23;16;9;1;18;4;27;16;14;10;18;14;53;22;16;7;24;11;23;20;55;31;24;3;46;45;26;16;54;40;5;2;2;1;22;18;15;6;13;9;7;3;8;5;11;8;23;19;15;13;25;10;9;2;19;17;83;51;18;11;21;14;13;8;18;7;15;11;20;4;20;16;1;1;19;16;106;44;20;2;19;9;22;19;31;26;36;31;10;8;27;13;15;12;18;8;32;11;23;18;256;252;18;10;20;16;20;13;12;5;12;10;19;14;11;2;67;17;66;32
315;138;;Pro;cct;AGG;3;1;7;5;9;2;16;5;7;2;15;4;13;2;6;4;25;12;6;4;8;1;7;1;9;2;7;1;12;11;12;8;8;2;10;2;7;1;7;1;6;1;6;1;10;1;10;2;8;2;63;5;4;1;7;1;10;5;55;30;21;5;13;9;9;2;16;7;12;10;2;1;8;2;11;1;7;3;7;2;6;1;7;1;8;3;9;1;7;1;3;3;9;4;19;6;4;1;9;1;7;1;14;4;8;1;14;4;9;4;1;1;7;2;54;18;14;2;13;2;11;3;11;7;33;23;8;1;14;5;9;4;10;2;19;5;9;1;12;5;6;3;11;4;13;9;10;3;7;2;7;3;15;6;60;18;15;4
359;182;;Thr;act;AGT;4;3;8;1;10;6;10;3;13;9;9;7;14;10;22;2;31;5;17;3;8;6;8;7;24;7;10;9;24;17;17;16;10;10;10;7;9;3;11;10;8;1;8;1;9;7;9;7;9;6;99;50;5;3;4;4;9;7;30;20;9;6;15;15;9;6;14;13;11;8;3;1;10;7;12;6;8;5;4;4;5;3;3;3;11;9;10;8;10;2;5;4;12;9;23;16;5;5;8;6;9;8;18;12;7;6;11;3;11;7;0;0;10;6;62;33;7;5;10;2;12;8;10;8;9;7;8;6;12;9;9;7;9;5;27;13;13;7;34;32;8;6;16;15;26;17;18;11;9;7;9;7;10;6;151;75;20;13
5;4;;Tyr;tat;ATA;0;0;0;0;0;0;0;0;0;0;1;1;11;11;0;0;2;2;0;0;0;0;0;0;0;0;1;1;1;1;1;1;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;4;4;0;0;0;0;0;0;1;1;1;1;2;2;0;0;1;1;0;0;1;1;0;0;0;0;0;0;0;0;0;0;3;3;0;0;0;0;0;0;2;2;0;0;0;0;3;3;0;0;2;2;4;4;0;0;0;0;0;0;0;0;0;0;2;2;5;5;0;0;0;0;1;1;2;2;0;0;0;0;0;0;0;0;0;0;1;1;4;4;1;1;0;0;1;1;4;4;0;0;0;0
11;7;;Asp;gat;ATC;0;0;0;0;1;1;0;0;20;19;0;0;6;6;0;0;0;0;0;0;2;2;0;0;0;0;1;1;6;6;0;0;1;1;1;1;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;1;1;0;0;2;2;0;0;0;0;1;1;0;0;1;1;1;1;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;2;2;1;1;0;0;0;0;0;0;1;1;2;2;0;0;1;1;2;2;0;0;1;1;1;1;1;1;2;1;0;0;2;2;1;1;0;0;0;0;10;9;6;6;0;0;1;1;0;0;1;1;1;1;10;10;3;3;0;0;1;1
0;0;;His;cat;ATG;0;0;0;0;0;0;0;0;0;0;3;3;4;4;0;0;1;1;0;0;0;0;0;0;0;0;1;1;1;1;0;0;0;0;0;0;0;0;1;1;0;0;0;0;1;1;0;0;2;2;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;3;3;0;0;0;0;0;0;0;0;1;1;0;0;5;5;0;0;1;1;1;1;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;2;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;2;1;1;0;0;1;1;1;1;1;1
24;15;;Asn;aat;ATT;0;0;0;0;6;6;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;2;2;1;1;0;0;2;2;0;0;0;0;0;0;1;1;1;1;0;0;5;5;1;1;1;1;0;0;2;2;2;2;2;2;0;0;0;0;4;4;3;3;0;0;2;2;0;0;0;0;0;0;0;0;0;0;0;0;6;6;48;44;0;0;3;3;0;0;0;0;1;1;0;0;0;0;0;0;0;0;2;2;0;0;1;1;0;0;0;0;1;1;2;1;2;2;0;0;0;0;1;1;0;0;0;0;0;0;2;2;1;1;3;3;1;1;0;0;0;0;1;1;0;0;1;1;1;1;0;0
241;118;;Leu;ttg;CAA;2;1;4;4;9;7;12;6;8;8;16;7;14;14;11;10;14;12;7;7;5;5;4;4;7;7;7;7;31;30;7;6;6;6;6;6;4;4;8;7;4;4;4;4;6;6;6;6;8;8;7;6;2;2;3;3;9;9;15;15;18;8;5;5;7;7;17;14;4;4;1;1;9;8;4;3;8;8;2;2;3;3;3;3;4;4;6;6;14;9;3;3;6;6;10;10;7;7;3;3;5;5;7;7;4;4;19;5;9;9;1;1;7;6;42;24;3;3;6;3;7;7;7;7;0;0;4;4;9;5;7;7;3;3;18;12;6;5;10;10;4;4;10;10;12;12;10;10;4;4;7;7;14;10;22;16;20;8
227;96;;Val;gtg;CAC;3;1;29;8;9;2;8;2;32;24;11;3;39;27;6;3;15;8;6;2;8;3;9;6;13;5;11;7;1540;1503;6;6;6;3;15;11;7;2;81;76;6;2;11;3;15;6;4;2;9;3;18;11;3;2;7;5;11;6;28;19;13;2;6;3;13;6;35;26;4;3;2;1;12;8;9;3;7;4;3;3;5;1;5;2;12;8;7;4;7;5;4;2;13;9;10;5;9;7;14;4;5;2;9;2;7;2;11;4;12;6;1;1;12;6;71;25;11;5;11;9;18;11;14;10;7;5;7;4;11;3;8;6;10;4;0;0;12;5;39;36;1;1;16;13;16;9;29;13;6;4;22;19;11;5;53;28;16;3
300;139;;Leu;ctg;CAG;4;2;10;2;7;5;3;1;7;4;8;1;6;3;7;5;8;5;5;2;7;3;10;5;12;7;12;9;25;20;6;4;6;2;4;2;8;1;10;4;9;1;8;1;3;2;6;4;5;3;9;3;7;5;7;5;5;4;47;34;7;1;5;4;9;2;10;6;8;8;2;1;6;4;11;6;6;5;4;3;5;2;7;3;10;4;5;3;4;2;6;6;9;6;18;13;2;2;16;6;9;4;16;8;11;3;10;2;12;6;1;1;6;5;75;38;7;2;5;2;11;8;9;7;5;3;13;10;11;4;5;3;9;4;5;3;5;2;4;2;7;4;5;4;37;19;21;7;7;4;6;5;7;3;32;15;13;3
522;174;;Met;atg;CAT;12;8;18;5;24;13;32;16;21;13;56;31;35;19;23;5;29;5;19;3;23;17;16;9;30;5;20;13;94;74;16;11;15;10;26;15;12;4;30;20;12;4;15;4;25;13;16;6;24;15;286;65;6;4;14;6;17;7;154;112;36;14;14;8;20;9;50;34;11;8;4;2;19;14;25;11;14;7;11;4;14;6;14;6;19;11;20;14;41;23;9;3;17;10;32;18;18;14;18;10;13;8;27;7;15;4;60;29;19;11;2;2;15;6;278;91;26;8;24;9;22;13;23;14;13;6;15;8;39;30;15;7;22;8;73;30;23;11;14;7;5;3;21;14;20;12;36;12;12;5;17;11;26;20;138;39;79;48
44;22;;Trp;tgg;CCA;7;4;6;1;10;7;16;5;256;243;18;6;178;173;13;1;22;3;12;3;6;6;6;4;18;4;11;10;30;20;10;9;8;7;8;4;8;2;15;12;9;2;8;2;7;4;7;5;23;22;74;27;3;3;6;3;9;7;29;19;18;3;6;5;7;5;23;17;15;13;1;1;9;6;9;6;8;7;5;3;4;2;6;4;8;6;11;9;14;7;4;3;10;10;14;9;47;45;10;7;6;6;12;5;6;4;18;7;10;6;0;0;8;5;9;8;14;2;9;1;10;9;8;5;8;7;6;5;13;3;8;7;8;5;18;13;7;4;7;4;3;3;13;11;12;7;17;10;6;4;217;208;10;1;33;12;27;7
268;181;;Gly;ggg;CCC;2;1;0;0;7;5;5;1;2148;2045;9;1;1295;1266;5;5;25;14;3;1;9;7;7;5;2;2;5;4;81;74;2;1;6;5;9;6;0;0;326;322;0;0;1;1;8;5;5;3;6;5;4;3;4;3;4;2;9;5;18;14;9;3;3;2;5;3;72;70;2;1;1;1;8;5;8;2;5;3;3;2;3;2;2;2;7;5;4;3;3;2;1;1;10;9;9;5;341;339;16;11;3;1;9;7;5;2;9;5;9;6;0;0;8;5;6;2;7;1;11;8;13;11;16;14;5;4;2;1;6;2;4;4;6;3;4;3;6;4;20;19;4;4;90;88;6;5;4;3;7;6;1766;1696;6;3;105;35;11;2
59;35;;Arg;cgg;CCG;1;1;0;0;7;5;4;3;21;20;6;4;16;13;0;0;24;11;1;1;4;3;3;3;1;1;4;3;2;2;3;3;3;3;4;2;0;0;5;5;0;0;0;0;4;2;3;2;24;24;2;2;0;0;2;2;5;3;10;7;5;4;4;4;4;2;3;3;1;1;1;1;4;2;4;3;3;3;2;2;2;2;2;2;3;3;5;3;3;2;1;1;3;2;14;11;6;6;4;3;3;3;6;6;4;3;8;5;4;2;0;0;4;2;10;6;6;5;5;3;7;3;5;3;3;3;3;2;7;3;3;2;3;3;1;1;3;1;3;3;0;0;7;6;2;2;4;4;3;2;12;12;6;6;8;6;6;3
104;29;;Arg;agg;CCT;3;3;2;2;45;44;8;4;67;67;10;6;116;114;2;1;11;7;4;3;29;28;6;5;3;1;5;4;12;7;10;10;5;4;7;7;3;1;47;46;3;2;4;2;7;6;7;6;53;52;26;5;2;2;3;3;6;5;28;21;13;3;5;4;5;5;16;14;8;8;1;1;7;6;5;4;4;4;3;2;5;5;3;3;5;4;21;21;6;4;4;3;5;4;9;7;33;32;6;5;5;5;18;6;6;5;11;5;5;4;0;0;5;4;50;25;11;4;10;5;9;7;5;4;8;6;6;4;10;3;5;4;4;3;19;12;4;4;6;5;2;2;13;13;11;5;10;5;4;4;54;53;8;4;27;9;11;6
80;44;;Ser;tcg;CGA;2;2;8;1;4;4;7;4;4;4;5;1;7;7;8;4;9;6;6;3;8;7;3;3;15;5;4;4;48;48;10;9;4;3;4;4;4;1;6;6;3;1;5;1;4;4;3;3;5;5;29;6;1;1;2;1;5;5;14;13;6;2;3;3;4;4;4;3;3;3;1;1;4;4;3;3;2;2;1;1;2;2;3;3;3;3;4;4;2;1;2;2;5;5;8;7;3;3;5;4;3;3;6;5;4;3;9;6;3;3;1;1;3;3;35;17;5;4;7;2;6;5;4;4;3;3;4;4;10;6;3;3;3;3;6;5;4;4;6;6;1;1;4;3;3;2;5;5;3;3;4;4;3;1;23;10;6;3
112;26;;Ala;gcg;CGC;3;3;6;2;5;4;7;3;20;19;11;2;16;14;7;5;6;4;4;4;4;4;6;5;8;1;4;3;3858;3758;4;4;5;5;6;5;3;1;17;16;5;2;5;3;8;7;4;4;7;6;56;15;2;2;4;4;5;5;26;20;8;3;6;5;4;4;15;15;3;2;2;1;5;4;6;4;5;3;3;3;3;3;3;3;10;7;5;4;3;3;2;2;5;4;11;8;7;6;4;4;3;2;12;8;4;3;13;5;5;4;1;1;5;4;24;6;5;3;8;2;4;3;5;5;4;4;3;2;11;2;5;4;4;2;7;3;7;6;18;17;3;3;6;5;4;4;6;6;3;2;21;20;5;2;36;21;22;11
180;91;;Pro;ccg;CGG;2;1;13;6;5;2;5;3;4;2;8;3;4;1;4;2;9;5;4;1;4;2;3;1;8;1;4;1;41;41;2;2;3;1;4;2;5;3;4;3;5;3;5;2;3;2;3;1;7;5;18;5;1;1;3;2;4;1;22;12;5;2;3;2;4;2;3;1;4;4;2;1;3;1;3;1;2;1;1;1;3;1;3;1;3;1;2;1;1;1;2;2;4;1;7;3;1;1;4;1;3;1;4;2;4;1;9;6;4;1;1;1;4;1;21;9;4;2;5;5;5;2;5;2;3;1;2;1;8;4;4;1;3;1;9;5;3;1;3;1;2;1;3;1;5;4;6;4;4;3;4;2;4;3;36;17;9;4
66;42;;Thr;acg;CGT;1;1;6;3;10;10;6;4;4;4;6;4;7;7;9;4;10;4;7;5;5;5;4;4;11;3;4;4;137;133;5;5;3;3;5;5;3;1;7;7;4;2;5;1;3;3;4;4;9;9;23;9;1;1;2;2;6;5;30;23;4;2;4;4;5;5;10;10;2;2;2;1;4;4;3;3;3;3;0;0;3;3;2;2;4;4;5;5;1;1;0;0;5;5;10;8;3;3;5;5;3;3;8;7;7;7;5;2;7;7;1;1;6;6;23;12;4;2;6;3;7;7;6;6;4;4;5;5;6;3;5;5;2;2;9;5;4;4;7;7;2;2;4;4;13;10;8;7;4;4;3;3;3;2;29;14;6;2
9;6;;Stp;tag;CTA;0;0;0;0;10;10;0;0;9;9;0;0;13;13;0;0;0;0;0;0;3;3;0;0;0;0;3;3;4;4;2;2;1;1;1;1;0;0;0;0;0;0;0;0;0;0;0;0;12;12;0;0;0;0;0;0;3;3;4;4;0;0;0;0;0;0;0;0;3;2;0;0;2;2;0;0;0;0;0;0;0;0;0;0;0;0;5;5;0;0;0;0;5;5;0;0;3;3;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;2;2;2;2;4;4;0;0;1;1;2;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;8;8;0;0;1;1;4;4
245;87;;Glu;gag;CTC;5;4;15;3;37;34;13;4;468;447;19;3;164;161;30;9;37;3;24;5;22;16;20;14;40;9;15;9;428;406;5;3;5;1;77;73;15;5;45;38;10;4;14;3;51;48;9;4;44;41;53;25;6;2;7;2;9;7;50;30;24;7;4;1;8;2;24;18;8;6;2;1;6;4;13;3;7;2;6;3;6;1;8;4;14;6;19;15;11;3;1;1;17;10;27;14;60;57;19;5;8;2;15;2;11;4;25;11;10;3;1;1;4;1;11;3;21;8;15;8;11;6;13;7;8;3;14;5;26;9;10;7;10;2;29;10;13;8;7;4;3;2;19;19;13;5;21;7;10;7;395;387;26;14;51;19;30;14
266;123;;Gln;cag;CTG;5;3;11;6;25;21;9;5;20;16;11;3;40;32;10;4;11;5;7;3;20;16;11;6;16;5;13;8;18;10;11;10;8;5;12;8;8;4;10;7;8;4;8;5;12;6;8;6;47;45;81;20;3;2;5;3;21;16;45;23;13;5;6;3;13;7;28;23;9;7;3;1;14;10;11;3;7;6;1;1;7;5;12;5;12;7;17;14;5;3;5;5;17;14;19;14;9;6;15;7;9;4;11;4;12;6;10;7;14;10;1;1;11;7;108;48;11;7;10;2;24;20;21;14;10;6;7;3;13;8;11;8;10;3;21;11;12;8;6;2;6;2;10;6;18;5;14;6;6;3;15;8;11;8;40;10;13;7
953;463;;Lys;aag;CTT;6;3;17;2;772;760;19;5;29;24;18;2;40;25;40;4;49;4;30;6;408;398;86;75;37;7;16;12;36;25;9;7;26;19;22;16;13;1;43;30;11;1;16;4;16;8;149;121;887;879;97;23;7;6;6;2;19;14;43;23;22;2;15;11;15;10;36;22;13;9;4;2;16;9;19;9;11;3;3;2;11;7;6;2;26;19;271;266;16;3;13;10;20;14;25;15;16;11;29;20;9;5;43;21;11;7;20;5;17;11;0;0;12;6;23;10;17;2;16;5;27;19;26;18;19;9;13;7;22;7;10;7;32;23;42;12;16;9;12;5;6;5;16;9;21;11;20;7;7;7;19;16;16;11;97;23;127;91
197;87;;Phe;ttc;GAA;5;1;9;1;11;3;21;5;13;9;18;5;30;18;22;6;24;6;15;5;10;6;8;4;24;5;8;4;35;25;22;20;8;3;13;6;8;1;12;7;8;3;9;1;12;4;8;3;12;8;35;12;6;2;10;5;13;8;36;24;22;5;6;2;10;5;32;19;7;6;2;1;10;5;12;4;10;7;6;4;5;2;8;2;7;3;11;5;26;6;6;4;17;13;24;18;6;4;14;8;6;2;23;14;10;6;20;7;14;5;1;1;12;3;57;23;18;3;14;3;18;13;16;11;8;4;10;5;21;5;10;5;13;7;0;0;21;10;10;4;10;4;11;8;19;10;23;13;6;5;12;8;23;12;58;18;25;8
6;4;;Val;gtc;GAC;0;0;0;0;0;0;2;1;1;1;4;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;3;3;16;16;0;0;1;1;1;1;0;0;1;1;0;0;0;0;3;3;0;0;0;0;1;1;1;1;1;1;1;1;0;0;1;1;1;1;0;0;1;1;0;0;0;0;3;3;0;0;0;0;1;1;0;0;0;0;1;1;0;0;3;3;1;1;1;1;1;1;0;0;0;0;0;0;0;0;0;0;17;4;2;2;0;0;1;1;1;1;0;0;0;0;1;1;1;1;0;0;0;0;3;3;1;1;0;0;0;0;1;1;3;3;2;2;0;0;0;0;0;0;0;0;3;3;1;1;0;0;12;1
4;2;;Leu;ctc;GAG;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;2;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;1;1;1;1;1;1;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;1;0;0
10;9;;Ile;atc;GAT;0;0;0;0;0;0;2;1;1;1;2;2;0;0;0;0;1;1;0;0;0;0;0;0;0;0;3;3;0;0;1;1;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;3;3;0;0;0;0;0;0;3;1;0;0;0;0;0;0;6;6;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;3;3;0;0;0;0;1;1;9;9;0;0;0;0;0;0;2;2;0;0;2;2;0;0;1;1;0;0;6;3;3;3;0;0;0;0;0;0;1;1;0;0;2;2;0;0;6;6;5;5;1;1;0;0;0;0;0;0;0;0;2;2;5;5;0;0
136;38;;Cys;tgc;GCA;12;4;5;1;25;12;18;14;24;19;15;9;338;313;16;2;21;5;13;2;21;12;41;17;15;3;32;23;15;10;18;14;34;16;24;20;7;4;22;13;7;3;8;3;25;15;34;20;32;19;107;35;10;5;11;5;35;30;27;19;14;1;23;18;29;23;28;23;17;14;1;1;28;20;46;15;29;10;5;3;27;10;20;9;60;28;25;10;10;3;5;5;23;14;37;19;61;56;25;16;21;11;42;34;10;4;17;9;30;18;0;0;28;15;68;30;14;6;7;5;34;25;33;24;40;14;25;12;13;7;21;11;8;6;31;11;23;13;48;19;9;4;22;20;15;8;15;10;25;19;22;20;11;6;92;46;25;15
836;445;;Gly;ggc;GCC;7;2;15;1;10;2;25;9;64;51;28;9;63;55;21;5;39;14;14;4;11;3;14;5;34;10;15;6;19;7;11;6;11;5;10;2;14;2;19;9;15;2;16;2;10;1;14;4;10;3;12;2;8;1;7;2;13;8;30;13;29;3;10;4;14;5;33;26;7;5;4;1;15;9;24;5;16;9;5;1;8;2;11;3;15;6;9;2;23;4;10;6;13;8;40;23;30;27;21;3;12;5;13;5;17;6;28;9;20;10;0;0;13;7;54;25;26;5;16;3;14;6;13;7;11;4;22;11;24;6;12;5;19;3;42;16;19;10;13;6;12;5;23;18;14;9;18;3;14;5;43;37;17;6;85;15;33;3
24;7;;Arg;cgc;GCG;0;0;0;0;1;1;0;0;0;0;1;1;7;7;0;0;0;0;0;0;0;0;0;0;0;0;3;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;9;9;0;0;0;0;0;0;0;0;2;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;1;1;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;1;1;0;0;1;1;0;0;3;3;0;0
424;263;;Ser;agc;GCT;5;3;6;2;13;10;16;9;13;10;18;6;19;11;9;3;14;5;9;3;8;6;9;6;15;3;8;5;33;23;20;19;10;7;13;6;6;2;10;7;3;2;8;4;12;7;7;3;12;8;30;16;6;3;7;4;8;4;0;0;28;12;7;5;8;6;76;69;8;7;2;2;8;4;9;2;10;4;6;5;5;3;7;5;8;6;12;8;15;9;8;8;9;6;18;12;7;6;10;3;7;5;10;5;7;3;20;6;11;7;1;1;9;5;65;31;16;6;9;3;8;4;9;6;12;7;8;4;13;6;7;4;8;2;17;3;10;4;7;5;5;3;36;34;11;6;19;13;9;7;11;8;9;2;99;59;14;4
2;2;;Ser;tcc;GGA;0;0;0;0;0;0;3;2;1;1;4;3;32;28;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;2;2;41;27;0;0;0;0;0;0;0;0;0;0;0;0;2;2;0;0;0;0;0;0;0;0;0;0;1;1;0;0;3;2;1;1;4;3;4;4;3;3;0;0;0;0;0;0;0;0;4;1;1;1;0;0;0;0;0;0;1;1;0;0;2;2;4;3;0;0;0;0;3;3;1;1;0;0;0;0;0;0;1;1;0;0;0;0;23;18;0;0;0;0;0;0;1;1;3;2;22;12
4;3;;Ala;gcc;GGC;0;0;0;0;0;0;0;0;0;0;0;0;2;2;0;0;0;0;0;0;0;0;1;1;0;0;2;2;168;165;1;1;4;4;0;0;0;0;2;2;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;2;2;0;0;0;0;6;6;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;4;4;0;0;0;0;0;0;1;1;0;0;3;3;0;0;0;0;0;0;0;0;1;1;1;1;0;0;1;1;0;0;0;0;0;0;1;1;1;1;2;2;0;0;11;7;0;0;0;0;0;0;0;0;31;30;0;0;1;1;0;0;0;0;0;0;2;2;0;0;0;0;0;0
12;8;;Pro;ccc;GGG;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;1;0;0;0;0;0;0;0;0;0;0;6;6;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;1;1;0;0;1;1;0;0;2;2;4;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;1;1;0;0;0;0;2;2;0;0;0;0;0;0;0;0;1;1;0;0;0;0;1;1;0;0;1;1;0;0;0;0;1;1;0;0
0;0;;Thr;acc;GGT;0;0;0;0;0;0;1;1;0;0;3;1;1;1;0;0;1;1;0;0;0;0;1;1;0;0;1;1;12;12;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;2;2;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;4;2;0;0;0;0;1;1;0;0;1;1;0;0;1;1;0;0;8;3;0;0;0;0;0;0;19;11;0;0;0;0;0;0;0;0;0;0;0;0;2;2;0;0;0;0;0;0;0;0;5;5;5;5;1;1;0;0;0;0;0;0;1;1;2;2;0;0;13;5
236;100;;Tyr;tac;GTA;6;6;22;21;11;10;83;33;14;14;17;14;39;38;19;6;28;8;19;12;9;9;11;11;24;2;35;25;36;29;5;5;15;11;11;11;9;9;14;11;10;10;9;9;14;10;13;13;10;9;17;13;12;8;16;13;23;22;50;47;21;20;7;7;13;13;19;19;8;8;3;2;31;31;15;13;8;8;6;4;5;5;8;8;11;11;9;9;13;11;7;5;19;19;28;26;16;16;12;12;8;7;18;18;10;10;20;17;24;23;1;1;15;13;90;50;18;16;8;7;29;28;31;29;2;2;9;9;14;14;15;15;11;10;24;17;17;14;9;9;13;10;15;15;13;11;15;14;10;10;18;17;19;19;107;48;21;18
150;43;;Asp;gac;GTC;8;2;20;2;11;6;29;8;45;38;26;5;42;33;34;7;34;3;27;7;13;4;15;5;41;9;14;6;49;35;14;10;10;4;13;7;14;3;21;9;6;1;17;3;10;5;13;4;9;2;184;49;5;4;10;3;15;8;30;15;33;8;10;6;13;3;20;14;19;16;3;1;15;9;24;12;13;12;3;1;8;3;5;2;16;4;8;4;30;14;9;5;13;8;27;14;8;6;23;6;13;4;10;4;14;3;31;11;15;7;1;1;10;4;90;34;34;5;11;3;13;6;17;10;15;3;19;10;24;4;11;5;19;7;82;20;97;83;8;3;7;4;15;11;19;13;24;6;13;7;49;44;23;12;59;13;42;12
387;163;;His;cac;GTG;5;2;21;5;8;1;12;6;11;4;21;7;19;5;21;3;26;5;19;6;9;2;14;3;17;5;9;4;37;27;10;8;8;2;10;2;5;1;10;4;6;2;5;1;11;3;5;1;16;8;52;19;4;4;6;4;7;1;26;16;18;3;7;2;9;1;27;13;5;3;2;1;14;4;9;1;7;1;3;3;7;3;6;3;10;3;7;2;18;8;4;4;11;4;24;20;8;5;9;1;8;1;23;14;5;1;26;10;10;1;0;0;10;1;27;12;13;4;9;3;11;4;10;2;10;1;7;1;15;7;9;4;9;1;26;9;10;3;6;2;5;3;12;5;12;8;19;9;10;5;9;5;14;9;42;18;26;8
1045;470;;Asn;aac;GTT;10;4;12;2;28;18;19;9;24;7;16;6;30;14;23;3;33;5;20;3;21;13;17;9;23;3;27;18;48;32;17;12;18;9;14;4;10;1;23;6;6;1;11;1;17;8;7;2;28;21;123;41;6;5;11;6;29;20;34;18;22;10;9;4;25;17;51;37;9;7;3;1;27;21;13;4;14;4;4;2;9;2;9;5;13;5;12;8;30;16;9;5;21;14;21;11;13;5;26;15;12;4;9;1;14;5;30;13;29;20;1;1;18;10;168;68;24;13;14;5;41;30;33;24;15;7;12;4;16;7;12;7;13;1;39;9;18;8;9;2;8;5;23;18;17;11;23;13;15;9;13;6;21;14;47;19;49;18
73;54;;Leu;tta;TAA;2;2;6;5;5;4;6;3;13;12;4;2;10;10;6;4;7;3;4;3;4;4;4;4;5;5;11;11;13;12;13;13;4;4;5;5;4;4;8;8;3;3;5;4;4;4;3;3;19;19;12;8;11;11;3;3;9;8;16;15;9;5;4;4;4;4;15;14;11;11;1;1;16;15;2;2;3;3;1;1;2;2;3;3;7;5;4;4;8;5;4;3;8;8;10;7;5;5;6;5;3;3;12;12;3;3;4;3;10;10;1;1;7;7;5;3;7;6;2;1;8;8;11;9;3;3;4;4;4;4;9;9;6;6;14;9;4;4;3;3;4;3;6;6;5;4;7;7;42;13;6;6;9;7;46;35;5;3
230;59;;Val;gta;TAC;2;2;3;1;7;7;7;3;18;18;5;3;21;19;6;4;8;5;5;4;5;5;5;4;7;5;6;5;145;116;5;5;3;2;7;7;2;1;16;16;2;1;2;1;6;6;6;6;6;6;12;8;1;1;3;3;8;8;9;9;9;4;4;3;5;4;50;39;7;7;1;1;7;6;5;4;1;1;2;2;3;3;2;2;3;1;6;6;7;5;1;1;6;6;15;13;8;8;8;5;3;2;9;7;4;4;4;1;7;5;1;1;7;5;26;19;8;3;2;1;7;5;10;10;3;2;5;5;4;2;5;4;4;3;11;6;11;9;5;4;2;2;26;26;4;3;9;7;4;3;16;16;5;4;36;19;4;2
244;134;;Leu;cta;TAG;3;3;3;2;5;5;11;5;4;4;10;4;5;5;5;2;8;2;3;1;4;4;4;4;6;4;4;4;20;18;4;4;3;3;4;3;2;1;3;3;2;1;2;1;5;5;3;3;33;33;17;12;0;0;2;2;5;5;24;20;10;3;5;5;3;3;11;11;5;4;1;1;5;5;6;6;4;3;1;1;2;2;2;2;4;4;4;4;10;4;0;0;4;4;7;5;3;3;4;4;3;3;7;6;5;5;10;5;3;3;1;1;3;3;40;14;0;0;6;5;3;3;4;4;1;1;2;2;9;6;4;4;4;4;8;6;5;3;3;3;1;1;5;5;6;6;4;4;5;4;4;4;11;7;25;10;9;5
75;53;;Ile;ata;TAT;1;1;2;2;6;6;5;2;8;8;4;3;8;8;24;16;26;13;7;4;5;5;5;5;7;5;5;5;23;19;13;13;5;5;5;5;2;2;6;6;0;0;2;2;5;5;4;4;9;9;61;15;2;2;2;2;6;6;18;16;8;3;3;3;5;5;7;7;7;7;1;1;7;7;7;7;6;6;1;1;3;3;3;2;5;5;5;5;14;7;1;1;5;5;10;8;5;5;7;7;11;11;25;20;4;4;5;3;7;7;1;1;4;4;10;7;9;3;5;3;6;6;5;5;3;3;5;5;5;4;6;6;4;4;22;16;5;4;4;4;1;1;8;8;5;5;6;6;4;4;5;5;9;6;51;25;5;4
14;12;;SeC;tga;TCA;1;1;0;0;2;2;0;0;17;17;0;0;29;29;0;0;3;2;2;2;1;1;2;2;1;1;2;2;3;3;4;4;1;1;1;1;1;1;1;1;1;1;1;1;4;4;2;2;18;18;1;1;0;0;1;1;3;3;2;2;0;0;7;4;2;2;24;24;4;4;0;0;2;2;0;0;7;4;0;0;0;0;0;0;1;1;1;1;1;1;1;1;3;3;5;5;4;4;1;1;1;1;1;1;1;1;0;0;3;3;0;0;1;1;1;1;1;1;1;1;3;3;2;2;1;1;2;2;1;1;3;3;2;2;0;0;0;0;1;1;1;1;18;18;1;1;1;1;1;1;21;21;1;1;1;1;0;0
47;23;;Gly;gga;TCC;8;3;8;1;7;4;13;2;987;962;9;3;391;385;42;9;66;5;34;6;11;4;6;1;47;11;9;3;66;44;24;14;6;4;4;2;6;2;34;24;5;2;7;2;4;2;7;2;48;46;61;21;4;2;7;4;5;4;39;21;18;2;4;3;9;4;619;616;5;5;1;1;5;3;11;7;10;4;4;2;6;2;7;2;8;2;9;7;15;6;11;6;6;2;15;9;133;132;14;2;9;6;12;6;7;2;10;5;8;2;1;1;4;2;17;4;17;7;9;4;8;5;7;5;9;3;12;7;10;3;6;4;9;3;33;14;10;8;5;3;7;3;1073;1068;16;11;12;5;6;4;833;814;19;12;80;27;11;3
107;50;;Arg;cga;TCG;3;3;8;4;84;82;6;2;9;8;5;1;12;11;10;6;17;6;8;4;15;15;6;4;11;5;4;4;25;22;5;4;4;4;5;4;10;4;8;7;5;3;7;2;4;3;5;4;1201;1194;79;14;2;2;2;2;6;5;17;15;9;3;4;4;6;6;18;14;4;4;1;1;5;5;5;3;5;3;1;1;5;4;3;2;5;4;29;28;5;2;1;1;7;7;7;5;6;6;5;3;4;4;7;7;6;5;4;2;5;5;1;1;6;5;26;9;7;2;7;5;6;5;6;6;5;4;5;5;4;1;4;4;5;3;19;10;5;3;5;5;3;3;12;12;7;7;7;7;5;5;7;7;6;3;33;8;7;4
252;139;;Arg;aga;TCT;3;3;2;2;17;17;10;9;55;55;9;7;44;44;10;3;13;3;8;3;9;9;5;5;12;3;6;6;14;14;26;25;5;5;6;6;3;3;9;9;4;4;3;3;5;5;5;5;54;54;68;25;3;3;4;4;5;5;21;19;18;8;6;6;6;6;90;90;9;9;1;1;6;6;6;6;7;6;3;3;5;4;5;5;6;6;16;15;8;6;4;4;7;7;6;6;22;22;6;6;4;4;27;26;5;5;12;6;6;6;1;1;6;6;18;10;11;6;7;3;8;6;6;6;6;6;6;6;8;6;6;6;5;5;18;9;7;6;5;5;4;4;123;122;10;10;13;12;6;6;48;48;6;3;105;53;9;6
209;117;;Ser;tca;TGA;1;1;2;1;6;6;12;6;5;5;10;5;7;7;8;5;14;7;9;7;5;5;3;3;7;3;5;4;54;51;15;15;3;2;5;3;2;2;6;5;2;2;2;2;4;4;3;3;14;13;62;19;3;3;4;3;5;5;18;15;11;5;3;3;4;4;7;7;6;6;1;1;20;16;6;5;4;2;3;3;2;2;2;2;3;2;4;4;8;4;5;4;6;6;6;6;4;4;4;4;3;2;10;9;3;3;17;7;9;9;1;1;5;5;20;10;9;5;5;3;8;8;9;9;4;4;3;3;13;6;6;5;5;5;15;9;5;5;7;7;4;4;6;6;9;9;8;8;5;5;6;6;8;3;41;19;11;5
368;103;;Ala;gca;TGC;6;6;3;2;9;7;10;3;42;42;13;6;35;31;14;1;11;4;9;2;11;8;15;14;11;5;6;5;5898;3009;15;12;9;7;13;12;2;2;66;64;0;0;2;1;11;9;10;10;10;9;53;17;5;5;7;4;7;6;24;20;17;5;5;4;8;7;53;47;20;19;1;1;11;11;9;6;6;6;6;4;1;1;5;5;11;8;8;7;16;8;5;5;11;11;17;11;12;12;9;9;7;5;11;6;7;6;10;1;10;10;1;1;9;9;31;10;21;8;9;2;9;7;10;9;9;6;8;7;13;5;8;7;7;4;17;7;14;12;39;39;7;5;40;37;11;9;8;5;4;4;36;36;37;21;47;18;15;7
205;97;;Pro;cca;TGG;3;1;8;2;11;8;47;6;5;3;18;10;9;3;41;11;54;6;31;8;8;7;6;2;43;10;6;3;51;44;4;3;4;2;7;3;5;1;7;2;5;2;8;1;7;3;5;2;68;64;29;7;5;4;4;3;7;4;21;15;27;7;5;4;7;3;14;12;10;7;1;1;10;7;8;3;4;1;2;2;3;3;4;3;8;5;7;6;11;3;4;3;5;3;12;9;6;4;5;3;4;3;11;5;4;3;14;9;6;4;1;1;6;4;43;14;23;10;8;2;9;6;10;6;6;2;6;4;11;5;5;3;6;1;21;6;4;2;7;5;1;1;8;5;14;10;9;5;32;32;5;3;16;8;53;17;31;18
290;139;;Thr;aca;TGT;3;2;2;1;9;8;9;5;8;7;10;8;10;8;10;4;15;3;11;2;4;3;4;3;12;5;7;7;206;157;18;17;4;3;8;6;6;2;8;7;5;2;6;2;7;5;6;6;13;12;35;16;4;4;4;3;6;5;30;24;10;5;4;4;6;6;22;17;9;8;1;1;6;6;7;2;6;3;2;2;5;3;3;3;4;3;7;6;10;7;2;2;6;6;18;16;5;4;7;6;6;5;25;22;6;5;16;7;8;8;1;1;7;7;19;9;11;6;5;4;4;4;6;5;5;4;5;5;12;8;7;6;7;3;21;10;8;5;6;4;4;3;18;17;12;9;7;6;4;4;6;5;8;6;91;43;14;6
6;5;;Stp;taa;TTA;0;0;1;1;1;1;1;1;24;24;0;0;4;4;0;0;0;0;0;0;3;3;0;0;0;0;1;1;1;1;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;37;36;0;0;0;0;0;0;2;1;1;1;0;0;0;0;0;0;2;2;1;1;0;0;2;2;0;0;0;0;0;0;0;0;0;0;1;1;2;2;32;30;1;1;3;3;3;3;0;0;0;0;1;1;0;0;0;0;0;0;3;3;0;0;1;1;2;1;1;1;0;0;1;1;2;2;0;0;0;0;1;1;1;1;2;2;1;1;1;1;0;0;0;0;2;2;0;0;0;0;3;3;20;20;1;1;2;2;0;0
225;97;;Glu;gaa;TTC;7;2;11;3;11;7;16;9;2368;2321;15;7;435;424;19;4;36;9;17;3;15;11;7;5;20;4;21;18;66;59;17;17;6;4;11;7;6;1;20;15;5;3;7;2;11;6;8;5;15;11;46;24;4;4;9;7;16;13;51;39;16;4;6;4;8;5;114;107;11;9;1;1;12;10;14;4;12;6;5;4;5;4;9;6;8;3;7;6;22;9;3;3;14;12;16;13;139;136;18;9;5;4;14;8;7;4;16;6;13;6;1;1;13;7;12;9;14;1;7;2;24;15;18;12;10;5;10;9;13;5;21;17;15;5;26;8;235;205;5;3;2;2;114;112;16;13;13;9;9;7;1901;1872;15;10;84;24;22;10
105;46;;Gln;caa;TTG;3;3;4;2;43;42;10;4;10;8;15;8;20;18;24;5;40;11;20;5;43;42;5;4;14;3;7;7;7;6;16;15;4;2;5;3;4;2;5;3;4;2;4;1;6;4;4;3;782;777;60;13;2;2;2;2;11;10;11;8;13;3;3;3;6;4;14;11;10;9;1;1;16;15;7;7;4;3;1;1;3;3;4;3;7;6;37;35;20;10;2;1;10;8;11;8;7;7;5;3;5;4;6;5;5;3;21;12;14;12;1;1;6;4;44;21;11;1;10;7;13;13;20;17;6;5;5;3;11;8;8;8;45;29;17;7;9;6;4;2;2;2;8;6;9;5;10;7;64;51;16;12;10;7;28;8;22;14
525;250;;Lys;aaa;TTT;5;3;8;5;55;50;16;6;86;82;12;9;78;68;16;5;29;9;14;1;34;28;15;10;30;7;16;11;43;38;36;32;11;7;15;11;6;2;18;14;4;2;6;3;15;8;11;5;50;45;61;31;4;2;6;4;14;11;63;46;20;5;8;5;12;8;60;46;20;13;1;1;19;13;13;4;10;7;4;2;3;2;5;2;14;6;31;25;20;13;3;2;23;15;32;25;22;17;12;8;11;7;16;7;9;6;12;8;19;13;0;0;12;6;24;7;18;5;8;4;23;15;20;14;1;1;8;3;11;8;18;14;14;6;57;20;38;23;10;5;4;1;31;26;15;11;20;13;10;6;74;70;11;6;72;21;82;68
12273;5704;;;;total;211;119;422;138;1474;1302;699;268;7113;6771;648;267;4057;3737;743;213;1095;278;596;180;912;773;498;325;827;220;492;346;13732;10330;557;483;384;244;519;358;293;98;1119;929;258;97;332;104;494;300;485;322;3778;3620;2489;795;203;140;283;169;508;379;1497;1045;738;237;367;282;433;269;2004;1751;377;318;83;49;530;398;481;222;353;209;155;105;252;142;258;153;470;285;756;632;684;365;201;149;508;383;859;583;1179;1100;506;281;327;203;674;401;338;188;750;312;531;357;35;35;412;256;2488;1087;647;260;430;181;613;438;613;452;407;247;375;229;628;294;396;279;448;218;1066;427;808;572;804;658;279;201;2019;1908;614;409;616;345;458;323;5873;5642;583;347;2642;1054;1202;601

C42 effectifs[modifier | modifier le wikicode]

  • Lien tableaux: tableaux
  • Légende:
    − 6*6*, pour mgr aac, les décomptes à partir du fichier fasta donne 140 au total (tot) et 13 séquences différentes (diff). Le nombre total de tRNAs représenté dans le tableau récapitulatif de la base gtRNAdb [1] donne seulement 6 pour aac au lieu de 140. Ceci est du aux nombreux pseudo-gènes de ce génome. En comparaison avec les décomptes des autres tRNAs de ce génome, la plupart ont tot=diff. Aussi j'ai décidé d'attribuer au codon acc tot=diff=6.
C42;;;ani;;aor;;bfu;;cal;;cgr;;cjd;;cneg;;cot;;dha;;ecu;;ede;;fgr;;fgr5;;fve;;fvr;;kaf;;kpa;;kla;;kna;;lkl;;lth;;mfa;;mgr;;mth;;ncr;;ncs;;opa;;pch;;pic;;sas;;sce;;spo;;sre;;tbl;;tdl;;tpf;;ttt;;uma;;vda;;vma;;yli;;zro;
aa;gène;tRNA;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff
Phe;ttt;AAA;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Val;gtt;AAC;8;2;10;2;8;8;6;3;10;1;9;2;7;6;4;2;10;2;1;1;2;2;19;8;16;6;7;2;13;2;13;2;5;2;7;1;7;1;14;1;11;2;12;2;6;6;7;3;19;1;13;3;3;1;9;5;7;3;7;2;14;2;9;2;4;4;18;3;12;2;10;1;6;3;4;3;11;9;7;7;24;3;12;2
Leu;ctt;AAG;6;6;0;0;6;5;2;2;0;0;4;1;6;4;1;1;2;2;1;1;1;1;13;2;6;1;6;4;12;5;2;2;2;2;0;0;1;1;;;0;0;4;2;7;6;7;7;17;15;2;2;1;1;6;1;3;1;0;0;0;0;5;2;4;4;0;0;0;0;0;0;5;4;4;3;8;2;5;2;21;12;0;0
Ile;att;AAT;7;5;10;5;8;8;6;6;9;1;6;1;6;5;4;1;9;1;1;1;2;2;13;5;11;5;11;2;11;7;13;1;5;1;7;1;7;1;12;2;10;1;12;2;8;8;8;8;17;17;12;1;4;1;10;3;7;1;9;1;13;1;8;2;4;4;17;4;8;1;10;1;6;6;4;2;9;1;7;7;26;12;11;2
Cys;tgt;ACA;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Gly;ggt;ACC;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0
Arg;cgt;ACG;9;3;12;2;6;5;2;2;4;1;6;3;3;3;2;2;5;2;1;1;2;2;10;2;10;2;13;11;10;2;4;2;2;2;3;1;3;2;5;1;4;2;4;3;6;6;7;7;21;2;5;2;2;2;10;1;3;1;4;1;6;2;8;1;4;4;4;1;4;1;3;1;6;6;4;4;9;5;6;6;1;1;5;2
Ser;agt;ACT;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Ser;tct;AGA;5;1;7;3;7;1;4;1;9;1;7;1;6;5;2;2;6;1;1;1;1;1;11;6;11;6;7;4;10;4;11;3;4;1;6;1;7;1;11;7;9;1;10;3;4;4;5;4;14;2;12;2;2;1;7;4;6;1;7;1;11;2;7;1;2;2;16;3;7;1;8;1;3;1;3;3;6;3;5;3;21;4;12;1
Ala;gct;AGC;8;1;10;2;8;1;6;1;10;1;6;1;8;8;3;1;7;1;1;1;2;2;14;9;13;9;13;3;14;13;12;1;5;1;7;1;7;3;13;2;10;1;12;2;9;9;7;7;19;13;12;2;3;1;8;1;7;1;7;1;11;1;6;1;3;3;19;3;8;1;9;2;7;7;5;4;11;9;7;7;30;2;12;1
Pro;cct;AGG;6;5;9;6;4;4;1;1;1;1;0;0;6;6;1;1;1;1;1;1;0;0;10;6;10;6;4;4;10;9;1;1;2;1;1;1;1;1;1;1;2;1;2;1;5;4;6;6;12;4;1;1;0;0;0;0;1;1;1;1;2;1;6;1;3;3;1;1;1;1;1;1;4;4;4;4;8;4;1;1;21;6;3;2
Thr;act;AGT;6;2;10;2;6;4;4;2;9;1;6;1;5;5;4;1;8;2;1;1;2;2;11;4;11;4;7;7;11;7;11;3;5;2;6;1;7;1;12;3;9;2;10;1;6;5;6;5;12;3;11;1;3;1;12;6;7;1;7;2;11;1;7;2;4;4;15;4;9;2;9;3;4;4;4;1;8;2;4;4;22;1;10;1
Tyr;tat;ATA;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0
Asp;gat;ATC;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
His;cat;ATG;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Asn;aat;ATT;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Leu;ttg;CAA;2;2;0;0;5;5;6;5;8;5;7;1;3;3;1;1;4;1;1;1;1;1;3;3;3;3;4;4;4;4;2;2;3;3;7;3;5;3;11;7;8;7;14;2;2;2;2;2;5;5;9;9;3;1;0;0;8;1;7;3;10;5;4;1;0;0;9;6;8;5;2;1;1;1;0;0;2;2;3;3;3;3;10;10
Val;gtg;CAC;2;2;3;3;2;2;1;1;1;1;3;1;2;2;1;1;1;1;1;1;1;1;3;3;3;3;3;2;3;3;1;1;1;1;2;2;2;2;3;1;3;1;4;2;2;2;3;3;4;4;2;1;1;1;3;1;1;1;4;3;2;1;1;1;1;1;1;1;2;1;1;1;3;3;1;1;2;2;2;2;8;5;4;1
Leu;ctg;CAG;3;3;4;4;1;1;1;1;0;0;1;1;1;1;1;1;1;1;1;1;1;1;5;3;5;3;2;1;5;4;0;0;2;2;0;0;0;0;0;0;3;3;2;1;4;4;4;4;6;6;0;0;1;1;3;3;1;1;1;1;0;0;1;1;2;2;0;0;0;0;0;0;4;4;2;2;4;4;4;4;13;7;0;0
Met;atg;CAT;7;5;8;8;8;5;4;2;7;2;7;4;7;6;4;4;10;9;2;2;2;2;6;6;5;5;15;7;8;6;9;4;4;3;6;3;4;2;10;2;8;4;10;5;8;6;8;7;17;8;9;2;4;2;11;10;6;5;10;6;10;2;7;4;4;4;11;6;7;2;8;4;5;5;4;4;9;5;8;5;18;7;9;2
Trp;tgg;CCA;3;1;4;1;6;2;2;2;5;5;4;1;3;3;1;1;4;1;1;1;0;0;4;4;4;4;4;4;5;5;6;2;3;2;4;3;4;4;5;4;5;3;6;1;4;1;4;3;7;2;7;7;2;2;0;0;4;1;5;2;6;1;3;1;2;2;7;6;4;1;4;3;4;3;2;2;3;3;3;3;13;8;6;4
Gly;ggg;CCC;1;1;1;1;2;2;1;1;1;1;1;1;2;2;0;0;1;1;1;1;2;2;1;1;1;1;8;7;1;1;1;1;1;1;1;1;2;1;2;1;2;2;2;1;3;3;2;2;6;6;2;1;0;0;1;1;1;1;2;2;2;2;1;1;1;1;1;1;1;1;1;1;2;2;1;1;3;3;2;2;0;0;2;2
Arg;cgg;CCG;2;2;3;3;2;2;1;1;1;1;1;1;1;1;1;1;1;1;0;0;1;1;1;1;1;1;2;2;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;1;2;2;2;2;3;2;2;2;1;1;2;1;1;1;2;1;1;1;1;1;0;0;1;1;1;1;1;1;3;2;0;0;2;2;2;2;0;0;1;1
Arg;agg;CCT;2;2;2;2;1;1;1;1;1;1;0;0;3;3;1;1;1;1;1;1;1;1;3;3;3;3;6;4;2;2;1;1;1;1;1;1;1;1;1;1;1;1;2;1;3;3;2;2;5;4;1;1;1;1;2;2;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2;1;1;2;2;3;3;1;1;2;1
Ser;tcg;CGA;2;2;3;3;2;2;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2;2;2;3;3;3;3;1;1;1;1;1;1;1;1;1;1;2;2;2;1;3;3;3;2;4;3;1;1;1;1;2;2;2;2;3;3;1;1;1;1;2;2;2;2;1;1;1;1;3;3;3;3;4;3;3;3;4;3;2;2
Ala;gcg;CGC;3;1;4;3;2;2;0;0;0;0;0;0;2;2;0;0;1;1;1;1;1;1;2;2;3;3;5;2;3;2;0;0;0;0;0;0;1;1;0;0;2;2;2;1;2;2;3;3;5;5;0;0;0;0;2;2;0;0;2;2;0;0;1;1;1;1;0;0;0;0;0;0;3;3;1;1;4;2;2;2;2;1;0;0
Pro;ccg;CGG;2;2;0;0;1;1;0;0;0;0;0;0;1;1;0;0;0;0;1;1;1;1;2;2;2;2;2;2;2;2;0;0;1;1;0;0;0;0;0;0;0;0;0;0;2;2;3;3;4;4;0;0;0;0;1;1;0;0;0;0;0;0;1;1;1;1;0;0;0;0;0;0;3;3;1;1;2;2;1;1;2;2;0;0
Thr;acg;CGT;2;2;2;2;0;0;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;3;2;3;2;4;2;2;2;1;1;1;1;1;1;1;1;1;1;1;1;2;1;2;2;3;3;3;3;2;2;1;1;2;2;1;1;2;2;1;1;1;1;1;1;1;1;1;1;1;1;2;2;1;1;3;3;2;2;2;2;2;2
Stp;tag;CTA;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Glu;gag;CTC;8;3;11;3;9;9;1;1;3;1;9;1;10;10;1;1;1;1;1;1;2;2;19;7;13;5;12;11;16;12;2;1;4;1;2;1;3;1;3;2;11;3;8;2;9;9;8;8;24;12;1;1;3;2;10;1;2;1;8;1;2;1;6;1;4;4;1;1;4;2;1;1;7;6;5;5;12;2;9;9;27;16;4;1
Gln;cag;CTG;5;4;7;4;2;2;1;1;2;1;2;2;3;1;1;1;1;1;1;1;1;1;7;1;7;1;6;6;8;2;1;1;2;2;1;1;2;2;1;1;5;1;4;1;6;6;5;5;11;10;1;1;1;1;5;1;2;2;4;3;1;1;2;1;2;2;1;1;2;1;1;1;4;4;3;3;6;3;4;4;15;15;3;2
Lys;aag;CTT;8;1;11;3;10;9;2;2;12;1;8;1;7;2;3;3;10;4;1;1;0;0;16;4;12;4;11;9;15;5;12;1;5;2;9;2;7;1;14;1;15;2;10;2;9;7;9;9;24;4;14;1;3;1;9;1;9;3;9;1;14;1;9;3;5;5;15;2;10;3;9;2;6;6;5;5;12;1;9;7;34;24;14;1
Phe;ttc;GAA;5;3;7;6;7;5;5;4;6;1;8;4;5;5;2;2;9;4;1;1;1;1;11;8;9;7;15;15;10;9;9;7;5;1;5;1;6;5;8;4;7;7;10;1;7;5;5;4;12;4;10;7;3;1;5;2;6;2;7;4;10;5;5;2;4;4;12;7;6;4;9;3;5;5;3;2;7;5;4;3;17;11;8;4
Val;gtc;GAC;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Leu;ctc;GAG;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;1;1;2;1;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;1;1;1;1;0;0;0;0;6;2;1;1;1;1;0;0;0;0;0;0;0;0;0;0;1;1
Ile;atc;GAT;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;1;1;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1
Cys;tgc;GCA;3;2;4;4;5;5;2;2;3;1;3;2;3;3;0;0;4;1;1;1;1;1;5;3;5;3;4;4;5;4;5;1;2;1;3;1;4;3;5;2;4;2;4;2;3;3;3;2;7;2;4;1;1;1;3;3;3;1;3;2;4;1;3;2;2;2;0;0;3;1;4;1;3;2;2;2;5;4;3;2;8;1;4;1
Gly;ggc;GCC;11;1;15;1;8;8;5;1;12;1;11;1;9;5;2;1;11;1;1;1;2;2;14;12;15;13;11;11;14;3;17;1;5;2;7;1;9;2;15;1;15;2;16;1;14;14;11;2;26;2;13;1;4;1;11;1;10;1;11;1;16;1;8;1;6;5;23;1;11;1;13;1;10;3;6;6;13;1;9;9;30;1;17;2
Arg;cgc;GCG;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Ser;agc;GCT;4;4;6;5;5;5;2;2;3;2;3;1;2;2;1;1;3;2;1;1;1;1;8;7;8;7;4;1;7;6;4;2;2;2;2;2;3;1;4;4;3;3;6;3;3;3;5;5;6;6;4;3;2;1;4;3;2;2;4;3;4;2;3;1;0;0;6;6;3;1;3;3;3;3;2;1;5;3;3;3;6;6;5;5
Ser;tcc;GGA;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0
Ala;gcc;GGC;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Pro;ccc;GGG;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Thr;acc;GGT;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Tyr;tac;GTA;6;5;13;11;6;5;4;4;6;1;6;4;4;4;3;2;6;3;1;1;1;1;8;4;6;3;6;6;8;7;9;3;4;4;5;1;5;4;7;7;6;5;10;2;5;5;6;4;10;6;9;2;2;2;5;3;5;4;5;3;8;2;4;3;2;2;9;7;7;4;6;2;4;4;3;1;6;6;5;3;14;10;7;1
Asp;gac;GTC;8;6;13;8;9;6;6;1;9;1;8;3;2;2;5;1;10;2;1;1;2;2;14;1;10;1;7;7;14;1;13;1;6;1;8;1;8;2;13;1;10;1;14;1;10;5;10;10;18;8;14;1;3;1;9;2;8;1;11;2;16;2;8;1;3;3;19;3;9;1;12;2;6;6;5;3;10;6;6;5;28;25;14;4
His;cac;GTG;5;2;8;7;4;4;3;3;6;2;6;2;4;4;1;1;6;2;1;1;2;2;7;5;7;5;7;7;6;5;6;1;3;1;4;1;4;1;6;1;5;3;8;1;4;1;4;4;9;6;8;1;2;1;11;5;4;1;6;3;7;1;4;1;2;2;7;1;4;1;5;1;3;3;1;1;6;1;6;6;12;5;6;2
Asn;aac;GTT;6;6;8;4;6;5;3;3;9;3;7;2;4;4;3;1;9;2;2;2;1;1;9;6;9;5;12;8;8;5;10;1;4;1;6;1;6;1;9;1;7;1;12;4;6*;6*;6;2;12;3;10;2;2;1;6;2;7;2;8;2;10;1;6;2;4;4;11;1;7;2;9;2;3;3;4;3;6;6;5;5;16;9;9;2
Leu;tta;TAA;1;1;3;3;2;2;5;2;3;1;1;1;1;1;3;1;10;2;1;1;1;1;2;2;1;1;1;1;2;2;14;3;1;1;3;2;3;1;3;1;2;1;4;2;1;1;1;1;1;1;7;2;1;1;2;2;3;1;3;2;7;1;2;2;0;0;12;2;3;1;9;1;7;7;0;0;1;1;0;0;1;1;4;1
Val;gta;TAC;1;1;2;2;2;2;1;1;2;2;2;2;0;0;1;1;2;2;1;1;1;1;2;2;2;2;3;3;2;2;2;2;1;1;1;1;1;1;1;1;1;1;2;1;1;1;2;2;2;2;2;2;0;0;1;1;2;2;3;2;2;1;2;1;1;1;2;2;1;1;2;1;1;1;1;1;1;1;1;1;2;1;2;2
Leu;cta;TAG;2;2;1;1;1;1;0;0;4;1;3;2;0;0;0;0;1;1;1;1;1;1;2;2;2;2;2;2;2;2;2;2;1;1;2;2;3;2;3;3;3;3;0;0;1;1;1;1;2;2;3;3;1;1;0;0;0;0;4;3;3;2;1;1;1;1;2;2;4;4;2;2;1;1;2;2;1;1;3;3;2;2;5;5
Ile;ata;TAT;1;1;2;2;1;1;1;1;2;2;1;1;1;1;1;1;2;2;1;1;1;1;3;3;3;3;2;2;1;1;2;2;1;1;1;1;2;2;1;1;1;1;4;3;1;1;1;1;1;1;2;2;1;1;2;2;1;1;1;1;2;2;1;1;1;1;2;2;1;1;2;1;1;1;1;1;0;0;1;1;1;1;1;1
SeC;tga;TCA;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;1;1;0;0;1;1;1;1;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;1;1;0;0;1;1;0;0;0;0;1;1;0;0;0;0;0;0;0;0;2;2;1;1;0;0;0;0;0;0
Gly;gga;TCC;3;3;4;2;7;4;2;1;2;1;4;2;3;2;1;1;5;3;1;1;1;1;6;6;5;5;9;5;5;2;4;3;3;3;2;2;1;1;2;1;3;1;6;2;3;3;4;3;4;2;3;1;2;2;5;4;3;2;2;1;3;1;3;3;2;2;3;2;2;1;2;2;2;2;2;2;3;3;3;1;11;10;5;1
Arg;cga;TCG;2;2;2;1;4;3;0;0;0;0;0;0;5;1;0;0;0;0;1;1;2;2;9;7;9;7;8;4;7;6;0;0;1;1;0;0;0;0;0;0;0;0;0;0;2;2;1;1;2;2;0;0;0;0;2;2;0;0;0;0;0;0;1;1;1;1;0;0;0;0;0;0;1;1;3;3;2;2;2;1;25;11;0;0
Arg;aga;TCT;2;1;2;2;5;5;5;1;9;1;7;2;1;1;2;1;10;3;1;1;0;0;3;3;3;3;2;2;2;2;11;2;4;2;7;2;6;2;12;2;9;3;10;1;1;1;1;1;5;4;10;1;3;1;0;0;7;2;7;2;11;1;2;2;1;1;13;3;7;2;8;2;1;1;1;1;3;3;1;1;4;1;8;1
Ser;tca;TGA;1;1;1;1;4;3;3;2;2;1;3;3;1;1;2;2;4;3;1;1;1;1;2;2;2;2;2;2;2;2;4;1;2;1;2;1;1;1;2;1;2;1;4;1;2;2;3;3;3;3;4;2;1;1;1;1;2;1;3;3;3;1;2;2;1;1;4;1;2;1;2;1;1;1;1;1;3;3;1;1;2;2;3;3
Ala;gca;TGC;2;2;3;2;5;5;2;2;5;1;3;2;1;1;2;1;5;2;1;1;1;1;4;4;3;3;9;6;3;2;5;2;2;1;3;1;1;1;4;1;3;3;8;2;3;3;2;2;3;3;5;2;2;1;2;2;3;1;6;5;5;1;2;1;1;1;5;2;4;1;3;1;2;2;1;1;2;2;2;2;4;1;9;3
Pro;cca;TGG;2;2;3;3;8;8;4;4;7;2;7;1;1;1;3;3;7;5;1;1;1;1;3;3;3;3;4;3;3;3;10;9;4;1;7;6;6;4;10;5;8;7;8;6;2;2;2;2;4;3;10;8;3;2;0;0;6;4;8;5;10;7;2;2;1;1;13;13;6;2;7;7;2;2;1;1;3;3;2;2;3;1;10;1
Thr;aca;TGT;2;2;2;2;3;3;2;1;3;1;3;2;1;1;2;1;3;3;1;1;1;1;4;3;4;3;3;3;4;3;3;1;1;1;2;1;2;2;2;1;2;2;4;1;2;2;2;2;3;3;3;2;1;1;3;3;2;1;3;3;4;2;2;2;1;1;3;2;2;1;2;2;1;1;1;1;3;3;3;3;3;3;2;1
Stp;taa;TTA;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Glu;gaa;TTC;3;3;6;5;6;6;6;5;9;1;5;2;3;3;2;2;9;2;1;1;1;1;5;4;4;3;6;5;5;5;15;1;5;2;8;1;6;2;13;1;6;2;8;2;3;2;2;2;5;2;13;2;2;1;3;3;8;1;4;2;14;2;4;1;2;2;16;5;8;1;11;3;2;2;2;2;2;2;3;3;6;3;10;2
Gln;caa;TTG;2;2;4;3;6;4;5;5;6;1;6;1;2;2;3;3;7;2;1;1;1;1;5;5;5;5;4;4;4;4;9;2;3;1;6;3;4;1;10;2;5;3;8;2;2;2;2;2;3;3;9;1;2;1;3;3;5;2;4;1;9;3;4;2;3;3;10;3;6;2;7;2;2;2;2;2;2;2;2;2;3;3;10;1
Lys;aaa;TTT;2;2;3;3;3;3;5;2;3;1;5;3;1;1;4;1;8;3;1;1;1;1;3;3;2;2;6;6;2;2;8;7;3;3;4;2;4;3;5;4;4;2;6;4;2;1;3;2;2;2;8;6;2;2;1;1;3;3;4;3;7;2;3;2;1;1;9;3;5;3;6;2;2;2;1;1;2;2;0;0;4;4;7;2
;;total;181;112;246;143;214;175;125;85;207;57;193;71;148;126;81;55;219;89;46;46;55;55;308;182;273;170;286;214;287;183;267;86;123;67;162;62;159;74;258;87;230;98;288;80;190;168;193;165;401;207;270;95;80;47;197;97;170;66;212;96;275;70;168;68;96;95;328;118;193;66;206;71;156;139;109;94;229;137;165;147;510;247;272;87

B42 effectifs[modifier | modifier le wikicode]

B42;;;cbl;;spl;;pdi;;ppoy;;sbn;;eal;;eco;;sbz;;eno;;kpn;;bcef;;bcoh;;blr;;dzc;;eclx;;gmc;;ksa;;mme;;mvs;;pge;;pha;;pse;;sfr;;vag;;vau;;vha;;vvm;;yrb;;bae;;saci;;sep;;hmr;;bbd;;lpl;;sty;;sma;;sho;;ksk;;ype;;pdix;;hmo;;vpf;
aa;tRNA;gène;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff
Phe;AAA;ttt;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0
Val;AAC;gtt;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Leu;AAG;ctt;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Ile;AAT;att;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Cys;ACA;tgt;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Gly;ACC;ggt;0;0;2;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Arg;ACG;cgt;1;1;7;2;3;3;4;1;6;1;3;1;4;1;4;1;4;1;4;1;3;2;3;1;5;2;3;1;4;2;4;3;4;1;3;1;5;2;4;1;4;1;3;2;4;2;6;1;5;3;7;1;6;2;3;1;2;1;1;1;2;2;0;0;1;1;2;1;4;2;1;1;1;1;2;1;2;2;1;1;3;1;7;1
Ser;ACT;agt;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Ser;AGA;tct;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0
Ala;AGC;gct;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Pro;AGG;cct;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Thr;AGT;act;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0
Tyr;ATA;tat;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Asp;ATC;gat;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;2;0;0;0;0;0;0;0;0;0;0
His;ATG;cat;0;0;2;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Asn;ATT;aat;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Leu;CAA;ttg;1;1;1;1;1;1;3;2;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;1;3;2;1;1;2;2;1;1;1;1;2;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2;1;1;2;2;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2
Val;CAC;gtg;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;1;1;0;0;0;0;0;0;4;4;2;1;2;1;0;0;0;0;1;1;0;0
Leu;CAG;ctg;0;0;0;0;2;1;3;2;2;2;4;2;4;3;4;2;4;3;4;2;0;0;1;1;1;1;8;2;4;3;1;1;4;4;0;0;0;0;4;1;0;0;3;1;1;1;0;0;0;0;0;0;0;0;4;2;0;0;2;2;0;0;1;1;0;0;1;1;4;2;1;1;1;1;1;1;2;2;0;0;4;3;0;0
Met;CAT;atg;7;5;13;5;4;3;7;6;10;6;9;5;8;5;6;3;6;3;7;3;8;6;6;3;8;5;6;4;8;4;6;4;6;3;11;8;11;3;7;3;7;3;4;3;9;5;7;3;8;4;10;5;10;4;7;3;6;3;6;2;4;3;3;3;3;3;5;4;6;3;6;3;8;5;5;3;6;3;10;5;8;4;11;4
Trp;CCA;tgg;1;1;2;1;2;2;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2;1;1;2;2;1;1;1;1;1;1;1;1;1;1;2;1;1;1;2;1;1;1;1;1;2;1;2;1;2;1;2;1;1;1;2;2;1;1;1;1;1;1;1;1;2;2;1;1;1;1;1;1;1;1;1;1;1;1;2;2;2;1
Gly;CCC;ggg;1;1;0;0;1;1;0;0;0;0;1;1;1;1;1;1;2;2;1;1;0;0;1;1;0;0;1;1;1;1;1;1;1;1;0;0;0;0;1;1;0;0;1;1;0;0;0;0;0;0;0;0;0;0;1;1;0;0;1;1;0;0;1;1;0;0;1;1;1;1;1;1;1;1;2;2;1;1;0;0;1;1;0;0
Arg;CCG;cgg;0;0;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;0;0;1;1;1;1;1;1;1;1;1;1;1;1;0;0;2;2;1;1
Arg;CCT;agg;1;1;1;1;1;1;0;0;1;1;1;1;1;1;2;2;1;1;1;1;0;0;1;1;0;0;1;1;1;1;0;0;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2;1;1;0;0;1;1;1;1;1;1;2;2;2;2;2;2;1;1;1;1;0;0;1;1;1;1
Ser;CGA;tcg;0;0;0;0;1;1;1;1;0;0;1;1;1;1;1;1;0;0;1;1;0;0;1;1;0;0;1;1;0;0;1;1;1;1;0;0;0;0;1;1;0;0;1;1;0;0;0;0;0;0;0;0;0;0;1;1;0;0;2;2;0;0;1;1;0;0;1;1;2;2;4;4;2;2;1;1;0;0;0;0;1;1;0;0
Ala;CGC;gcg;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;3;2;0;0;1;1;0;0;1;1;0;0;1;1;1;1;1;1;0;0;0;0;1;1;0;0
Pro;CGG;ccg;0;0;0;0;1;1;0;0;0;0;1;1;1;1;1;1;0;0;1;1;0;0;1;1;0;0;1;1;0;0;1;1;1;1;0;0;0;0;1;1;0;0;2;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;1;1;1;1;1;1;1;1;1;1;0;0;0;0;2;2;0;0
Thr;CGT;acg;0;0;0;0;1;1;1;1;0;0;1;1;2;2;1;1;1;1;1;1;0;0;1;1;0;0;1;1;1;1;1;1;1;1;0;0;0;0;1;1;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;1;1;1;1;0;0;1;1;1;1;1;1;1;1;2;2;0;0;0;0;1;1;0;0
Stp;CTA;tag;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Glu;CTC;gag;1;1;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;1;1;0;0;1;1;0;0;3;1;3;2;3;1;0;0;0;0;0;0;0;0
Gln;CTG;cag;1;1;0;0;2;1;0;0;0;0;2;1;2;1;2;1;2;2;2;1;0;0;0;0;0;0;2;1;2;2;0;0;2;2;0;0;0;0;3;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;1;1;0;0;1;1;0;0;1;1;1;1;2;2;2;2;2;2;1;1;0;0;0;0;0;0
Lys;CTT;aag;2;2;0;0;2;2;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;1;1;0;0;0;0;0;0;0;0;0;0;1;1;0;0;1;1;0;0;0;0;0;0;0;0;0;0;1;1;0;0;1;1;0;0;1;1;0;0;1;1;0;0;3;1;3;1;4;1;1;1;0;0;0;0;0;0
Phe;GAA;ttc;3;1;4;1;2;2;3;1;3;1;2;1;2;1;2;1;2;1;2;1;3;2;3;3;3;2;2;1;2;1;2;1;2;1;2;1;4;1;2;2;3;2;2;1;2;1;4;2;3;2;4;2;4;2;2;1;3;2;1;1;2;2;1;1;1;1;2;1;2;1;1;1;1;1;1;1;2;1;3;1;3;2;4;2
Val;GAC;gtc;0;0;2;1;1;1;1;1;2;1;2;2;2;2;2;2;2;2;3;3;0;0;1;1;2;2;2;2;2;2;1;1;2;2;1;1;2;2;3;3;2;2;1;1;2;1;2;2;2;2;2;2;2;2;3;1;1;1;3;2;0;0;1;1;0;0;0;0;2;2;3;3;3;2;4;3;2;2;0;0;4;1;2;2
Leu;GAG;ctc;1;1;1;1;1;1;2;2;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2;1;1;2;1;2;1;1;1;1;1;2;2;1;1;1;1;1;1;0;0;1;1;2;1;2;2;2;1;1;1;0;0;2;1;2;1
Ile;GAT;atc;2;2;3;1;7;1;3;2;3;1;3;1;3;1;3;1;3;1;3;1;4;1;3;2;4;2;3;1;3;1;4;3;3;1;3;1;11;1;3;1;2;1;8;1;4;2;7;1;3;1;5;1;8;1;3;1;3;2;2;2;2;1;2;1;1;1;3;1;3;1;1;1;1;1;1;1;3;1;1;1;4;1;3;1
Cys;GCA;tgc;2;2;4;1;2;2;2;2;2;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2;1;1;1;1;2;2;1;1;2;1;3;1;1;1;2;1;1;1;2;2;4;1;2;2;5;3;3;2;1;1;1;1;2;2;1;1;1;1;1;1;1;1;1;1;2;2;2;2;4;4;1;1;2;1;3;3;4;2
Gly;GCC;ggc;3;1;8;1;3;1;5;2;6;1;3;1;4;1;4;1;4;1;4;1;4;2;4;1;5;1;4;1;4;1;5;3;4;1;4;1;5;1;4;1;6;2;2;1;5;2;9;1;7;2;10;1;8;1;4;1;2;1;2;2;2;1;1;1;1;1;2;1;3;1;3;2;3;1;4;2;2;1;2;1;7;5;11;1
Arg;GCG;cgc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Ser;GCT;agc;2;1;3;1;1;1;3;2;2;1;1;1;1;1;1;1;1;1;1;1;2;1;2;2;2;1;1;1;1;1;2;2;1;1;1;1;2;1;1;1;2;1;1;1;2;1;2;1;2;1;2;1;2;1;1;1;2;1;2;2;1;1;1;1;1;1;1;1;1;1;2;2;1;1;1;1;1;1;2;1;2;1;2;1
Ser;GGA;tcc;1;1;1;1;2;1;3;1;1;1;2;1;2;1;2;1;2;1;2;1;1;1;1;1;2;2;2;1;2;1;1;1;2;2;1;1;1;1;2;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2;1;1;2;2;1;1;1;1;1;1;1;1;2;1;1;1;1;1;1;1;2;2;1;1;2;2;1;1
Ala;GGC;gcc;0;0;2;1;1;1;1;1;2;1;2;1;2;1;2;1;2;1;2;1;0;0;1;1;1;1;6;1;2;2;1;1;2;1;1;1;1;1;2;1;1;1;3;2;2;2;1;1;1;1;1;1;0;0;2;1;1;1;1;1;0;0;1;1;1;1;0;0;2;1;2;1;2;1;4;2;2;1;0;0;5;1;1;1
Pro;GGG;ccc;0;0;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;0;0;0;0;1;1;1;1;1;1;0;0;1;1;1;1;0;0;1;1;1;1;1;1;1;1;0;0;1;1;0;0;1;1;2;2;0;0;2;1;0;0;1;1;1;1;0;0;1;1;3;1;3;1;1;1;1;1;0;0;3;2;0;0
Thr;GGT;acc;1;1;1;1;1;1;1;1;2;2;2;2;2;2;2;2;2;1;2;1;1;1;1;1;2;2;2;2;2;1;1;1;2;1;1;1;1;1;2;1;1;1;2;2;1;1;2;2;2;2;2;2;2;2;2;2;1;1;1;1;0;0;1;1;1;1;1;1;2;2;2;2;2;2;2;1;2;2;0;0;3;2;2;2
Tyr;GTA;tac;2;1;6;1;3;1;4;1;4;1;3;2;3;2;3;2;3;2;3;1;3;1;2;2;4;1;2;1;3;3;2;1;3;2;2;1;5;1;3;2;3;1;2;1;4;1;3;1;5;1;5;1;4;1;3;1;2;1;1;1;2;1;1;1;1;1;2;1;2;2;1;1;1;1;1;1;2;1;3;1;4;2;7;2
Asp;GTC;gac;4;2;6;1;3;2;5;1;4;1;3;1;3;1;3;1;3;1;3;1;6;1;4;4;6;2;3;1;3;1;4;3;3;1;7;2;5;1;3;1;11;1;7;2;4;2;6;1;5;1;6;1;7;1;3;2;4;1;2;1;3;3;1;1;3;2;3;1;3;1;2;1;2;1;2;1;3;2;4;2;4;2;7;1
His;GTG;cac;2;1;2;1;2;1;2;1;2;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2;3;2;1;1;1;1;2;1;1;1;1;1;4;3;1;1;2;2;2;1;2;1;2;2;2;1;2;1;2;1;1;1;2;1;2;2;2;2;1;1;1;1;2;1;1;1;1;1;1;1;1;1;1;1;2;1;2;2;2;1
Asn;GTT;aac;3;2;7;1;3;2;6;1;5;1;4;1;4;1;4;1;4;1;4;1;5;2;4;2;5;2;3;1;5;2;4;3;4;1;2;1;6;1;4;1;4;1;3;1;5;3;5;1;4;1;5;3;5;1;3;1;4;2;2;1;3;2;1;1;1;1;5;3;5;2;2;1;2;1;2;2;3;1;4;2;4;1;5;3
Leu;TAA;tta;2;1;4;1;1;1;1;1;3;1;1;1;1;1;1;1;1;1;1;1;2;1;2;2;2;2;1;1;1;1;2;1;1;1;2;1;5;2;1;1;3;1;1;1;3;2;3;2;2;1;3;1;2;2;1;1;2;2;1;1;2;1;1;1;1;1;2;1;1;1;1;1;1;1;1;1;1;1;5;2;1;1;3;2
Val;TAC;gta;5;1;11;1;3;1;6;2;4;1;4;3;5;1;4;1;4;2;5;1;5;1;4;3;5;1;8;1;4;2;4;2;4;1;6;1;7;1;4;1;7;2;5;2;6;2;2;1;2;1;4;1;1;1;3;1;3;1;1;1;3;2;1;1;2;1;3;1;3;2;1;1;1;1;1;1;3;1;6;4;2;1;4;1
Leu;TAG;cta;2;1;5;1;1;1;2;1;2;2;1;1;1;1;1;1;1;1;1;1;2;1;2;2;4;1;1;1;1;1;2;2;1;1;2;1;5;1;1;1;4;2;1;1;2;2;3;2;4;3;5;2;7;3;1;1;2;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;3;2;1;1;11;3
Ile;TAT;ata;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
SeC;TCA;tga;1;1;1;1;0;0;0;0;1;1;1;1;1;1;1;1;1;1;1;1;0;0;0;0;0;0;0;0;1;1;0;0;1;1;0;0;0;0;1;1;0;0;1;1;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;1;1;0;0;1;1;1;1;1;1;0;0
Gly;TCC;gga;4;1;1;1;2;1;4;2;1;1;2;1;1;1;1;1;1;1;1;1;4;2;2;1;4;1;1;1;1;1;3;2;1;1;1;1;4;3;1;1;1;1;1;1;1;1;2;1;2;1;4;2;2;1;1;1;3;2;1;1;5;4;1;1;1;1;3;2;1;1;3;3;2;2;1;1;1;1;5;1;1;1;2;1
Arg;TCG;cga;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;2;0;0;1;1;1;1;0;0;0;0;0;0;0;0;3;1;0;0;0;0;0;0;0;0
Arg;TCT;aga;3;1;1;1;1;1;2;1;1;1;2;2;1;1;2;2;1;1;1;1;0;0;1;1;2;1;1;1;1;1;2;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2;1;1;2;2;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2;1;1;1;1;1;1;1;1;4;2;1;1;1;1
Ser;TGA;tca;2;1;4;2;2;2;1;1;4;2;1;1;1;1;2;2;2;2;1;1;3;3;2;2;3;1;1;1;2;1;2;1;1;1;1;1;8;2;1;1;4;2;1;1;3;1;4;1;3;1;4;1;3;1;2;2;2;2;1;1;3;2;1;1;1;1;1;1;1;1;2;2;1;1;1;1;2;2;3;1;1;1;4;1
Ala;TGC;gca;3;1;3;1;7;2;5;3;3;1;3;1;3;1;3;1;3;1;3;1;5;2;4;2;4;2;3;1;3;1;5;2;3;1;3;1;11;1;3;1;3;1;8;1;3;1;8;1;4;2;7;2;9;3;3;1;3;2;2;2;3;1;2;1;1;1;2;1;3;1;1;1;1;1;1;1;3;1;5;1;2;1;5;1
Pro;TGG;cca;3;1;3;1;1;1;4;2;3;1;1;1;1;1;1;1;2;1;1;1;3;2;2;2;4;2;1;1;2;1;3;1;1;1;2;1;4;1;1;1;3;1;1;1;4;1;3;1;3;1;3;1;3;1;2;1;1;1;1;1;2;2;1;1;2;2;2;1;1;1;1;1;1;1;1;1;2;1;3;1;1;1;3;1
Thr;TGT;aca;4;3;4;1;3;1;4;2;3;1;2;1;1;1;1;1;1;1;1;1;3;2;2;2;6;1;1;1;1;1;3;2;1;1;4;2;4;1;1;1;3;1;1;1;2;1;5;1;4;2;5;1;4;1;2;1;3;3;1;1;3;2;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;1;5;1;2;2;5;1
Stp;TTA;taa;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Glu;TTC;gaa;3;2;13;1;2;2;6;1;7;1;4;2;4;1;4;1;4;1;4;1;7;2;4;2;6;1;4;1;4;1;5;1;4;1;3;1;0;0;4;2;7;2;5;4;6;1;3;1;4;1;5;1;1;1;4;1;6;2;2;1;3;3;1;1;2;1;2;1;4;1;1;1;1;1;1;1;3;1;5;1;6;2;6;1
Gln;TTG;caa;2;1;5;1;1;1;4;1;3;2;2;1;2;1;2;1;2;1;2;1;5;2;3;3;4;2;1;1;2;1;4;3;2;1;3;1;4;1;1;1;4;1;1;1;3;1;1;1;2;2;2;2;5;1;2;1;4;3;3;3;2;2;1;1;1;1;2;2;2;1;1;1;1;1;1;1;1;1;3;1;4;1;6;2
Lys;TTT;aaa;4;1;12;1;2;2;6;2;10;4;4;1;6;1;5;1;5;1;6;1;6;2;4;2;6;1;3;1;5;1;4;2;5;1;4;1;7;1;5;1;8;2;2;1;6;1;2;1;2;1;4;1;1;1;5;1;3;1;0;0;3;2;1;1;2;1;2;1;4;2;1;1;1;1;1;1;4;2;5;1;5;1;4;1
;;total;81;47;147;44;83;56;109;55;108;49;85;52;87;50;85;49;83;48;86;45;92;47;84;64;113;53;89;47;86;52;91;61;82;49;81;42;132;41;85;48;106;44;89;52;97;50;105;41;93;49;121;47;112;46;83;47;75;48;71;61;61;48;49;47;40;36;70;50;81;53;77;63;74;59;77;58;70;48;90;39;109;65;131;47

A10 effectifs[modifier | modifier le wikicode]

A10;;;fpl;;hbo;;mac;;mbw;;mhor;;mls;;mmet;;mpl;;mru;;nou;
aa;tRNA;gène;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff;tot;diff
Phe;AAA;ttt;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Val;AAC;gtt;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Leu;AAG;ctt;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Ile;AAT;att;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Cys;ACA;tgt;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Gly;ACC;ggt;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Arg;ACG;cgt;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0
Ser;ACT;agt;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Ser;AGA;tct;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Ala;AGC;gct;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Pro;AGG;cct;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Thr;AGT;act;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Tyr;ATA;tat;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Asp;ATC;gat;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
His;ATG;cat;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Asn;ATT;aat;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Leu;CAA;ttg;1;1;1;1;1;1;1;1;2;2;1;1;1;1;1;1;2;2;1;1
Val;CAC;gtg;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;0;0;1;1
Leu;CAG;ctg;1;1;1;1;1;1;1;1;2;2;2;2;1;1;1;1;0;0;1;1
Met;CAT;atg;3;3;3;3;4;3;5;3;4;4;4;3;4;3;3;3;3;3;4;4
Trp;CCA;tgg;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2;1;1
Gly;CCC;ggg;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;0;0;1;1
Arg;CCG;cgg;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;0;0;1;1
Arg;CCT;agg;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1
Ser;CGA;tcg;1;1;1;1;1;1;1;1;1;1;1;1;0;0;1;1;0;0;1;1
Ala;CGC;gcg;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;0;0;1;1
Pro;CGG;ccg;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;0;0;1;1
Thr;CGT;acg;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;0;0;1;1
Stp;CTA;tag;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Glu;CTC;gag;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;0;0;1;1
Gln;CTG;cag;2;2;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1
Lys;CTT;aag;1;1;1;1;1;1;1;1;1;1;1;1;2;1;1;1;1;1;1;1
Phe;GAA;ttc;1;1;1;1;2;1;2;1;2;1;2;1;2;2;1;1;2;2;1;1
Val;GAC;gtc;1;1;1;1;2;1;2;1;2;1;2;1;1;1;1;1;2;2;1;1
Leu;GAG;ctc;2;2;1;1;2;2;2;1;2;2;2;2;2;1;1;1;1;1;1;1
Ile;GAT;atc;1;1;1;1;2;1;2;1;2;2;2;1;1;1;1;1;2;2;1;1
Cys;GCA;tgc;1;1;1;1;3;3;4;3;4;4;3;3;4;3;8;6;1;1;1;1
Gly;GCC;ggc;1;1;2;1;3;1;3;2;3;2;2;2;1;1;1;1;1;1;2;1
Arg;GCG;cgc;1;1;2;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1
Ser;GCT;agc;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2;1;1
Ser;GGA;tcc;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2;1;1
Ala;GGC;gcc;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1
Pro;GGG;ccc;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;0;0;1;1
Thr;GGT;acc;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2
Tyr;GTA;tac;1;1;2;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2;1;1
Asp;GTC;gac;1;1;2;1;1;1;1;1;1;1;1;1;2;1;1;1;2;2;2;2
His;GTG;cac;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1
Asn;GTT;aac;1;1;1;1;2;1;2;1;2;1;2;1;1;1;1;1;2;2;1;1
Leu;TAA;tta;1;1;1;1;1;1;3;3;1;1;1;1;1;1;1;1;2;2;1;1
Val;TAC;gta;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;1;1;1
Leu;TAG;cta;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2;1;1
Ile;TAT;ata;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
SeC;TCA;tga;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Gly;TCC;gga;1;1;2;2;1;1;1;1;1;1;1;1;1;1;1;1;2;2;1;1
Arg;TCG;cga;2;2;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1
Arg;TCT;aga;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2;1;1
Ser;TGA;tca;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2;1;1
Ala;TGC;gca;1;1;2;1;1;1;1;1;1;1;1;1;3;1;1;1;3;2;4;1
Pro;TGG;cca;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2;1;1
Thr;TGT;aca;1;1;1;1;1;1;2;2;1;1;1;1;1;1;4;2;1;1;1;1
Stp;TTA;taa;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
Glu;TTC;gaa;1;1;1;1;2;1;2;1;2;1;2;1;1;1;1;1;2;2;1;1
Gln;TTG;caa;1;1;1;1;2;2;1;1;1;1;1;1;1;1;1;1;2;2;1;1
Lys;TTT;aaa;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;2;2;1;1
;;total;49;49;52;47;58;50;62;52;60;55;57;51;55;48;56;52;59;57;53;49

Tableaux des codons, corrélations et indice double[modifier | modifier le wikicode]

E79-Codons. Correlations et indices des doublons[modifier | modifier le wikicode]

E79;;Lys;;Asn;;Lys;;Asn;;Thr;;Thr;;Thr;;Thr;;Arg;;Ser;;Arg;;Ser;;Ile;;Ile;;Met;;Ile;;Gln;;His;;Gln;;His;;Pro;;Pro;;Pro;;Pro;;Arg;;Arg;;Arg;;Arg;;Leu;;Leu;;Leu;;Leu;;Glu;;Asp;;Glu;;Asp;;Ala;;Ala;;Ala;;Ala;;Gly;;Gly;;Gly;;Gly;;Val;;Val;;Val;;Val;;Stp;;Tyr;;Stp;;Tyr;;Ser;;Ser;;Ser;;Ser;;SeC;;Cys;;Trp;;Cys;;Leu;;Phe;;Leu;;Phe;
;;TTT;;GTT;;CTT;;ATT;;TGT;;GGT;;CGT;;AGT;;TCT;;GCT;;CCT;;ACT;;TAT;;GAT;;CAT;;AAT;;TTG;;GTG;;CTG;;ATG;;TGG;;GGG;;CGG;;AGG;;TCG;;GCG;;CCG;;ACG;;TAG;;GAG;;CAG;;AAG;;TTC;;GTC;;CTC;;ATC;;TGC;;GGC;;CGC;;AGC;;TCC;;GCC;;CCC;;ACC;;TAC;;GAC;;CAC;;AAC;;TTA;;GTA;;CTA;;ATA;;TGA;;GGA;;CGA;;AGA;;TCA;;GCA;;CCA;;ACA;;TAA;;GAA;;CAA;;AAA;
;;double;aaa;double;aac;double;aag;double;aat;double;aca;double;acc;double;acg;double;act;double;aga;double;agc;double;agg;double;agt;double;ata;double;atc;double;atg;double;att;double;caa;double;cac;double;cag;double;cat;double;cca;double;ccc;double;ccg;double;cct;double;cga;double;cgc;double;cgg;double;cgt;double;cta;double;ctc;double;ctg;double;ctt;double;gaa;double;gac;double;gag;double;gat;double;gca;double;gcc;double;gcg;double;gct;double;gga;double;ggc;double;ggg;double;ggt;double;gta;double;gtc;double;gtg;double;gtt;double;taa;double;tac;double;tag;double;tat;double;tca;double;tcc;double;tcg;double;tct;double;tga;double;tgc;double;tgg;double;tgt;double;tta;double;ttc;double;ttg;double;ttt
;acs;2;2;6;3;3;2;0;−;1;1;0;−;0;0;1;2;0;2;2;2;0;2;0;−;0;0;0;−;4;7;4;1;0;2;3;1;2;2;0;−;2;0;0;0;1;0;2;0;0;2;0;−;0;0;2;1;0;2;0;−;2;1;2;1;5;1;6;1;1;3;0;−;0;5;0;−;0;2;6;5;5;2;5;1;1;0;0;−;0;1;0;−;2;0;2;2;0;−;0;5;0;−;0;−;0;0;0;−;0;1;4;0;0;0;8;3;3;3;0;−;0;1;4;0;1;0;0;−
;aga;3;4;10;1;15;1;0;−;1;0;0;−;3;2;7;0;0;1;4;1;0;1;0;−;0;1;0;−;13;4;10;1;2;1;16;4;5;5;0;−;6;1;0;−;7;5;2;4;4;3;0;−;0;−;9;0;1;1;0;−;8;1;3;1;8;2;18;1;12;2;0;−;1;1;0;−;4;1;13;3;7;0;14;0;0;−;0;−;2;0;0;−;21;7;24;6;0;0;1;20;0;−;0;−;1;0;0;−;7;0;4;1;0;−;4;0;5;0;0;−;1;4;8;0;0;3;0;−
;aml;5;49;10;17;12;759;0;5;1;7;0;−;0;9;4;5;0;16;3;9;1;43;0;1;0;5;0;−;11;12;7;4;1;41;7;0;4;20;0;−;3;7;0;−;3;1;7;1;2;81;0;0;2;4;5;2;0;4;0;−;2;4;2;4;4;6;5;5;3;33;0;0;2;6;0;−;1;3;3;13;3;3;8;1;2;4;0;−;0;6;0;−;7;1;8;1;0;0;1;9;0;9;0;−;0;5;0;−;0;3;6;3;0;1;13;11;3;6;0;−;1;3;8;2;2;6;0;−
;ath;10;5;10;8;14;4;0;−;4;4;0;0;2;3;7;2;1;8;7;8;4;3;0;−;3;1;1;0;16;15;15;1;6;3;6;5;4;4;0;−;41;5;0;−;2;2;11;4;4;1;0;−;1;2;4;6;6;4;0;0;2;0;9;2;7;8;21;7;9;3;0;−;7;2;0;−;4;2;13;2;11;1;16;8;4;0;0;−;4;2;1;0;6;1;12;2;0;0;50;32;0;−;0;−;6;5;1;1;3;3;26;10;0;−;4;13;11;4;0;−;3;2;16;4;6;5;0;−
;bacu;4;81;17;6;5;23;0;−;1;6;0;−;0;3;4;8;0;54;3;9;0;66;0;−;0;7;0;0;8;12;6;5;2;7;7;3;4;15;0;−;2;2;0;−;2;1;5;1;1;7;0;−;1;19;3;5;0;3;0;−;3;3;4;1;47;2320;7;37;21;446;1;18;0;41;0;−;1;18;2;17;25;961;13;50;103;2044;1;10;0;17;0;0;8;23;5;8;0;23;0;13;0;8;0;−;0;4;0;0;0;3;3;6;0;16;5;18;13;242;0;1;1;11;4;8;0;7;0;−
;bdi;3;8;10;5;16;1;0;−;2;7;2;0;2;3;2;6;2;6;12;5;4;5;0;−;1;2;0;1;25;30;13;6;7;7;14;6;8;2;0;2;8;9;0;−;5;2;11;3;4;0;0;0;2;3;12;3;6;3;0;−;7;0;7;6;8;6;21;4;16;2;0;−;7;5;0;−;9;1;16;2;6;2;19;8;8;0;0;−;2;2;2;1;8;2;11;4;0;−;3;13;0;−;0;0;5;4;1;2;4;0;8;2;0;−;6;8;12;5;0;−;2;1;13;4;9;6;0;−
;bta;10;67;16;13;15;24;0;−;2;7;0;0;0;6;4;9;0;43;8;10;2;113;0;3;0;7;0;−;16;18;14;3;2;17;14;4;8;31;0;3;6;2;0;−;3;0;11;1;1;10;0;6;3;12;7;5;0;4;0;−;3;2;6;4;11;423;9;32;3;160;0;5;4;30;0;1;2;13;12;18;6;384;8;54;29;1265;0;19;2;18;0;−;12;26;7;12;0;3;1;37;0;12;0;10;0;6;4;27;0;6;8;4;0;28;25;312;5;172;9;133;0;9;12;17;0;13;0;5
;cbr;11;4;20;2;36;3;0;−;6;3;0;−;5;3;20;1;7;2;6;2;1;0;0;−;8;15;0;−;18;4;17;3;19;4;18;2;6;3;0;−;30;10;0;−;2;1;2;3;4;5;0;−;0;−;17;4;3;1;0;−;2;4;21;4;15;3;27;6;21;8;0;−;13;0;0;−;2;4;22;6;33;8;16;4;0;4;0;−;2;3;0;−;3;2;18;6;0;−;13;5;0;−;0;−;3;4;0;−;4;3;14;2;0;−;14;1;12;0;0;−;2;3;16;5;1;9;0;−
;cbre;20;8;28;4;45;3;0;−;12;2;0;0;6;3;26;4;10;2;9;4;4;6;0;−;13;12;0;0;24;4;31;1;29;10;21;4;6;4;0;0;48;5;1;0;4;4;13;11;11;5;0;−;13;10;28;3;6;1;0;−;3;4;29;2;27;8;31;2;34;2;0;−;7;3;0;−;2;3;33;1;61;4;25;13;11;13;0;−;3;4;0;−;7;7;30;2;0;−;20;7;0;−;0;1;7;6;0;−;3;5;16;3;1;1;16;4;19;2;0;1;4;2;18;5;2;11;0;−
;cel;13;0;17;2;24;5;0;−;9;1;0;−;2;4;14;2;5;2;6;2;1;2;0;0;3;3;0;−;16;2;19;1;15;4;13;5;4;2;0;−;23;7;0;−;3;0;2;3;4;3;0;−;0;0;14;3;2;0;0;−;3;1;14;5;14;2;20;6;19;4;0;−;7;1;0;−;0;3;16;5;28;5;10;3;2;0;0;−;1;3;0;−;4;1;15;3;0;−;7;11;0;−;0;−;2;6;0;−;3;2;11;3;0;1;11;1;9;2;0;−;1;2;10;4;0;6;0;−
;cfa;6;27;8;12;10;397;0;0;1;2;0;−;0;4;2;5;0;8;2;5;1;27;0;−;0;4;0;−;6;16;4;4;1;41;7;1;4;15;0;−;1;6;0;−;2;1;7;0;0;14;0;−;1;2;1;4;0;3;0;−;4;2;3;0;4;10;9;3;6;15;0;1;3;7;0;−;0;3;3;10;7;3;8;2;2;6;0;−;0;4;0;−;5;2;2;3;0;2;0;8;0;2;0;−;0;4;0;−;1;6;5;4;0;0;9;11;0;5;0;−;0;3;4;5;0;4;0;−
;cge;5;9;8;8;11;74;0;−;1;2;0;0;0;3;1;6;0;4;3;5;1;4;0;−;0;4;0;−;7;8;10;2;1;3;11;2;5;5;0;−;4;1;0;−;2;0;6;0;2;3;0;−;0;2;3;2;0;3;0;−;5;4;3;1;2;4;10;4;6;13;0;−;1;13;0;0;1;4;5;16;5;0;9;4;2;4;0;0;1;3;0;−;3;5;4;8;0;−;0;10;0;−;0;−;0;2;0;−;0;2;5;0;0;1;24;16;2;3;0;−;0;3;4;3;0;3;0;−
;cjap;23;6;20;2;30;6;0;−;7;4;0;−;8;2;17;6;9;2;12;2;2;0;0;−;2;4;0;−;25;4;20;5;11;2;12;4;11;4;0;−;33;9;0;−;7;0;7;1;6;4;0;−;0;0;17;3;2;3;0;−;5;6;22;3;16;3;32;8;31;8;0;−;6;4;0;−;7;0;23;7;36;10;24;9;0;1;0;−;2;4;0;−;8;4;19;3;0;−;22;1;0;−;0;−;4;2;0;−;10;4;14;4;0;0;12;2;14;3;0;−;0;4;19;4;0;6;0;0
;cjc;5;10;9;17;4;11;0;−;0;6;0;0;0;3;1;8;0;5;3;4;1;3;0;−;0;4;0;2;7;12;5;7;0;6;5;3;5;7;0;0;3;2;0;−;3;0;6;0;0;3;2;0;1;2;4;1;0;3;0;−;3;8;4;3;3;17;8;5;6;8;0;0;1;4;0;1;1;2;2;12;6;2;9;5;1;3;0;−;1;4;0;2;4;6;3;3;0;0;10;24;0;2;0;0;1;3;0;−;0;3;5;3;0;1;9;22;1;9;0;−;0;10;4;3;0;6;0;−
;cmk;5;37;16;31;11;24;0;1;49;156;0;11;4;132;7;16;0;13;10;22;5;6;0;−;4;18;0;−;20;73;8;22;1;5;10;26;8;9;0;0;7;43;0;5;0;40;1;10;3;21;0;−;0;1;4;4;2;17;0;1;5;19;6;13;7;58;14;34;22;405;0;5;2889;3008;3;164;100;3757;19;55;22;43;12;6;7;73;0;1;29;115;0;15;37;1502;6;15;0;0;7;28;0;3;0;0;3;50;0;0;0;47;12;13;0;2;5;9;10;19;0;0;1;11;10;24;1;29;0;2
;cpic;4;31;5;11;2;6;0;0;1;16;0;−;0;4;1;15;1;24;1;18;0;9;0;2;0;12;0;0;5;10;2;8;1;14;2;7;1;9;0;−;1;2;0;0;0;1;4;7;1;3;0;−;0;2;2;4;0;3;0;0;2;3;0;1;0;16;4;9;2;2;0;−;3;11;0;0;0;3;1;9;10;13;5;5;1;0;0;−;0;4;0;−;0;5;1;14;0;0;0;4;0;1;0;0;0;14;0;−;1;8;2;21;0;3;4;13;1;8;0;4;0;12;2;19;1;5;0;1
;cpo;4;6;9;8;7;18;0;−;1;2;0;−;0;2;0;9;0;4;3;6;1;3;0;−;0;4;0;−;5;9;7;2;2;1;6;1;3;4;0;−;2;1;0;−;2;0;6;1;0;3;0;−;0;2;4;2;0;2;0;−;4;1;3;1;2;3;6;3;4;0;0;0;2;6;0;3;0;4;4;23;2;3;6;4;1;4;0;−;1;1;0;0;3;2;4;1;0;−;4;10;0;0;0;−;1;1;0;−;1;2;6;1;0;0;18;15;1;6;0;−;0;3;5;2;0;5;0;−
;csi;4;10;10;3;6;15;0;1;2;5;0;−;0;4;3;6;0;5;7;5;0;6;0;−;0;4;0;−;11;14;7;5;2;2;8;1;4;7;0;−;4;2;0;−;2;1;8;1;1;3;0;−;2;1;4;5;1;2;0;−;2;1;3;2;4;6;6;6;4;72;0;0;1;11;0;−;1;4;7;15;2;1;8;1;3;5;0;−;0;6;0;0;4;10;5;5;0;−;0;10;0;0;0;−;2;2;0;−;0;3;8;4;0;0;4;19;4;3;0;−;0;4;7;5;0;5;0;−
;dme;4;1;9;0;12;0;0;−;4;1;0;−;2;0;6;2;0;2;4;1;2;0;0;−;0;1;0;−;8;3;8;1;2;1;4;0;4;3;0;−;4;0;0;−;2;2;6;0;6;3;0;−;0;−;9;0;1;0;0;−;7;0;3;0;5;0;11;2;10;4;0;−;0;1;0;−;2;0;10;1;4;1;12;1;0;−;0;−;1;0;0;−;5;1;4;1;0;−;0;8;0;−;0;−;0;1;0;−;3;0;5;2;0;0;3;3;6;1;0;−;0;3;7;0;0;3;0;−
;dno;4;13;17;5;13;29;0;−;1;6;0;−;0;6;1;9;0;8;3;6;1;45;0;−;0;5;0;0;10;19;6;5;2;2;6;3;3;6;0;0;5;1;0;−;1;2;6;0;1;6;0;−;0;4;5;4;0;2;0;−;6;3;3;1;5;14;12;8;7;37;0;−;2;63;0;1;1;15;7;15;10;23;10;8;4;321;0;23;0;15;0;0;5;75;4;7;0;−;3;10;0;−;0;−;1;4;0;−;0;5;7;2;0;0;9;12;3;11;0;−;0;7;5;6;1;6;0;−
;dsi;2;1;5;0;10;0;0;−;3;1;0;−;2;1;7;0;0;3;1;1;1;1;0;−;0;−;0;−;8;3;6;2;2;1;4;1;4;3;0;−;3;1;0;−;2;2;5;0;2;2;0;−;0;−;8;0;1;0;0;−;8;0;4;0;2;2;5;0;6;3;0;−;0;−;0;−;3;1;8;0;3;1;13;1;0;−;0;−;1;0;0;−;4;1;5;1;0;−;0;9;0;−;0;−;0;1;0;−;2;0;5;2;0;0;4;2;7;1;0;−;0;2;5;2;0;3;0;−
;dya;3;2;10;0;12;3;0;0;4;1;0;−;4;0;7;0;0;2;4;3;2;1;0;−;0;1;0;−;11;3;8;1;3;0;4;0;3;4;0;−;7;0;0;−;3;1;5;0;5;1;0;−;0;−;11;0;1;0;0;−;7;0;4;0;5;1;14;2;11;2;0;−;1;0;0;−;2;2;14;3;5;1;14;1;0;0;0;−;1;0;0;−;8;2;5;1;0;−;0;8;0;−;0;−;0;1;0;−;4;0;6;2;0;0;5;2;6;1;0;−;1;3;8;0;0;3;0;−
;ecb;7;7;9;7;8;7;0;0;2;4;0;−;0;2;2;6;0;4;5;6;1;5;0;−;0;4;0;−;12;12;13;6;2;3;8;2;6;5;0;0;4;2;0;−;1;1;9;0;1;2;0;−;2;1;6;3;0;4;0;−;1;1;5;1;5;5;5;4;3;47;0;−;2;8;0;−;1;6;11;15;2;1;9;0;3;4;0;−;0;5;0;2;9;5;7;4;0;−;4;9;0;−;0;0;0;3;0;−;0;3;8;3;0;3;10;14;3;3;0;−;0;3;8;3;0;5;0;−
;eeu;6;4;5;1;28;120;0;−;0;5;0;−;0;3;2;6;0;4;4;2;1;5;0;−;0;3;0;−;10;5;7;1;1;2;4;0;2;5;0;−;3;1;0;−;2;0;8;1;1;3;0;−;1;1;3;2;0;2;0;−;2;3;4;1;3;4;9;3;5;3;0;−;0;9;0;−;0;3;4;9;5;1;10;3;2;2;0;−;0;5;0;−;2;1;3;3;0;−;0;12;0;−;0;−;0;2;0;−;0;2;5;1;0;1;14;19;2;4;0;−;0;2;5;2;0;5;0;−
;fca;5;44;7;20;8;878;0;4;1;11;0;−;0;8;3;5;0;53;4;7;1;51;0;1;0;8;0;−;9;14;8;1;5;776;8;7;2;44;0;1;4;63;0;0;2;4;6;1;7;1193;0;8;0;23;5;3;0;32;0;−;2;2;5;0;4;10;7;1;3;40;0;0;1;8;0;0;1;5;4;13;2;45;7;2;1;4;0;1;0;5;0;−;6;2;4;3;1;35;1;8;0;11;0;−;1;12;0;0;0;4;5;2;0;17;13;18;1;21;0;0;0;18;4;7;0;7;0;0
;gac;30;30;82;40;74;22;0;0;19;15;0;−;14;8;49;49;43;24;14;15;21;4;0;−;46;14;0;−;221;64;84;16;47;12;33;18;61;19;0;−;22;6;0;−;13;4;58;4;65;13;0;−;0;1;37;11;5;11;0;−;6;2;31;17;22;23;135;48;28;24;0;−;36;16;0;−;41;14;31;21;40;20;10;1;1;2;0;−;4;7;0;0;7;10;9;11;0;−;4;12;0;−;0;−;43;18;0;−;23;5;38;13;0;0;72;34;47;26;0;−;4;7;23;11;1;5;0;−
;gfr;2;1;1;4;1;5;0;0;0;3;0;−;0;0;2;2;0;2;3;2;0;1;0;−;0;1;0;0;2;3;4;1;0;1;0;3;1;1;0;−;1;3;0;−;0;0;3;0;0;1;0;−;0;−;1;4;0;−;0;−;2;4;1;2;0;3;1;3;4;1;0;−;0;4;0;−;0;1;9;6;2;1;7;0;1;2;0;−;0;0;0;0;1;1;0;1;0;−;4;7;0;−;0;−;0;2;0;−;0;0;1;0;0;−;5;4;0;2;0;−;0;10;4;1;0;1;0;−
;gga;2;3;5;5;4;1;0;−;1;2;0;−;0;1;0;3;0;3;3;3;0;2;0;−;0;1;0;−;8;5;6;0;0;1;2;3;2;2;0;−;1;2;0;−;1;1;6;0;0;1;0;−;0;1;4;3;0;1;0;−;2;4;0;2;2;6;7;2;5;1;0;−;3;3;0;−;0;3;13;10;3;3;5;1;2;1;0;−;0;2;0;0;2;4;2;4;0;−;3;12;0;−;0;−;1;2;0;−;1;0;4;4;0;0;6;4;3;2;0;−;0;2;5;4;0;2;0;−
;ggo;3;10;9;19;5;13;0;1;1;4;0;−;1;4;2;6;0;4;4;3;1;4;0;−;0;5;0;2;10;6;5;8;1;9;6;0;5;15;0;−;3;3;0;−;3;0;5;4;1;4;0;−;2;2;3;3;0;4;0;−;1;3;4;4;3;12;7;7;2;6;0;−;1;5;0;1;0;4;3;19;1;3;5;7;4;4;0;−;0;7;0;0;5;5;2;6;1;0;1;21;0;2;0;3;0;4;0;1;0;4;6;4;0;2;5;29;2;6;0;0;1;7;5;7;0;8;0;−
;gmo;17;45;16;17;20;22;0;1;6;23;0;−;7;22;10;19;2;18;0;−;7;20;0;0;2;15;0;−;42;111;5;20;3;7;10;15;22;22;0;0;6;14;0;0;10;11;25;29;2;14;0;1;3;6;8;22;4;19;0;−;13;33;11;21;12;38;15;14;20;29;0;0;4;19;0;−;6;19;24;30;18;20;17;12;4;13;0;−;0;8;0;−;9;18;8;12;0;0;3;46;0;3;0;−;3;14;14;26;1;12;12;17;0;1;8;18;10;18;0;−;1;14;12;23;0;14;0;5
;gmx;15;4;12;9;20;1;0;1;5;4;0;0;2;1;3;5;10;7;16;11;10;2;0;−;5;2;0;−;22;13;12;18;10;2;15;2;8;4;0;−;20;6;0;−;3;1;16;4;6;2;0;−;1;3;11;1;7;2;0;−;6;0;15;0;12;3;25;7;17;6;0;−;12;4;0;−;5;2;21;2;16;1;26;2;6;2;0;−;5;3;0;0;11;1;15;6;0;−;1;19;0;−;0;−;6;4;0;−;4;1;10;4;0;−;13;0;15;2;0;−;4;4;17;4;10;7;0;−
;hgl;3;4;5;3;4;10;0;−;0;3;0;1;0;3;0;14;0;5;2;4;1;3;0;1;0;2;0;−;6;7;5;2;0;2;5;1;3;2;0;−;1;3;0;−;1;1;4;8;0;3;0;−;0;3;2;2;0;4;0;−;1;3;2;2;2;3;4;5;3;0;0;1;1;3;0;5;1;4;1;44;1;2;6;3;1;1;0;3;1;2;0;0;3;2;1;10;0;−;0;6;0;−;0;−;0;2;0;−;0;2;2;4;3;3;5;17;1;4;0;−;0;3;4;1;0;4;0;−
;hsa-18;4;7;8;16;5;9;0;−;0;5;0;−;0;4;3;5;0;5;2;5;0;4;0;−;0;4;2;0;11;8;5;9;2;3;8;0;6;6;0;−;4;2;0;−;2;1;7;1;0;5;0;−;2;1;5;1;0;2;0;−;7;1;5;3;3;4;10;2;6;1;0;−;1;6;0;−;0;3;10;15;5;3;9;4;2;2;0;−;1;3;0;−;7;5;4;5;0;−;0;12;0;−;0;0;0;3;0;−;0;3;5;3;0;1;6;22;2;4;0;−;0;3;5;4;0;6;0;−
;lav;14;45;14;36;14;21;0;3;5;16;0;0;0;9;1;12;0;89;7;68;2;13;0;2;0;6;0;−;16;33;13;29;3;10;14;12;5;22;0;2;2;11;0;−;2;0;9;6;4;13;0;−;0;2;4;9;0;10;0;−;4;5;4;17;7;106;6;13;6;17;0;−;6;46;0;−;0;14;14;39;3;615;7;25;2;69;0;3;11;38;0;0;9;25;7;33;0;1;0;18;0;−;0;0;0;6;0;−;1;2;9;19;0;23;5;22;6;16;0;0;1;13;13;18;3;13;0;0
;lcm;7;12;2;6;4;8;0;2;1;7;0;−;0;1;3;7;0;8;1;6;0;7;0;−;0;6;0;−;3;7;1;5;1;8;2;2;2;6;0;−;3;6;0;−;0;3;2;9;0;3;0;−;0;0;2;1;1;3;0;−;0;7;1;2;2;8;3;15;2;5;0;0;1;18;0;−;1;1;3;1;0;4;2;4;1;0;0;−;0;6;0;−;1;2;0;2;0;0;0;7;1;1;0;1;0;5;0;−;0;2;0;2;0;3;3;13;2;12;0;4;0;10;1;5;0;3;0;−
;lma;0;0;2;0;2;1;0;−;0;0;0;−;1;0;2;0;0;0;0;1;0;0;0;−;0;0;0;−;2;1;2;0;0;0;1;0;2;0;0;−;0;0;0;−;1;0;1;0;0;0;0;−;0;0;3;0;0;0;0;−;1;0;2;0;0;0;2;0;1;0;0;−;0;0;0;−;1;0;1;0;0;0;3;0;0;0;0;−;0;0;0;−;1;0;1;0;0;−;1;1;0;−;0;−;0;0;0;−;0;0;0;0;0;−;0;0;0;0;0;−;0;0;1;0;0;0;0;−
;mcc;6;12;6;20;7;8;0;1;0;5;0;−;0;3;3;6;0;5;4;3;1;5;0;−;0;6;0;5;5;13;4;7;1;14;10;3;4;9;0;−;3;6;0;0;2;0;6;1;0;4;0;−;2;1;3;2;0;4;0;−;2;3;2;6;2;9;6;8;2;3;0;0;0;10;0;0;1;3;4;17;2;2;6;8;3;4;0;−;1;5;0;2;4;7;3;6;0;1;0;30;0;1;0;0;4;15;0;1;0;3;5;3;0;1;8;19;3;5;0;1;1;14;5;4;1;7;0;−
;mdo;9;3;9;3;10;8;0;−;5;1;0;−;0;2;6;5;0;5;7;1;1;3;0;−;0;6;0;−;14;10;12;0;0;6;8;0;8;2;0;−;5;2;0;−;2;0;10;0;2;2;0;−;1;2;0;4;0;5;0;−;5;5;5;2;10;3;12;11;10;2;0;0;3;5;0;−;2;3;9;5;4;6;19;4;6;1;0;−;1;3;0;−;6;2;6;2;0;−;2;12;0;−;0;−;1;4;0;−;0;2;6;5;0;−;31;14;3;5;0;3;0;1;8;3;1;2;0;−
;meu;3;6;10;3;8;2;0;−;3;2;0;−;0;2;3;4;1;5;6;3;0;3;0;−;0;5;0;−;7;6;4;1;1;2;6;0;1;5;0;0;3;0;0;−;1;0;4;2;2;2;0;−;0;2;2;4;1;2;0;−;1;4;2;2;6;5;1;11;5;1;0;−;0;5;0;−;2;2;4;8;6;3;7;8;2;2;0;−;0;0;0;−;3;3;5;2;0;−;0;7;0;−;0;0;2;1;0;−;0;1;6;1;3;3;19;9;1;6;0;−;0;2;3;6;0;7;0;0
;mgp;2;1;2;1;1;1;0;−;0;1;0;−;0;−;0;3;0;2;1;4;1;1;0;−;0;0;0;−;7;3;1;1;0;0;0;2;0;0;0;−;0;1;0;−;0;0;5;1;0;0;0;−;0;1;0;1;0;0;0;−;1;2;0;0;1;3;2;0;3;2;0;−;2;3;0;−;0;2;4;2;2;1;4;0;1;1;0;−;0;1;0;0;0;2;0;2;0;−;2;3;0;−;0;−;0;2;0;−;0;0;2;2;0;−;2;2;2;2;0;−;0;0;2;3;0;1;0;−
;mlu;1;1;7;1;4;6;0;−;2;2;0;−;0;2;2;2;1;3;2;2;0;4;0;−;0;2;0;−;8;5;6;3;0;2;4;2;2;4;0;4;0;2;0;−;2;0;5;0;1;3;0;−;0;1;1;4;0;1;0;−;3;1;1;1;1;3;5;2;5;0;0;−;0;0;0;−;0;2;3;4;4;1;6;1;1;1;0;−;0;2;0;−;4;0;3;1;0;−;0;4;0;−;0;−;0;1;0;−;0;1;4;1;0;−;17;9;2;1;0;−;0;1;3;1;0;2;0;−
;mmr;3;1;4;4;4;1;0;−;0;2;0;−;0;1;0;2;0;4;2;4;0;2;0;−;1;1;0;−;8;5;2;1;1;2;3;2;7;4;0;−;1;2;0;−;2;0;6;0;1;1;0;−;0;1;2;3;0;1;0;−;4;2;3;1;3;5;3;1;4;3;0;−;0;4;0;−;0;2;3;7;5;1;8;2;0;1;0;−;0;1;0;−;3;1;2;1;0;−;0;7;0;−;0;−;0;1;0;−;0;2;1;5;0;−;11;8;2;3;0;0;0;2;6;1;0;2;0;−
;mmu;8;5;8;4;7;18;0;−;1;2;0;−;0;3;2;8;0;5;2;5;1;3;0;−;0;4;0;0;8;10;7;4;1;5;7;2;5;6;0;0;3;4;0;0;2;0;5;2;1;3;0;−;0;2;3;2;0;3;0;−;6;3;2;2;5;2;12;3;8;5;0;−;3;7;0;3;3;6;4;18;6;1;9;5;2;4;0;1;2;0;0;0;4;7;2;5;0;0;0;10;0;−;0;−;1;1;0;0;0;2;5;4;0;0;32;27;2;5;0;0;2;4;4;2;0;3;0;−
;mpu;6;24;4;7;5;265;0;5;1;5;0;−;0;4;2;7;1;14;4;7;0;20;0;−;0;4;0;−;6;13;6;3;2;34;5;1;3;13;0;0;1;5;0;−;1;0;8;0;1;27;0;−;2;2;3;2;0;3;0;−;2;2;4;1;1;5;4;3;4;14;0;−;1;6;0;−;1;3;2;12;2;6;7;1;1;2;0;−;0;5;0;−;3;3;3;4;0;1;0;8;0;4;0;−;0;3;0;−;0;3;5;2;0;0;15;9;2;8;0;−;0;3;6;4;0;5;0;−
;mtr;7;12;14;15;13;2;4;43;3;6;2;1;0;0;8;1;2;5;6;8;2;3;0;−;7;6;0;−;18;22;14;8;10;9;10;7;2;2;0;−;8;2;0;0;0;0;6;0;3;1;0;−;1;1;5;6;6;3;0;−;2;1;3;5;13;8;16;13;8;2;0;0;8;7;0;−;0;2;15;9;9;5;19;3;1;1;0;0;2;4;0;2;2;4;11;5;2;29;2;10;0;−;0;2;4;3;1;1;1;0;7;4;0;0;7;2;7;6;0;0;3;4;20;5;5;8;0;0
;mun;1;1;4;4;3;9;0;−;0;1;0;−;0;−;1;3;0;3;0;7;1;2;0;−;0;0;0;−;6;2;3;1;1;0;0;3;0;4;0;−;1;2;0;−;0;1;0;2;0;0;0;−;0;0;1;1;0;−;0;−;0;5;0;2;0;2;4;4;0;0;0;−;0;4;0;−;0;1;7;1;5;5;4;5;0;0;0;−;0;0;0;0;2;1;1;2;0;0;2;4;0;−;0;−;1;3;0;0;0;1;0;3;0;0;0;4;1;2;0;−;1;2;2;3;0;2;0;−
;nle;8;14;7;13;6;13;0;2;0;5;0;−;0;4;3;8;0;6;3;5;1;3;0;−;0;4;0;2;7;9;4;8;2;7;7;3;3;13;0;−;2;2;0;1;3;0;5;3;0;6;0;−;1;1;4;2;0;3;0;−;3;5;4;5;2;11;5;7;7;9;0;−;0;10;0;0;1;3;2;16;4;1;5;7;1;8;0;−;0;5;0;0;4;8;4;6;0;2;0;18;0;4;0;−;0;5;1;2;0;4;3;6;0;2;9;13;0;9;0;0;0;7;4;12;0;5;0;0
;oaa;7;24;10;10;10;14;0;−;2;15;0;0;2;7;7;15;0;5;6;11;2;6;7;10;2;7;0;−;14;17;10;16;3;7;4;19;5;13;0;0;3;8;0;3;4;2;13;5;2;4;0;−;3;10;4;7;2;4;0;−;5;12;3;4;3;12;13;13;13;13;0;−;6;10;0;−;3;7;32;50;6;8;17;22;4;4;0;1;2;12;0;0;5;4;7;15;0;2;2;25;0;−;0;−;0;5;0;3;1;6;0;−;0;4;18;18;5;8;0;−;3;6;6;17;0;9;0;0
;oas;5;16;8;4;5;10;0;−;1;3;0;−;0;2;0;4;0;21;1;5;1;31;0;−;0;4;0;−;4;13;3;2;0;6;3;4;3;5;0;−;2;3;0;−;0;0;3;0;0;5;0;1;0;5;0;1;0;2;0;−;0;1;3;2;3;135;2;5;3;56;0;1;0;11;0;2;1;5;7;10;1;131;3;26;2;338;0;4;0;7;0;−;2;6;3;3;0;−;0;15;0;2;0;1;0;3;0;2;0;2;1;0;0;3;5;55;2;44;0;15;0;4;2;3;0;6;0;0
;ocu;4;7;11;14;9;19;0;0;1;5;0;0;0;4;2;5;0;5;7;2;1;4;0;−;0;6;0;0;8;9;6;4;2;2;8;0;8;6;0;−;2;2;0;−;3;0;8;0;2;2;0;−;1;2;4;2;0;3;0;−;10;5;2;2;9;8;17;5;14;4;0;0;0;8;0;−;0;3;7;13;12;1;18;2;5;10;0;−;3;4;0;−;10;3;4;7;0;−;0;11;0;−;0;−;0;3;0;−;1;3;7;2;0;0;9;15;3;6;0;−;1;4;6;7;0;2;0;−
;oga;4;6;8;3;4;4;0;−;1;4;0;−;0;2;1;7;0;3;2;4;0;4;0;1;0;10;0;8;5;7;6;3;1;3;7;0;5;3;0;−;1;2;0;−;2;0;6;0;0;3;0;−;0;2;2;3;0;2;0;−;5;3;3;0;1;3;9;3;6;1;0;−;2;4;0;−;1;1;5;7;3;5;7;4;2;0;0;−;1;1;0;−;3;1;3;2;0;0;1;6;0;−;0;−;1;1;0;−;0;2;2;3;0;0;10;10;0;5;0;−;0;2;4;1;0;4;0;0
;oni;9;6;8;0;22;20;0;−;3;21;0;0;1;6;6;11;1;25;5;4;12;5;0;1;5;19;0;−;20;6;12;12;1;4;9;13;7;3;0;−;6;4;0;−;2;1;10;3;0;6;0;−;0;5;12;3;1;5;0;−;8;7;5;8;6;7;6;3;13;1;0;−;5;5;0;−;4;7;11;6;6;5;8;4;2;6;0;−;2;6;0;−;7;1;6;1;0;−;0;17;0;−;0;2;1;8;0;−;1;4;6;3;0;0;8;33;7;4;0;0;0;11;9;13;0;6;0;−
;opr;3;5;9;4;4;6;0;−;1;4;0;−;0;6;1;5;0;4;4;2;1;4;0;−;0;3;0;−;11;3;6;1;2;2;4;0;6;5;0;−;1;2;0;−;3;0;7;0;1;4;0;−;1;2;4;2;0;4;0;−;8;2;2;2;3;3;11;2;7;3;0;−;1;5;0;−;1;2;4;10;5;1;11;5;3;1;0;−;0;3;0;−;5;1;2;4;0;−;0;9;0;−;0;−;0;2;0;−;1;2;5;1;0;0;6;3;2;3;0;−;0;2;4;5;0;3;0;−
;osa;4;7;17;12;15;4;0;−;9;6;5;2;3;1;8;2;6;5;14;5;6;4;0;−;2;2;0;−;31;28;14;3;9;11;16;9;3;6;0;−;5;8;0;−;3;5;10;3;2;1;0;−;3;4;17;6;5;4;0;−;8;1;11;3;10;5;20;10;14;10;0;0;9;0;0;0;8;4;16;3;5;4;19;8;4;4;0;−;3;0;13;3;7;3;11;6;0;−;3;16;0;−;0;1;10;6;3;0;3;5;7;4;0;−;8;8;11;6;0;0;1;2;13;6;14;4;0;−
;pan;6;12;9;19;6;10;0;1;0;7;0;−;0;6;4;6;0;5;4;6;1;3;0;−;0;6;0;1;8;10;5;8;2;11;9;0;4;9;0;−;2;3;0;−;3;0;5;3;0;4;0;−;2;1;4;2;0;2;0;−;6;5;4;3;7;5;8;6;7;2;0;1;0;9;0;0;1;3;4;15;6;1;10;9;3;5;0;−;2;4;0;1;6;5;4;4;0;2;1;22;0;−;0;3;0;8;0;0;0;2;6;3;0;2;12;17;4;5;0;3;0;9;9;4;0;8;0;0
;pfa;0;−;0;0;0;−;0;−;0;0;0;−;0;0;0;−;0;0;0;0;0;−;0;−;0;0;0;−;0;1;0;0;0;0;0;−;0;0;0;−;0;0;0;−;0;0;0;0;0;0;0;−;0;−;0;−;0;0;0;−;0;0;0;0;0;0;0;0;0;0;0;−;0;0;0;−;0;0;0;0;0;0;0;−;0;−;0;−;0;0;0;−;0;0;0;0;0;−;0;0;0;−;0;−;0;0;0;−;0;0;0;0;0;−;0;−;0;−;0;−;0;0;0;0;0;0;0;−
;pha;6;5;8;9;6;5;0;0;0;6;0;−;0;5;4;5;0;5;4;4;1;3;0;−;0;3;0;1;9;5;5;6;2;3;9;0;4;6;0;−;2;3;0;−;3;0;5;1;1;4;0;−;2;1;3;3;0;2;0;−;1;4;4;4;6;6;6;3;3;0;0;0;0;8;0;0;1;3;3;15;2;1;6;6;3;4;0;−;2;4;0;0;6;5;5;3;0;0;2;12;0;−;0;−;0;4;0;−;0;2;6;2;0;0;13;14;3;4;0;1;0;6;9;2;1;5;0;−
;pma;17;6;100;67;13;9;0;−;10;8;8;10;11;11;29;32;8;9;34;30;25;24;0;−;3;6;0;−;187;90;47;62;23;20;15;11;60;47;0;0;29;13;0;−;12;8;36;17;17;8;0;0;4;5;55;29;26;13;0;−;37;37;56;55;3;8;56;33;8;2;0;1;21;9;0;−;18;5;62;43;13;3;29;24;4;1;0;0;7;18;0;0;46;24;96;69;1;0;40;49;0;0;0;−;10;9;0;−;18;16;14;7;0;0;38;29;1;7;0;−;2;2;34;22;18;23;0;1
;pop;13;4;11;12;15;1;0;−;5;5;0;−;2;1;2;4;5;5;10;5;7;3;0;0;6;2;0;0;18;7;14;5;10;0;9;3;4;6;0;−;13;9;0;−;2;1;12;1;5;1;0;−;1;4;4;7;0;−;0;0;5;1;13;35;13;0;29;4;13;7;0;−;13;7;0;−;2;2;18;1;10;6;21;4;6;0;0;−;5;2;0;−;6;4;13;3;0;0;2;15;0;−;0;−;4;4;0;0;1;3;8;5;0;0;8;5;12;1;0;0;1;5;15;2;0;2;1;4
;ppp;4;3;9;4;11;4;0;0;1;3;0;−;3;2;8;1;4;2;6;2;5;4;0;−;2;2;0;−;15;8;9;2;3;6;6;2;8;1;0;−;6;1;0;−;0;4;11;1;2;4;0;0;2;2;5;2;1;4;0;0;3;1;5;0;5;1;8;2;7;7;0;0;7;1;0;−;6;1;10;8;5;3;13;2;3;7;0;0;1;0;0;−;2;8;10;2;0;−;1;6;0;1;0;−;2;2;0;−;5;1;10;2;0;0;2;4;8;0;0;−;1;0;11;2;3;2;0;1
;ppy;8;14;11;29;8;18;1;0;0;3;0;−;0;6;4;7;2;5;4;3;2;6;0;−;0;5;3;2;9;12;7;8;0;12;7;3;4;19;0;−;3;5;0;0;3;1;8;2;1;4;0;−;4;2;4;2;0;2;0;0;3;7;6;9;9;14;7;5;5;5;0;0;2;6;0;0;1;2;3;18;3;4;8;5;2;10;0;−;2;4;0;0;7;10;4;5;0;0;1;27;0;1;0;1;0;7;0;1;1;4;3;7;0;2;9;24;1;8;0;−;0;7;5;12;0;6;0;−
;ptr;6;13;9;23;8;17;0;1;1;4;0;−;0;5;2;7;0;5;3;5;1;3;0;2;0;4;0;2;9;13;6;10;3;16;8;1;7;13;0;−;4;5;0;0;3;1;4;6;0;5;0;0;2;2;5;1;0;3;0;0;2;6;5;5;6;11;7;9;6;6;0;0;1;8;0;0;0;4;5;25;2;4;6;6;2;13;0;−;0;9;0;0;4;9;6;4;0;1;2;28;0;3;0;4;0;8;1;2;0;3;6;5;0;1;9;23;3;4;0;0;2;8;5;10;0;6;0;−
;rno;0;0;8;6;10;8;0;−;1;3;0;−;0;3;2;6;0;5;5;6;2;5;0;0;0;2;0;−;7;5;5;6;1;4;9;0;4;5;0;−;4;1;0;−;2;0;10;22;1;3;0;−;0;2;3;2;0;0;0;−;2;2;0;0;5;4;12;2;5;2;1;0;3;5;0;1;0;3;5;30;6;2;7;3;1;3;0;−;1;1;0;−;2;4;3;4;0;−;0;1;0;−;0;−;0;3;0;−;0;2;2;8;0;0;26;13;1;6;0;−;0;2;4;3;0;−;0;0
;san;5;2;8;3;6;6;0;−;0;4;0;−;0;4;2;5;0;5;4;3;2;3;0;−;0;4;0;−;7;7;7;7;2;2;6;0;4;2;0;−;2;3;0;−;1;0;7;0;0;4;0;−;1;1;4;4;0;1;0;0;3;9;4;1;1;8;9;9;9;4;0;−;1;6;0;−;1;1;2;7;5;6;11;10;1;0;0;−;0;4;0;−;3;3;5;1;0;−;0;8;0;0;0;−;0;2;0;−;0;3;4;3;0;1;13;11;1;4;0;−;0;3;5;4;0;3;0;−
;sbi;3;7;9;6;15;6;0;0;4;7;0;1;3;2;3;8;2;5;7;5;7;2;0;−;1;3;0;−;9;29;14;2;3;7;8;6;5;7;0;1;6;4;0;1;4;3;9;4;3;0;0;−;4;2;11;3;3;5;0;−;7;3;11;3;8;4;20;3;17;8;0;1;8;4;4;6;9;1;14;12;7;2;18;5;4;1;0;−;2;1;0;2;8;2;9;6;0;0;0;13;0;1;0;0;7;5;0;2;4;5;8;2;0;0;6;6;10;2;0;−;0;3;16;4;4;4;0;−
;sbq;4;13;5;6;3;6;0;−;1;5;0;−;0;4;2;6;0;5;3;3;1;3;0;−;0;5;0;0;8;6;6;4;0;7;5;3;3;7;0;−;2;2;0;−;3;0;5;3;0;3;0;−;1;1;4;1;0;3;0;−;2;2;4;2;4;16;6;4;3;6;0;0;1;6;0;−;1;3;3;11;2;3;7;4;0;3;0;−;1;3;0;0;2;5;2;3;0;0;0;14;0;−;0;1;1;4;0;0;0;2;6;2;0;2;10;10;1;6;0;0;0;8;5;4;0;6;0;−
;shr;8;5;12;0;9;22;0;−;4;2;0;−;0;1;4;4;0;4;6;1;1;2;0;−;0;3;0;−;14;7;10;0;16;28;8;0;7;2;0;−;5;0;0;−;2;0;8;1;2;2;0;−;0;2;0;3;0;3;0;−;5;3;6;2;10;4;12;6;8;1;0;−;3;3;0;−;2;1;10;7;6;2;16;2;3;2;0;−;1;2;0;−;6;3;7;0;0;1;1;9;0;−;0;−;0;4;0;−;0;2;7;2;0;1;2;5;3;4;0;−;0;5;6;6;0;2;0;−
;spu;37;19;30;8;30;11;0;−;11;9;0;−;4;4;14;12;9;8;14;2;7;11;17;8;6;15;0;1;43;29;57;11;10;6;17;8;10;10;0;−;15;5;0;−;4;4;14;4;9;9;0;−;0;0;20;8;2;5;0;−;2;2;5;12;18;7;62;19;19;9;0;−;10;6;0;−;4;2;21;10;19;13;26;15;1;2;0;−;5;5;0;−;0;−;17;2;0;0;7;16;0;−;0;−;6;8;0;−;1;4;0;−;0;−;20;10;5;12;0;−;5;8;0;−;6;11;0;1
;ssc;15;22;10;7;7;8;0;1;3;4;0;−;0;3;6;6;1;5;6;3;0;3;0;−;1;3;0;−;12;10;12;0;3;5;7;2;4;7;0;−;2;1;0;−;2;0;8;0;2;2;0;−;2;0;5;1;2;2;0;−;3;1;5;2;30;204;14;82;5;7;1;8;2;11;0;−;1;5;5;17;2;7;9;9;2;3;0;−;2;8;0;0;7;4;4;5;0;0;3;13;0;−;0;−;0;4;0;−;0;3;6;3;0;−;10;12;3;3;0;0;0;3;11;9;1;4;0;−
;str;5;4;7;1;7;4;0;0;2;3;0;4;0;6;2;31;0;4;2;4;1;4;0;−;0;3;0;5;7;6;6;7;2;1;4;1;4;1;0;−;2;4;0;0;2;0;7;4;0;4;0;−;0;2;3;2;0;2;0;−;2;1;3;2;2;2;5;2;3;3;0;5;0;38;1;29;1;16;4;251;2;2;7;5;1;18;0;6;1;3;0;2;3;35;4;13;0;−;0;8;0;−;0;−;0;6;0;0;0;5;6;8;0;0;29;18;3;3;0;−;0;2;6;3;0;9;0;0
;tgu;3;0;3;4;1;4;0;2;1;2;0;4;0;1;2;5;0;3;2;2;0;1;1;1;0;0;0;4;2;2;5;34;0;1;2;2;4;1;0;−;0;0;0;−;1;0;3;2;0;2;0;−;0;−;2;3;0;0;0;−;3;3;0;1;0;1;3;3;1;1;0;−;2;4;0;−;0;2;8;9;4;2;7;4;0;3;0;0;0;1;0;1;0;0;1;7;0;−;3;9;0;−;0;−;0;3;0;−;0;0;2;0;0;0;5;3;0;2;0;0;1;2;6;3;0;3;0;1
;tma;5;25;5;17;7;8;0;0;1;16;0;0;0;3;1;14;1;121;2;33;0;12;0;4;0;7;0;0;7;13;5;7;2;5;7;4;4;5;0;−;3;4;0;−;2;0;7;3;0;11;0;−;1;5;3;4;0;4;0;−;1;3;3;4;2;111;4;10;0;18;0;0;3;36;0;0;1;4;4;15;5;1067;5;17;2;87;0;8;0;25;0;−;3;12;3;7;0;1;0;14;0;−;0;0;0;5;0;−;1;2;4;9;0;17;2;19;2;10;0;4;0;5;3;7;0;9;0;0
;tng;4;10;6;10;10;10;0;−;3;8;0;−;3;9;9;16;0;9;5;5;6;4;0;0;0;4;0;−;8;11;8;9;4;4;4;7;13;4;0;−;4;9;0;0;1;3;4;8;0;6;0;0;0;1;10;3;0;5;0;−;18;18;2;12;3;12;6;12;8;4;0;−;2;8;0;−;0;3;7;12;5;10;5;8;1;4;0;−;1;2;0;−;7;8;3;6;0;−;2;10;0;−;0;3;0;8;5;17;1;1;5;8;0;0;7;7;5;6;0;−;1;3;9;9;0;11;0;0
;tru;7;12;10;12;13;6;0;−;1;5;0;−;1;6;7;10;1;11;6;12;5;4;0;−;0;5;0;−;24;11;9;2;3;6;10;8;8;5;0;1;4;4;0;−;2;3;7;2;0;6;0;0;0;3;13;2;0;3;0;−;14;6;3;7;4;8;18;5;14;6;0;0;3;4;0;−;0;5;7;4;7;4;15;2;1;2;0;−;2;6;0;−;16;12;8;10;0;−;1;13;0;−;0;0;0;7;0;−;0;4;5;5;0;0;5;9;7;9;0;−;0;6;10;12;0;9;0;0
;tsy;4;5;6;8;0;6;0;0;0;3;0;−;0;3;2;6;0;5;2;6;0;3;0;−;0;3;0;−;7;4;5;2;13;50;5;4;3;2;0;0;0;31;0;0;1;2;5;1;0;4;0;−;1;1;3;2;1;3;0;−;3;3;3;2;2;6;6;6;3;6;0;0;0;3;0;−;1;1;2;9;2;3;9;4;1;5;0;−;1;2;0;−;2;3;1;4;0;2;0;9;0;−;0;−;0;4;0;−;0;2;3;3;0;0;6;18;2;3;0;0;29;12;1;4;0;3;0;−
;ttr;4;69;7;5;3;15;0;−;1;4;0;0;0;2;2;6;0;47;3;7;1;52;0;−;0;4;0;−;6;10;5;5;4;11;4;4;7;7;0;−;2;2;0;−;2;1;4;2;0;6;0;0;0;11;2;4;0;3;0;−;1;4;5;0;29;1871;5;43;8;386;0;9;0;35;0;1;1;19;5;13;19;813;6;36;70;1695;1;17;0;15;0;2;3;18;1;6;0;19;1;16;0;7;0;0;0;5;0;−;0;3;3;8;0;20;2;19;9;207;1;4;0;5;4;7;0;6;0;−
;vvi;5;5;7;13;5;10;0;0;2;5;0;1;1;1;4;5;3;2;7;1;4;3;0;−;3;5;0;1;6;19;9;5;3;6;5;8;3;7;0;0;8;7;0;−;1;2;9;5;3;2;0;−;0;5;1;9;4;6;0;−;4;2;5;4;5;9;11;11;12;13;0;2;16;20;0;−;3;1;9;1;7;11;11;5;3;2;0;−;1;3;0;0;6;4;8;6;0;0;0;18;0;−;0;3;5;2;0;0;2;0;4;8;0;0;5;5;9;0;0;0;2;6;11;11;4;9;0;1
;xtr;51;20;28;18;74;22;0;0;48;42;0;−;15;13;76;74;52;52;40;58;18;8;0;−;26;24;0;4;99;38;45;17;20;7;24;17;30;9;0;0;36;16;0;0;19;16;42;17;25;7;0;2;2;5;20;12;15;9;1;0;17;14;20;17;60;23;46;12;32;18;0;−;29;17;0;−;15;20;50;16;53;26;70;14;70;34;0;−;17;18;0;−;25;27;36;18;0;1;59;47;0;0;0;−;22;18;1;1;13;9;23;16;0;0;46;45;21;11;0;1;11;34;40;17;6;15;0;1
;zma;14;67;31;17;36;90;0;−;8;5;8;4;4;1;7;12;3;5;10;3;5;5;0;−;1;3;0;−;31;47;32;36;8;13;18;7;6;6;0;0;13;17;0;−;5;3;11;3;3;3;0;−;3;2;25;9;4;4;0;−;10;2;19;9;12;9;30;11;16;13;0;0;8;6;0;−;11;10;34;31;8;2;30;2;9;1;0;−;2;1;11;0;13;2;11;10;0;−;3;17;0;3;0;−;6;4;10;11;3;2;8;4;0;−;10;14;20;6;0;0;2;2;17;7;12;7;0;0
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
corrélation;;0.19;;0.70;;-0.01;;0.95;;0.78;;0.49;;0.19;;0.79;;0.19;;0.53;;-0.01;;0.78;;0.54;;-0.08;;0.65;;0.43;;0.03;;0.46;;0.49;;#DIV/0 !;;0.16;;-0.10;;0.30;;0.45;;0.06;;-0.15;;0.23;;0.62;;0.29;;-0.13;;0.70;;0.69;;0.53;;0.39;;0.20;;0.59;;1.00;;0.61;;0.90;;0.06;;0.10;;0.10;;0.83;;0.41;;0.82;;0.06;;0.51;;0.75;;0.60;;0.51;;-0.13;;#DIV/0 !;;0.36;;0.80;;0.15;;0.41;;0.00;;0.26;;0.15;;0.99;;0.35;;0.40;;0.36;;0.42;
total;;318;481;942;767;950;3242;5;75;295;595;25;39;118;414;477;646;193;899;443;554;212;745;25;37;153;395;6;41;1387;1152;850;539;360;1357;631;319;515;608;0;14;531;444;1;10;211;154;650;252;241;1618;2;18;84;214;543;299;122;288;1;1;368;338;491;366;601;5711;1070;715;697;2075;3;58;3200;3735;8;218;308;4099;822;1240;682;4374;916;569;444;6146;2;97;148;503;27;35;494;2030;594;480;5;126;307;1078;1;81;0;36;178;403;42;100;134;269;506;337;7;167;887;1309;430;1077;10;175;97;416;645;472;114;465;1;23
Indice doublons;;0.66;;1.23;;0.29;;0.07;;0.50;;0.64;;0.29;;0.74;;0.21;;0.80;;0.28;;0.68;;0.39;;0.15;;1.20;;1.58;;0.27;;1.98;;0.85;;0.00;;1.20;;0.10;;1.37;;2.58;;0.15;;0.11;;0.39;;1.82;;0.42;;1.00;;1.09;;1.34;;0.11;;1.50;;0.34;;0.05;;0.86;;0.04;;0.08;;0.66;;0.16;;1.61;;0.07;;0.02;;0.29;;0.77;;0.24;;1.24;;0.04;;0.28;;0.01;;0.00;;0.44;;0.42;;0.50;;1.50;;0.04;;0.68;;0.40;;0.06;;0.23;;1.37;;0.25;;0.04;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;double;aaa;double;aac;double;aag;double;aat;double;aca;double;acc;double;acg;double;act;double;aga;double;agc;double;agg;double;agt;double;ata;double;atc;double;atg;double;att;double;caa;double;cac;double;cag;double;cat;double;cca;double;ccc;double;ccg;double;cct;double;cga;double;cgc;double;cgg;double;cgt;double;cta;double;ctc;double;ctg;double;ctt;double;gaa;double;gac;double;gag;double;gat;double;gca;double;gcc;double;gcg;double;gct;double;gga;double;ggc;double;ggg;double;ggt;double;gta;double;gtc;double;gtg;double;gtt;double;taa;double;tac;double;tag;double;tat;double;tca;double;tcc;double;tcg;double;tct;double;tga;double;tgc;double;tgg;double;tgt;double;tta;double;ttc;double;ttg;double;ttt
;dre;275;249;575;469;490;462;9;14;151;138;0;−;24;41;177;181;113;138;161;262;75;28;3;10;22;52;1;8;348;173;129;128;59;45;224;162;143;122;0;−;108;96;4;7;89;90;177;137;57;49;17;6;24;34;147;55;110;133;2;1;161;138;124;145;128;96;107;42;158;86;4;6;265;102;1;2;86;25;66;25;24;22;391;444;87;180;0;10;171;58;2;3;131;95;146;85;1;4;136;99;3;5;1;3;92;116;0;1;36;43;160;175;2;11;98;37;22;21;0;8;19;53;110;86;123;117;0;9
E79 Repérage des effectifs supérieurs à 49[modifier | modifier le wikicode]
  • Lien aux tableaux: E79 Repérage des effectifs supérieurs à 49
  • Méthode: Recherche dans calc, des cellules du tableau des corrélations et indices de doublons, contenant un nombre inférieur à 40 (ou bien le caractère −); les colorer. Avec la fonction concat() de calc les cellules non colorées ont leur nombre préfixé par * astérisque. Avec toujours la même fonction les codons faibles xyc/t, taa, tag et tga à effectif supérieur à 6 est préfixé par &. Ces préfixes aident à les changer sous writer en bgcolor="#xxxxxx"|.
  • Légende:
    aaa1, aaa2, respectivement doublons et gènes différents des gènes tRNAs du codon aaa
    Rouge pour effectif supérieur à 49, Sauf pour les codons faibles xyc/t, taa, tag, tga.
    Cyan pour effectif supérieur à 39, Sauf pour les codons faibles xyc/t, taa, tag, tga. Après le changement d'astérisque en rouge (bgcolor="#ff3300"|) rechercher (bgcolor="#ff3300"|4) et le remplacer par (bgcolor="#66ffff"|4). Cependant il faut rechercher 3 effectifs supérieurs à 400 et leur réattribuer le rouge.
    Jaune pour les codons faibles xyc/t, taa, tag, tga dont l'effectif est supérieur à 6.
    Som− pour somme des tirets qui correspondent au nombre −1 pour les codons à effectif nul lors des décomptes directs( colonne diff et tot). Ce qui permet de calculer ici la ligne diff.
    db,diff: db pour doublon et diff pour différent, tout 2 issus des décomptes directs. diff est calculé ici comme suite: total de la colonne + 79 − "Som−".
    total total des codons correspondant au "tot" du décompte direct, db+diff.
    db+dif: somme de db et des "diff−1".
  • Duplications des gènes de tRNAs. E79-codons. Effectifs supérieurs à 49
KEGG;aaa1;aaa2;aac1;aac2;aag1;aag2;aat1;aat2;aca1;aca2;acc1;acc2;acg1;acg2;act1;act2;aga1;aga2;agc1;agc2;agg1;agg2;agt1;agt2;ata1;ata2;atc1;atc2;atg1;atg2;att1;att2;caa1;caa2;cac1;cac2;cag1;cag2;cat1;cat2;cca1;cca2;ccc1;ccc2;ccg1;ccg2;cct1;cct2;cga1;cga2;cgc1;cgc2;cgg1;cgg2;cgt1;cgt2;cta1;cta2;ctc1;ctc2;ctg1;ctg2;ctt1;ctt2;gaa1;gaa2;gac1;gac2;gag1;gag2;gat1;gat2;gca1;gca2;gcc1;gcc2;gcg1;gcg2;gct1;gct2;gga1;gga2;ggc1;ggc2;ggg1;ggg2;ggt1;ggt2;gta1;gta2;gtc1;gtc2;gtg1;gtg2;gtt1;gtt2;taa1;taa2;tac1;tac2;tag1;tag2;tat1;tat2;tca1;tca2;tcc1;tcc2;tcg1;tcg2;tct1;tct2;tga1;tga2;tgc1;tgc2;tgg1;tgg2;tgt1;tgt2;tta1;tta2;ttc1;ttc2;ttg1;ttg2;ttt1;ttt2
acs;2;2;6;3;3;2;0;−;1;1;0;−;0;0;1;2;0;2;2;2;0;2;0;−;0;0;0;−;4;7;4;1;0;2;3;1;2;2;0;−;2;0;0;0;1;0;2;0;0;2;0;−;0;0;2;1;0;2;0;−;2;1;2;1;5;1;6;1;1;3;0;−;0;5;0;−;0;2;6;5;5;2;5;1;1;0;0;−;0;1;0;−;2;0;2;2;0;−;0;5;0;−;0;−;0;0;0;−;0;1;4;0;0;0;8;3;3;3;0;−;0;1;4;0;1;0;0;−
aga;3;4;10;1;15;1;0;−;1;0;0;−;3;2;7;0;0;1;4;1;0;1;0;−;0;1;0;−;13;4;10;1;2;1;16;4;5;5;0;−;6;1;0;−;7;5;2;4;4;3;0;−;0;−;9;0;1;1;0;−;8;1;3;1;8;2;18;1;12;2;0;−;1;1;0;−;4;1;13;3;7;0;14;0;0;−;0;−;2;0;0;−;21;7;24;6;0;0;1;20;0;−;0;−;1;0;0;−;7;0;4;1;0;−;4;0;5;0;0;−;1;4;8;0;0;3;0;−
aml;5;*49;10;17;12;*759;0;5;1;7;0;−;0;9;4;5;0;16;3;9;1;*43;0;1;0;5;0;−;11;12;7;4;1;*41;7;0;4;20;0;−;3;7;0;−;3;1;7;1;2;*81;0;0;2;4;5;2;0;4;0;−;2;4;2;4;4;6;5;5;3;33;0;0;2;6;0;−;1;3;3;13;3;3;8;1;2;4;0;−;0;6;0;−;7;1;8;1;0;0;1;9;0;&9;0;−;0;5;0;−;0;3;6;3;0;1;13;11;3;6;0;−;1;3;8;2;2;6;0;−
ath;10;5;10;8;14;4;0;−;4;4;0;0;2;3;7;2;1;8;7;8;4;3;0;−;3;1;1;0;16;15;15;1;6;3;6;5;4;4;0;−;*41;5;0;−;2;2;11;4;4;1;0;−;1;2;4;6;6;4;0;0;2;0;9;2;7;8;21;7;9;3;0;−;7;2;0;−;4;2;13;2;11;1;16;8;4;0;0;−;4;2;1;0;6;1;12;2;0;0;*50;32;0;−;0;−;6;5;1;1;3;3;26;10;0;−;4;13;11;4;0;−;3;2;16;4;6;5;0;−
bacu;4;*81;17;6;5;23;0;−;1;6;0;−;0;3;4;8;0;*54;3;9;0;*66;0;−;0;7;0;0;8;12;6;5;2;7;7;3;4;15;0;−;2;2;0;−;2;1;5;1;1;7;0;−;1;19;3;5;0;3;0;−;3;3;4;1;*47;*2320;7;37;21;*446;1;&18;0;*41;0;−;1;18;2;17;25;*961;13;*50;*103;*2044;1;&10;0;17;0;0;8;23;5;8;0;&23;0;13;0;&8;0;−;0;4;0;0;0;3;3;6;0;&16;5;18;13;*242;0;1;1;11;4;8;0;7;0;−
bdi;3;8;10;5;16;1;0;−;2;7;2;0;2;3;2;6;2;6;12;5;4;5;0;−;1;2;0;1;25;30;13;6;7;7;14;6;8;2;0;2;8;9;0;−;5;2;11;3;4;0;0;0;2;3;12;3;6;3;0;−;7;0;7;6;8;6;21;4;16;2;0;−;7;5;0;−;9;1;16;2;6;2;19;8;8;0;0;−;2;2;2;1;8;2;11;4;0;−;3;13;0;−;0;0;5;4;1;2;4;0;8;2;0;−;6;8;12;5;0;−;2;1;13;4;9;6;0;−
bta;10;*67;16;13;15;24;0;−;2;7;0;0;0;6;4;9;0;*43;8;10;2;*113;0;3;0;7;0;−;16;18;14;3;2;17;14;4;8;31;0;3;6;2;0;−;3;0;11;1;1;10;0;6;3;12;7;5;0;4;0;−;3;2;6;4;11;*423;9;32;3;*160;0;5;4;30;0;1;2;13;12;18;6;*384;8;*54;29;*1265;0;&19;2;18;0;−;12;26;7;12;0;3;1;37;0;&12;0;&10;0;6;4;&27;0;6;8;4;0;&28;25;*312;5;*172;&9;&133;0;9;12;17;0;13;0;5
cbr;11;4;20;2;36;3;0;−;6;3;0;−;5;3;20;1;7;2;6;2;1;0;0;−;8;15;0;−;18;4;17;3;19;4;18;2;6;3;0;−;30;10;0;−;2;1;2;3;4;5;0;−;0;−;17;4;3;1;0;−;2;4;21;4;15;3;27;6;21;8;0;−;13;0;0;−;2;4;22;6;33;8;16;4;0;4;0;−;2;3;0;−;3;2;18;6;0;−;13;5;0;−;0;−;3;4;0;−;4;3;14;2;0;−;14;1;12;0;0;−;2;3;16;5;1;9;0;−
cbre;20;8;28;4;*45;3;0;−;12;2;0;0;6;3;26;4;10;2;9;4;4;6;0;−;13;12;0;0;24;4;31;1;29;10;21;4;6;4;0;0;*48;5;1;0;4;4;13;11;11;5;0;−;13;10;28;3;6;1;0;−;3;4;29;2;27;8;31;2;34;2;0;−;7;3;0;−;2;3;33;1;*61;4;25;13;11;13;0;−;3;4;0;−;7;7;30;2;0;−;20;7;0;−;0;1;7;6;0;−;3;5;16;3;1;1;16;4;19;2;0;1;4;2;18;5;2;11;0;−
cel;13;0;17;2;24;5;0;−;9;1;0;−;2;4;14;2;5;2;6;2;1;2;0;0;3;3;0;−;16;2;19;1;15;4;13;5;4;2;0;−;23;7;0;−;3;0;2;3;4;3;0;−;0;0;14;3;2;0;0;−;3;1;14;5;14;2;20;6;19;4;0;−;7;1;0;−;0;3;16;5;28;5;10;3;2;0;0;−;1;3;0;−;4;1;15;3;0;−;7;11;0;−;0;−;2;6;0;−;3;2;11;3;0;1;11;1;9;2;0;−;1;2;10;4;0;6;0;−
cfa;6;27;8;12;10;*397;0;0;1;2;0;−;0;4;2;5;0;8;2;5;1;27;0;−;0;4;0;−;6;16;4;4;1;*41;7;1;4;15;0;−;1;6;0;−;2;1;7;0;0;14;0;−;1;2;1;4;0;3;0;−;4;2;3;0;4;10;9;3;6;15;0;1;3;7;0;−;0;3;3;10;7;3;8;2;2;6;0;−;0;4;0;−;5;2;2;3;0;2;0;8;0;2;0;−;0;4;0;−;1;6;5;4;0;0;9;11;0;5;0;−;0;3;4;5;0;4;0;−
cge;5;9;8;8;11;*74;0;−;1;2;0;0;0;3;1;6;0;4;3;5;1;4;0;−;0;4;0;−;7;8;10;2;1;3;11;2;5;5;0;−;4;1;0;−;2;0;6;0;2;3;0;−;0;2;3;2;0;3;0;−;5;4;3;1;2;4;10;4;6;13;0;−;1;13;0;0;1;4;5;16;5;0;9;4;2;4;0;0;1;3;0;−;3;5;4;8;0;−;0;10;0;−;0;−;0;2;0;−;0;2;5;0;0;1;24;16;2;3;0;−;0;3;4;3;0;3;0;−
cjap;23;6;20;2;30;6;0;−;7;4;0;−;8;2;17;6;9;2;12;2;2;0;0;−;2;4;0;−;25;4;20;5;11;2;12;4;11;4;0;−;33;9;0;−;7;0;7;1;6;4;0;−;0;0;17;3;2;3;0;−;5;6;22;3;16;3;32;8;31;8;0;−;6;4;0;−;7;0;23;7;36;10;24;9;0;1;0;−;2;4;0;−;8;4;19;3;0;−;22;1;0;−;0;−;4;2;0;−;10;4;14;4;0;0;12;2;14;3;0;−;0;4;19;4;0;6;0;0
cjc;5;10;9;17;4;11;0;−;0;6;0;0;0;3;1;8;0;5;3;4;1;3;0;−;0;4;0;2;7;12;5;7;0;6;5;3;5;7;0;0;3;2;0;−;3;0;6;0;0;3;2;0;1;2;4;1;0;3;0;−;3;8;4;3;3;17;8;5;6;8;0;0;1;4;0;1;1;2;2;12;6;2;9;5;1;3;0;−;1;4;0;2;4;6;3;3;0;0;10;24;0;2;0;0;1;3;0;−;0;3;5;3;0;1;9;22;1;9;0;−;0;10;4;3;0;6;0;−
cmk;5;37;16;31;11;24;0;1;*49;*156;0;&11;4;*132;7;16;0;13;10;22;5;6;0;−;4;18;0;−;20;*73;8;22;1;5;10;26;8;9;0;0;7;*43;0;5;0;*40;1;10;3;21;0;−;0;1;4;4;2;17;0;1;5;19;6;13;7;*58;14;34;22;*405;0;5;*2889;*3008;3;&164;*100;*3757;19;*55;22;*43;12;6;7;*73;0;1;29;*115;0;*15;37;*1502;6;15;0;0;7;28;0;3;0;0;3;*50;0;0;0;*47;12;13;0;2;5;9;10;19;0;0;1;11;10;24;1;29;0;2
cpic;4;31;5;11;2;6;0;0;1;16;0;−;0;4;1;15;1;24;1;18;0;9;0;2;0;12;0;0;5;10;2;8;1;14;2;7;1;9;0;−;1;2;0;0;0;1;4;7;1;3;0;−;0;2;2;4;0;3;0;0;2;3;0;1;0;16;4;9;2;2;0;−;3;11;0;0;0;3;1;9;10;13;5;5;1;0;0;−;0;4;0;−;0;5;1;14;0;0;0;4;0;1;0;0;0;14;0;−;1;8;2;21;0;3;4;13;1;8;0;4;0;12;2;19;1;5;0;1
cpo;4;6;9;8;7;18;0;−;1;2;0;−;0;2;0;9;0;4;3;6;1;3;0;−;0;4;0;−;5;9;7;2;2;1;6;1;3;4;0;−;2;1;0;−;2;0;6;1;0;3;0;−;0;2;4;2;0;2;0;−;4;1;3;1;2;3;6;3;4;0;0;0;2;6;0;3;0;4;4;23;2;3;6;4;1;4;0;−;1;1;0;0;3;2;4;1;0;−;4;10;0;0;0;−;1;1;0;−;1;2;6;1;0;0;18;15;1;6;0;−;0;3;5;2;0;5;0;−
csi;4;10;10;3;6;15;0;1;2;5;0;−;0;4;3;6;0;5;7;5;0;6;0;−;0;4;0;−;11;14;7;5;2;2;8;1;4;7;0;−;4;2;0;−;2;1;8;1;1;3;0;−;2;1;4;5;1;2;0;−;2;1;3;2;4;6;6;6;4;*72;0;0;1;11;0;−;1;4;7;15;2;1;8;1;3;5;0;−;0;6;0;0;4;10;5;5;0;−;0;10;0;0;0;−;2;2;0;−;0;3;8;4;0;0;4;19;4;3;0;−;0;4;7;5;0;5;0;−
dme;4;1;9;0;12;0;0;−;4;1;0;−;2;0;6;2;0;2;4;1;2;0;0;−;0;1;0;−;8;3;8;1;2;1;4;0;4;3;0;−;4;0;0;−;2;2;6;0;6;3;0;−;0;−;9;0;1;0;0;−;7;0;3;0;5;0;11;2;10;4;0;−;0;1;0;−;2;0;10;1;4;1;12;1;0;−;0;−;1;0;0;−;5;1;4;1;0;−;0;8;0;−;0;−;0;1;0;−;3;0;5;2;0;0;3;3;6;1;0;−;0;3;7;0;0;3;0;−
dno;4;13;17;5;13;29;0;−;1;6;0;−;0;6;1;9;0;8;3;6;1;*45;0;−;0;5;0;0;10;19;6;5;2;2;6;3;3;6;0;0;5;1;0;−;1;2;6;0;1;6;0;−;0;4;5;4;0;2;0;−;6;3;3;1;5;14;12;8;7;37;0;−;2;*63;0;1;1;15;7;15;10;23;10;8;4;*321;0;&23;0;15;0;0;5;*75;4;7;0;−;3;10;0;−;0;−;1;4;0;−;0;5;7;2;0;0;9;12;3;11;0;−;0;7;5;6;1;6;0;−
dsi;2;1;5;0;10;0;0;−;3;1;0;−;2;1;7;0;0;3;1;1;1;1;0;−;0;−;0;−;8;3;6;2;2;1;4;1;4;3;0;−;3;1;0;−;2;2;5;0;2;2;0;−;0;−;8;0;1;0;0;−;8;0;4;0;2;2;5;0;6;3;0;−;0;−;0;−;3;1;8;0;3;1;13;1;0;−;0;−;1;0;0;−;4;1;5;1;0;−;0;9;0;−;0;−;0;1;0;−;2;0;5;2;0;0;4;2;7;1;0;−;0;2;5;2;0;3;0;−
dya;3;2;10;0;12;3;0;0;4;1;0;−;4;0;7;0;0;2;4;3;2;1;0;−;0;1;0;−;11;3;8;1;3;0;4;0;3;4;0;−;7;0;0;−;3;1;5;0;5;1;0;−;0;−;11;0;1;0;0;−;7;0;4;0;5;1;14;2;11;2;0;−;1;0;0;−;2;2;14;3;5;1;14;1;0;0;0;−;1;0;0;−;8;2;5;1;0;−;0;8;0;−;0;−;0;1;0;−;4;0;6;2;0;0;5;2;6;1;0;−;1;3;8;0;0;3;0;−
ecb;7;7;9;7;8;7;0;0;2;4;0;−;0;2;2;6;0;4;5;6;1;5;0;−;0;4;0;−;12;12;13;6;2;3;8;2;6;5;0;0;4;2;0;−;1;1;9;0;1;2;0;−;2;1;6;3;0;4;0;−;1;1;5;1;5;5;5;4;3;*47;0;−;2;8;0;−;1;6;11;15;2;1;9;0;3;4;0;−;0;5;0;2;9;5;7;4;0;−;4;9;0;−;0;0;0;3;0;−;0;3;8;3;0;3;10;14;3;3;0;−;0;3;8;3;0;5;0;−
eeu;6;4;5;1;28;*120;0;−;0;5;0;−;0;3;2;6;0;4;4;2;1;5;0;−;0;3;0;−;10;5;7;1;1;2;4;0;2;5;0;−;3;1;0;−;2;0;8;1;1;3;0;−;1;1;3;2;0;2;0;−;2;3;4;1;3;4;9;3;5;3;0;−;0;9;0;−;0;3;4;9;5;1;10;3;2;2;0;−;0;5;0;−;2;1;3;3;0;−;0;12;0;−;0;−;0;2;0;−;0;2;5;1;0;1;14;19;2;4;0;−;0;2;5;2;0;5;0;−
fca;5;*44;7;20;8;*878;0;4;1;11;0;−;0;8;3;5;0;*53;4;7;1;*51;0;1;0;8;0;−;9;14;8;1;5;*776;8;7;2;*44;0;1;4;*63;0;0;2;4;6;1;7;*1193;0;&8;0;23;5;3;0;32;0;−;2;2;5;0;4;10;7;1;3;*40;0;0;1;8;0;0;1;5;4;13;2;*45;7;2;1;4;0;1;0;5;0;−;6;2;4;3;1;&35;1;8;0;&11;0;−;1;12;0;0;0;4;5;2;0;&17;13;18;1;21;0;0;0;18;4;7;0;7;0;0
gac;30;30;*82;*40;*74;22;0;0;19;15;0;−;14;8;*49;*49;*43;24;14;15;21;4;0;−;*46;14;0;−;*221;*64;*84;16;*47;12;33;18;*61;19;0;−;22;6;0;−;13;4;*58;4;*65;13;0;−;0;1;37;11;5;11;0;−;6;2;31;17;22;23;*135;*48;28;24;0;−;36;16;0;−;*41;14;31;21;*40;20;10;1;1;2;0;−;4;7;0;0;7;10;9;11;0;−;4;12;0;−;0;−;*43;18;0;−;23;5;38;13;0;0;*72;34;*47;26;0;−;4;7;23;11;1;5;0;−
gfr;2;1;1;4;1;5;0;0;0;3;0;−;0;0;2;2;0;2;3;2;0;1;0;−;0;1;0;0;2;3;4;1;0;1;0;3;1;1;0;−;1;3;0;−;0;0;3;0;0;1;0;−;0;−;1;4;0;−;0;−;2;4;1;2;0;3;1;3;4;1;0;−;0;4;0;−;0;1;9;6;2;1;7;0;1;2;0;−;0;0;0;0;1;1;0;1;0;−;4;7;0;−;0;−;0;2;0;−;0;0;1;0;0;−;5;4;0;2;0;−;0;10;4;1;0;1;0;−
gga;2;3;5;5;4;1;0;−;1;2;0;−;0;1;0;3;0;3;3;3;0;2;0;−;0;1;0;−;8;5;6;0;0;1;2;3;2;2;0;−;1;2;0;−;1;1;6;0;0;1;0;−;0;1;4;3;0;1;0;−;2;4;0;2;2;6;7;2;5;1;0;−;3;3;0;−;0;3;13;10;3;3;5;1;2;1;0;−;0;2;0;0;2;4;2;4;0;−;3;12;0;−;0;−;1;2;0;−;1;0;4;4;0;0;6;4;3;2;0;−;0;2;5;4;0;2;0;−
ggo;3;10;9;19;5;13;0;1;1;4;0;−;1;4;2;6;0;4;4;3;1;4;0;−;0;5;0;2;10;6;5;8;1;9;6;0;5;15;0;−;3;3;0;−;3;0;5;4;1;4;0;−;2;2;3;3;0;4;0;−;1;3;4;4;3;12;7;7;2;6;0;−;1;5;0;1;0;4;3;19;1;3;5;7;4;4;0;−;0;7;0;0;5;5;2;6;1;0;1;21;0;2;0;3;0;4;0;1;0;4;6;4;0;2;5;29;2;6;0;0;1;7;5;7;0;8;0;−
gmo;17;*45;16;17;20;22;0;1;6;23;0;−;7;22;10;19;2;18;0;−;7;20;0;0;2;15;0;−;*42;*111;5;20;3;7;10;15;22;22;0;0;6;14;0;0;10;11;25;29;2;14;0;1;3;6;8;22;4;19;0;−;13;33;11;21;12;38;15;14;20;29;0;0;4;19;0;−;6;19;24;30;18;20;17;12;4;13;0;−;0;8;0;−;9;18;8;12;0;0;3;*46;0;3;0;−;3;14;&14;&26;1;12;12;17;0;1;8;18;10;18;0;−;1;14;12;23;0;14;0;5
gmx;15;4;12;9;20;1;0;1;5;4;0;0;2;1;3;5;10;7;16;11;10;2;0;−;5;2;0;−;22;13;12;18;10;2;15;2;8;4;0;−;20;6;0;−;3;1;16;4;6;2;0;−;1;3;11;1;7;2;0;−;6;0;15;0;12;3;25;7;17;6;0;−;12;4;0;−;5;2;21;2;16;1;26;2;6;2;0;−;5;3;0;0;11;1;15;6;0;−;1;19;0;−;0;−;6;4;0;−;4;1;10;4;0;−;13;0;15;2;0;−;4;4;17;4;10;7;0;−
hgl;3;4;5;3;4;10;0;−;0;3;0;1;0;3;0;14;0;5;2;4;1;3;0;1;0;2;0;−;6;7;5;2;0;2;5;1;3;2;0;−;1;3;0;−;1;1;4;8;0;3;0;−;0;3;2;2;0;4;0;−;1;3;2;2;2;3;4;5;3;0;0;1;1;3;0;5;1;4;1;*44;1;2;6;3;1;1;0;3;1;2;0;0;3;2;1;10;0;−;0;6;0;−;0;−;0;2;0;−;0;2;2;4;3;3;5;17;1;4;0;−;0;3;4;1;0;4;0;−
hsa-18;4;7;8;16;5;9;0;−;0;5;0;−;0;4;3;5;0;5;2;5;0;4;0;−;0;4;2;0;11;8;5;9;2;3;8;0;6;6;0;−;4;2;0;−;2;1;7;1;0;5;0;−;2;1;5;1;0;2;0;−;7;1;5;3;3;4;10;2;6;1;0;−;1;6;0;−;0;3;10;15;5;3;9;4;2;2;0;−;1;3;0;−;7;5;4;5;0;−;0;12;0;−;0;0;0;3;0;−;0;3;5;3;0;1;6;22;2;4;0;−;0;3;5;4;0;6;0;−
lav;14;*45;14;36;14;21;0;3;5;16;0;0;0;9;1;12;0;*89;7;*68;2;13;0;2;0;6;0;−;16;33;13;29;3;10;14;12;5;22;0;2;2;11;0;−;2;0;9;6;4;13;0;−;0;2;4;9;0;10;0;−;4;5;4;17;7;*106;6;13;6;17;0;−;6;*46;0;−;0;14;14;39;3;*615;7;25;2;*69;0;3;11;38;0;0;9;25;7;33;0;1;0;18;0;−;0;0;0;6;0;−;1;2;9;19;0;&23;5;22;6;16;0;0;1;13;13;18;3;13;0;0
lcm;7;12;2;6;4;8;0;2;1;7;0;−;0;1;3;7;0;8;1;6;0;7;0;−;0;6;0;−;3;7;1;5;1;8;2;2;2;6;0;−;3;6;0;−;0;3;2;9;0;3;0;−;0;0;2;1;1;3;0;−;0;7;1;2;2;8;3;15;2;5;0;0;1;18;0;−;1;1;3;1;0;4;2;4;1;0;0;−;0;6;0;−;1;2;0;2;0;0;0;7;1;1;0;1;0;5;0;−;0;2;0;2;0;3;3;13;2;12;0;4;0;10;1;5;0;3;0;−
lma;0;0;2;0;2;1;0;−;0;0;0;−;1;0;2;0;0;0;0;1;0;0;0;−;0;0;0;−;2;1;2;0;0;0;1;0;2;0;0;−;0;0;0;−;1;0;1;0;0;0;0;−;0;0;3;0;0;0;0;−;1;0;2;0;0;0;2;0;1;0;0;−;0;0;0;−;1;0;1;0;0;0;3;0;0;0;0;−;0;0;0;−;1;0;1;0;0;−;1;1;0;−;0;−;0;0;0;−;0;0;0;0;0;−;0;0;0;0;0;−;0;0;1;0;0;0;0;−
mcc;6;12;6;20;7;8;0;1;0;5;0;−;0;3;3;6;0;5;4;3;1;5;0;−;0;6;0;5;5;13;4;7;1;14;10;3;4;9;0;−;3;6;0;0;2;0;6;1;0;4;0;−;2;1;3;2;0;4;0;−;2;3;2;6;2;9;6;8;2;3;0;0;0;10;0;0;1;3;4;17;2;2;6;8;3;4;0;−;1;5;0;2;4;7;3;6;0;1;0;30;0;1;0;0;4;15;0;1;0;3;5;3;0;1;8;19;3;5;0;1;1;14;5;4;1;7;0;−
mdo;9;3;9;3;10;8;0;−;5;1;0;−;0;2;6;5;0;5;7;1;1;3;0;−;0;6;0;−;14;10;12;0;0;6;8;0;8;2;0;−;5;2;0;−;2;0;10;0;2;2;0;−;1;2;0;4;0;5;0;−;5;5;5;2;10;3;12;11;10;2;0;0;3;5;0;−;2;3;9;5;4;6;19;4;6;1;0;−;1;3;0;−;6;2;6;2;0;−;2;12;0;−;0;−;1;4;0;−;0;2;6;5;0;−;31;14;3;5;0;3;0;1;8;3;1;2;0;−
meu;3;6;10;3;8;2;0;−;3;2;0;−;0;2;3;4;1;5;6;3;0;3;0;−;0;5;0;−;7;6;4;1;1;2;6;0;1;5;0;0;3;0;0;−;1;0;4;2;2;2;0;−;0;2;2;4;1;2;0;−;1;4;2;2;6;5;1;11;5;1;0;−;0;5;0;−;2;2;4;8;6;3;7;8;2;2;0;−;0;0;0;−;3;3;5;2;0;−;0;7;0;−;0;0;2;1;0;−;0;1;6;1;3;3;19;9;1;6;0;−;0;2;3;6;0;7;0;0
mgp;2;1;2;1;1;1;0;−;0;1;0;−;0;−;0;3;0;2;1;4;1;1;0;−;0;0;0;−;7;3;1;1;0;0;0;2;0;0;0;−;0;1;0;−;0;0;5;1;0;0;0;−;0;1;0;1;0;0;0;−;1;2;0;0;1;3;2;0;3;2;0;−;2;3;0;−;0;2;4;2;2;1;4;0;1;1;0;−;0;1;0;0;0;2;0;2;0;−;2;3;0;−;0;−;0;2;0;−;0;0;2;2;0;−;2;2;2;2;0;−;0;0;2;3;0;1;0;−
mlu;1;1;7;1;4;6;0;−;2;2;0;−;0;2;2;2;1;3;2;2;0;4;0;−;0;2;0;−;8;5;6;3;0;2;4;2;2;4;0;4;0;2;0;−;2;0;5;0;1;3;0;−;0;1;1;4;0;1;0;−;3;1;1;1;1;3;5;2;5;0;0;−;0;0;0;−;0;2;3;4;4;1;6;1;1;1;0;−;0;2;0;−;4;0;3;1;0;−;0;4;0;−;0;−;0;1;0;−;0;1;4;1;0;−;17;9;2;1;0;−;0;1;3;1;0;2;0;−
mmr;3;1;4;4;4;1;0;−;0;2;0;−;0;1;0;2;0;4;2;4;0;2;0;−;1;1;0;−;8;5;2;1;1;2;3;2;7;4;0;−;1;2;0;−;2;0;6;0;1;1;0;−;0;1;2;3;0;1;0;−;4;2;3;1;3;5;3;1;4;3;0;−;0;4;0;−;0;2;3;7;5;1;8;2;0;1;0;−;0;1;0;−;3;1;2;1;0;−;0;7;0;−;0;−;0;1;0;−;0;2;1;5;0;−;11;8;2;3;0;0;0;2;6;1;0;2;0;−
mmu;8;5;8;4;7;18;0;−;1;2;0;−;0;3;2;8;0;5;2;5;1;3;0;−;0;4;0;0;8;10;7;4;1;5;7;2;5;6;0;0;3;4;0;0;2;0;5;2;1;3;0;−;0;2;3;2;0;3;0;−;6;3;2;2;5;2;12;3;8;5;0;−;3;7;0;3;3;6;4;18;6;1;9;5;2;4;0;1;2;0;0;0;4;7;2;5;0;0;0;10;0;−;0;−;1;1;0;0;0;2;5;4;0;0;32;27;2;5;0;0;2;4;4;2;0;3;0;−
mpu;6;24;4;7;5;*265;0;5;1;5;0;−;0;4;2;7;1;14;4;7;0;20;0;−;0;4;0;−;6;13;6;3;2;34;5;1;3;13;0;0;1;5;0;−;1;0;8;0;1;27;0;−;2;2;3;2;0;3;0;−;2;2;4;1;1;5;4;3;4;14;0;−;1;6;0;−;1;3;2;12;2;6;7;1;1;2;0;−;0;5;0;−;3;3;3;4;0;1;0;8;0;4;0;−;0;3;0;−;0;3;5;2;0;0;15;9;2;8;0;−;0;3;6;4;0;5;0;−
mtr;7;12;14;15;13;2;4;&43;3;6;2;1;0;0;8;1;2;5;6;8;2;3;0;−;7;6;0;−;18;22;14;8;10;9;10;7;2;2;0;−;8;2;0;0;0;0;6;0;3;1;0;−;1;1;5;6;6;3;0;−;2;1;3;5;13;8;16;13;8;2;0;0;8;7;0;−;0;2;15;9;9;5;19;3;1;1;0;0;2;4;0;2;2;4;11;5;2;&29;2;10;0;−;0;2;4;3;1;1;1;0;7;4;0;0;7;2;7;6;0;0;3;4;20;5;5;8;0;0
mun;1;1;4;4;3;9;0;−;0;1;0;−;0;−;1;3;0;3;0;7;1;2;0;−;0;0;0;−;6;2;3;1;1;0;0;3;0;4;0;−;1;2;0;−;0;1;0;2;0;0;0;−;0;0;1;1;0;−;0;−;0;5;0;2;0;2;4;4;0;0;0;−;0;4;0;−;0;1;7;1;5;5;4;5;0;0;0;−;0;0;0;0;2;1;1;2;0;0;2;4;0;−;0;−;1;3;0;0;0;1;0;3;0;0;0;4;1;2;0;−;1;2;2;3;0;2;0;−
nle;8;14;7;13;6;13;0;2;0;5;0;−;0;4;3;8;0;6;3;5;1;3;0;−;0;4;0;2;7;9;4;8;2;7;7;3;3;13;0;−;2;2;0;1;3;0;5;3;0;6;0;−;1;1;4;2;0;3;0;−;3;5;4;5;2;11;5;7;7;9;0;−;0;10;0;0;1;3;2;16;4;1;5;7;1;8;0;−;0;5;0;0;4;8;4;6;0;2;0;18;0;4;0;−;0;5;1;2;0;4;3;6;0;2;9;13;0;9;0;0;0;7;4;12;0;5;0;0
oaa;7;24;10;10;10;14;0;−;2;15;0;0;2;7;7;15;0;5;6;11;2;6;&7;&10;2;7;0;−;14;17;10;16;3;7;4;19;5;13;0;0;3;8;0;3;4;2;13;5;2;4;0;−;3;10;4;7;2;4;0;−;5;12;3;4;3;12;13;13;13;13;0;−;6;10;0;−;3;7;32;*50;6;8;17;22;4;4;0;1;2;12;0;0;5;4;7;15;0;2;2;25;0;−;0;−;0;5;0;3;1;6;0;−;0;4;18;18;5;8;0;−;3;6;6;17;0;9;0;0
oas;5;16;8;4;5;10;0;−;1;3;0;−;0;2;0;4;0;21;1;5;1;31;0;−;0;4;0;−;4;13;3;2;0;6;3;4;3;5;0;−;2;3;0;−;0;0;3;0;0;5;0;1;0;5;0;1;0;2;0;−;0;1;3;2;3;*135;2;5;3;*56;0;1;0;11;0;2;1;5;7;10;1;*131;3;26;2;*338;0;4;0;7;0;−;2;6;3;3;0;−;0;15;0;2;0;1;0;3;0;2;0;2;1;0;0;3;5;*55;2;*44;0;&15;0;4;2;3;0;6;0;0
ocu;4;7;11;14;9;19;0;0;1;5;0;0;0;4;2;5;0;5;7;2;1;4;0;−;0;6;0;0;8;9;6;4;2;2;8;0;8;6;0;−;2;2;0;−;3;0;8;0;2;2;0;−;1;2;4;2;0;3;0;−;10;5;2;2;9;8;17;5;14;4;0;0;0;8;0;−;0;3;7;13;12;1;18;2;5;10;0;−;3;4;0;−;10;3;4;7;0;−;0;11;0;−;0;−;0;3;0;−;1;3;7;2;0;0;9;15;3;6;0;−;1;4;6;7;0;2;0;−
oga;4;6;8;3;4;4;0;−;1;4;0;−;0;2;1;7;0;3;2;4;0;4;0;1;0;10;0;&8;5;7;6;3;1;3;7;0;5;3;0;−;1;2;0;−;2;0;6;0;0;3;0;−;0;2;2;3;0;2;0;−;5;3;3;0;1;3;9;3;6;1;0;−;2;4;0;−;1;1;5;7;3;5;7;4;2;0;0;−;1;1;0;−;3;1;3;2;0;0;1;6;0;−;0;−;1;1;0;−;0;2;2;3;0;0;10;10;0;5;0;−;0;2;4;1;0;4;0;0
oni;9;6;8;0;22;20;0;−;3;21;0;0;1;6;6;11;1;25;5;4;12;5;0;1;5;19;0;−;20;6;12;12;1;4;9;13;7;3;0;−;6;4;0;−;2;1;10;3;0;6;0;−;0;5;12;3;1;5;0;−;8;7;5;8;6;7;6;3;13;1;0;−;5;5;0;−;4;7;11;6;6;5;8;4;2;6;0;−;2;6;0;−;7;1;6;1;0;−;0;17;0;−;0;2;1;8;0;−;1;4;6;3;0;0;8;33;7;4;0;0;0;11;9;13;0;6;0;−
opr;3;5;9;4;4;6;0;−;1;4;0;−;0;6;1;5;0;4;4;2;1;4;0;−;0;3;0;−;11;3;6;1;2;2;4;0;6;5;0;−;1;2;0;−;3;0;7;0;1;4;0;−;1;2;4;2;0;4;0;−;8;2;2;2;3;3;11;2;7;3;0;−;1;5;0;−;1;2;4;10;5;1;11;5;3;1;0;−;0;3;0;−;5;1;2;4;0;−;0;9;0;−;0;−;0;2;0;−;1;2;5;1;0;0;6;3;2;3;0;−;0;2;4;5;0;3;0;−
osa;4;7;17;12;15;4;0;−;9;6;5;2;3;1;8;2;6;5;14;5;6;4;0;−;2;2;0;−;31;28;14;3;9;11;16;9;3;6;0;−;5;8;0;−;3;5;10;3;2;1;0;−;3;4;17;6;5;4;0;−;8;1;11;3;10;5;20;10;14;10;0;0;9;0;0;0;8;4;16;3;5;4;19;8;4;4;0;−;3;0;&13;3;7;3;11;6;0;−;3;16;0;−;0;1;10;6;3;0;3;5;7;4;0;−;8;8;11;6;0;0;1;2;13;6;14;4;0;−
pan;6;12;9;19;6;10;0;1;0;7;0;−;0;6;4;6;0;5;4;6;1;3;0;−;0;6;0;1;8;10;5;8;2;11;9;0;4;9;0;−;2;3;0;−;3;0;5;3;0;4;0;−;2;1;4;2;0;2;0;−;6;5;4;3;7;5;8;6;7;2;0;1;0;9;0;0;1;3;4;15;6;1;10;9;3;5;0;−;2;4;0;1;6;5;4;4;0;2;1;22;0;−;0;3;0;8;0;0;0;2;6;3;0;2;12;17;4;5;0;3;0;9;9;4;0;8;0;0
pfa;0;−;0;0;0;−;0;−;0;0;0;−;0;0;0;−;0;0;0;0;0;−;0;−;0;0;0;−;0;1;0;0;0;0;0;−;0;0;0;−;0;0;0;−;0;0;0;0;0;0;0;−;0;−;0;−;0;0;0;−;0;0;0;0;0;0;0;0;0;0;0;−;0;0;0;−;0;0;0;0;0;0;0;−;0;−;0;−;0;0;0;−;0;0;0;0;0;−;0;0;0;−;0;−;0;0;0;−;0;0;0;0;0;−;0;−;0;−;0;−;0;0;0;0;0;0;0;−
pha;6;5;8;9;6;5;0;0;0;6;0;−;0;5;4;5;0;5;4;4;1;3;0;−;0;3;0;1;9;5;5;6;2;3;9;0;4;6;0;−;2;3;0;−;3;0;5;1;1;4;0;−;2;1;3;3;0;2;0;−;1;4;4;4;6;6;6;3;3;0;0;0;0;8;0;0;1;3;3;15;2;1;6;6;3;4;0;−;2;4;0;0;6;5;5;3;0;0;2;12;0;−;0;−;0;4;0;−;0;2;6;2;0;0;13;14;3;4;0;1;0;6;9;2;1;5;0;−
pma;17;6;*100;*67;13;9;0;−;10;8;&8;&10;11;11;29;32;8;9;34;30;25;24;0;−;3;6;0;−;*187;*90;*47;*62;23;20;15;11;*60;*47;0;0;29;13;0;−;12;8;36;17;17;8;0;0;4;5;*55;29;26;13;0;−;37;37;*56;*55;3;8;*56;33;8;2;0;1;21;9;0;−;18;5;*62;*43;13;3;29;24;4;1;0;0;7;18;0;0;*46;24;*96;*69;1;0;*40;*49;0;0;0;−;10;9;0;−;18;16;14;7;0;0;38;29;1;7;0;−;2;2;34;22;18;23;0;1
pop;13;4;11;12;15;1;0;−;5;5;0;−;2;1;2;4;5;5;10;5;7;3;0;0;6;2;0;0;18;7;14;5;10;0;9;3;4;6;0;−;13;9;0;−;2;1;12;1;5;1;0;−;1;4;4;7;0;−;0;0;5;1;13;35;13;0;29;4;13;7;0;−;13;7;0;−;2;2;18;1;10;6;21;4;6;0;0;−;5;2;0;−;6;4;13;3;0;0;2;15;0;−;0;−;4;4;0;0;1;3;8;5;0;0;8;5;12;1;0;0;1;5;15;2;0;2;1;4
ppp;4;3;9;4;11;4;0;0;1;3;0;−;3;2;8;1;4;2;6;2;5;4;0;−;2;2;0;−;15;8;9;2;3;6;6;2;8;1;0;−;6;1;0;−;0;4;11;1;2;4;0;0;2;2;5;2;1;4;0;0;3;1;5;0;5;1;8;2;7;7;0;0;7;1;0;−;6;1;10;8;5;3;13;2;3;7;0;0;1;0;0;−;2;8;10;2;0;−;1;6;0;1;0;−;2;2;0;−;5;1;10;2;0;0;2;4;8;0;0;−;1;0;11;2;3;2;0;1
ppy;8;14;11;29;8;18;1;0;0;3;0;−;0;6;4;7;2;5;4;3;2;6;0;−;0;5;3;2;9;12;7;8;0;12;7;3;4;19;0;−;3;5;0;0;3;1;8;2;1;4;0;−;4;2;4;2;0;2;0;0;3;7;6;9;9;14;7;5;5;5;0;0;2;6;0;0;1;2;3;18;3;4;8;5;2;10;0;−;2;4;0;0;7;10;4;5;0;0;1;27;0;1;0;1;0;7;0;1;1;4;3;7;0;2;9;24;1;8;0;−;0;7;5;12;0;6;0;−
ptr;6;13;9;23;8;17;0;1;1;4;0;−;0;5;2;7;0;5;3;5;1;3;0;2;0;4;0;2;9;13;6;10;3;16;8;1;7;13;0;−;4;5;0;0;3;1;4;6;0;5;0;0;2;2;5;1;0;3;0;0;2;6;5;5;6;11;7;9;6;6;0;0;1;8;0;0;0;4;5;25;2;4;6;6;2;13;0;−;0;9;0;0;4;9;6;4;0;1;2;28;0;3;0;4;0;8;1;2;0;3;6;5;0;1;9;23;3;4;0;0;2;8;5;10;0;6;0;−
rno;0;0;8;6;10;8;0;−;1;3;0;−;0;3;2;6;0;5;5;6;2;5;0;0;0;2;0;−;7;5;5;6;1;4;9;0;4;5;0;−;4;1;0;−;2;0;10;22;1;3;0;−;0;2;3;2;0;0;0;−;2;2;0;0;5;4;12;2;5;2;1;0;3;5;0;1;0;3;5;30;6;2;7;3;1;3;0;−;1;1;0;−;2;4;3;4;0;−;0;1;0;−;0;−;0;3;0;−;0;2;2;8;0;0;26;13;1;6;0;−;0;2;4;3;0;−;0;0
san;5;2;8;3;6;6;0;−;0;4;0;−;0;4;2;5;0;5;4;3;2;3;0;−;0;4;0;−;7;7;7;7;2;2;6;0;4;2;0;−;2;3;0;−;1;0;7;0;0;4;0;−;1;1;4;4;0;1;0;0;3;9;4;1;1;8;9;9;9;4;0;−;1;6;0;−;1;1;2;7;5;6;11;10;1;0;0;−;0;4;0;−;3;3;5;1;0;−;0;8;0;0;0;−;0;2;0;−;0;3;4;3;0;1;13;11;1;4;0;−;0;3;5;4;0;3;0;−
sbi;3;7;9;6;15;6;0;0;4;7;0;1;3;2;3;8;2;5;7;5;7;2;0;−;1;3;0;−;9;29;14;2;3;7;8;6;5;7;0;1;6;4;0;1;4;3;9;4;3;0;0;−;4;2;11;3;3;5;0;−;7;3;11;3;8;4;20;3;17;8;0;1;8;4;4;6;9;1;14;12;7;2;18;5;4;1;0;−;2;1;0;2;8;2;9;6;0;0;0;13;0;1;0;0;7;5;0;2;4;5;8;2;0;0;6;6;10;2;0;−;0;3;16;4;4;4;0;−
sbq;4;13;5;6;3;6;0;−;1;5;0;−;0;4;2;6;0;5;3;3;1;3;0;−;0;5;0;0;8;6;6;4;0;7;5;3;3;7;0;−;2;2;0;−;3;0;5;3;0;3;0;−;1;1;4;1;0;3;0;−;2;2;4;2;4;16;6;4;3;6;0;0;1;6;0;−;1;3;3;11;2;3;7;4;0;3;0;−;1;3;0;0;2;5;2;3;0;0;0;14;0;−;0;1;1;4;0;0;0;2;6;2;0;2;10;10;1;6;0;0;0;8;5;4;0;6;0;−
shr;8;5;12;0;9;22;0;−;4;2;0;−;0;1;4;4;0;4;6;1;1;2;0;−;0;3;0;−;14;7;10;0;16;28;8;0;7;2;0;−;5;0;0;−;2;0;8;1;2;2;0;−;0;2;0;3;0;3;0;−;5;3;6;2;10;4;12;6;8;1;0;−;3;3;0;−;2;1;10;7;6;2;16;2;3;2;0;−;1;2;0;−;6;3;7;0;0;1;1;9;0;−;0;−;0;4;0;−;0;2;7;2;0;1;2;5;3;4;0;−;0;5;6;6;0;2;0;−
spu;37;19;30;8;30;11;0;−;11;9;0;−;4;4;14;12;9;8;14;2;7;11;&17;&8;6;15;0;1;*43;29;*57;11;10;6;17;8;10;10;0;−;15;5;0;−;4;4;14;4;9;9;0;−;0;0;20;8;2;5;0;−;2;2;5;12;18;7;*62;19;19;9;0;−;10;6;0;−;4;2;21;10;19;13;26;15;1;2;0;−;5;5;0;−;0;−;17;2;0;0;7;16;0;−;0;−;6;8;0;−;1;4;0;−;0;−;20;10;5;12;0;−;5;8;0;−;6;11;0;1
ssc;15;22;10;7;7;8;0;1;3;4;0;−;0;3;6;6;1;5;6;3;0;3;0;−;1;3;0;−;12;10;12;0;3;5;7;2;4;7;0;−;2;1;0;−;2;0;8;0;2;2;0;−;2;0;5;1;2;2;0;−;3;1;5;2;30;*204;14;*82;5;7;1;&8;2;11;0;−;1;5;5;17;2;7;9;9;2;3;0;−;2;8;0;0;7;4;4;5;0;0;3;13;0;−;0;−;0;4;0;−;0;3;6;3;0;−;10;12;3;3;0;0;0;3;11;9;1;4;0;−
str;5;4;7;1;7;4;0;0;2;3;0;4;0;6;2;31;0;4;2;4;1;4;0;−;0;3;0;5;7;6;6;7;2;1;4;1;4;1;0;−;2;4;0;0;2;0;7;4;0;4;0;−;0;2;3;2;0;2;0;−;2;1;3;2;2;2;5;2;3;3;0;5;0;38;1;&29;1;16;4;*251;2;2;7;5;1;18;0;6;1;3;0;2;3;35;4;13;0;−;0;8;0;−;0;−;0;6;0;0;0;5;6;8;0;0;29;18;3;3;0;−;0;2;6;3;0;9;0;0
tgu;3;0;3;4;1;4;0;2;1;2;0;4;0;1;2;5;0;3;2;2;0;1;1;1;0;0;0;4;2;2;5;34;0;1;2;2;4;1;0;−;0;0;0;−;1;0;3;2;0;2;0;−;0;−;2;3;0;0;0;−;3;3;0;1;0;1;3;3;1;1;0;−;2;4;0;−;0;2;8;9;4;2;7;4;0;3;0;0;0;1;0;1;0;0;1;7;0;−;3;9;0;−;0;−;0;3;0;−;0;0;2;0;0;0;5;3;0;2;0;0;1;2;6;3;0;3;0;1
tma;5;25;5;17;7;8;0;0;1;16;0;0;0;3;1;14;1;*121;2;33;0;12;0;4;0;7;0;0;7;13;5;7;2;5;7;4;4;5;0;−;3;4;0;−;2;0;7;3;0;11;0;−;1;5;3;4;0;4;0;−;1;3;3;4;2;*111;4;10;0;18;0;0;3;36;0;0;1;4;4;15;5;*1067;5;17;2;*87;0;&8;0;25;0;−;3;12;3;7;0;1;0;14;0;−;0;0;0;5;0;−;1;2;4;9;0;&17;2;19;2;10;0;4;0;5;3;7;0;9;0;0
tng;4;10;6;10;10;10;0;−;3;8;0;−;3;9;9;16;0;9;5;5;6;4;0;0;0;4;0;−;8;11;8;9;4;4;4;7;13;4;0;−;4;9;0;0;1;3;4;8;0;6;0;0;0;1;10;3;0;5;0;−;18;18;2;12;3;12;6;12;8;4;0;−;2;8;0;−;0;3;7;12;5;10;5;8;1;4;0;−;1;2;0;−;7;8;3;6;0;−;2;10;0;−;0;3;0;8;5;&17;1;1;5;8;0;0;7;7;5;6;0;−;1;3;9;9;0;11;0;0
tru;7;12;10;12;13;6;0;−;1;5;0;−;1;6;7;10;1;11;6;12;5;4;0;−;0;5;0;−;24;11;9;2;3;6;10;8;8;5;0;1;4;4;0;−;2;3;7;2;0;6;0;0;0;3;13;2;0;3;0;−;14;6;3;7;4;8;18;5;14;6;0;0;3;4;0;−;0;5;7;4;7;4;15;2;1;2;0;−;2;6;0;−;16;12;8;10;0;−;1;13;0;−;0;0;0;7;0;−;0;4;5;5;0;0;5;9;7;9;0;−;0;6;10;12;0;9;0;0
tsy;4;5;6;8;0;6;0;0;0;3;0;−;0;3;2;6;0;5;2;6;0;3;0;−;0;3;0;−;7;4;5;2;13;*50;5;4;3;2;0;0;0;31;0;0;1;2;5;1;0;4;0;−;1;1;3;2;1;3;0;−;3;3;3;2;2;6;6;6;3;6;0;0;0;3;0;−;1;1;2;9;2;3;9;4;1;5;0;−;1;2;0;−;2;3;1;4;0;2;0;9;0;−;0;−;0;4;0;−;0;2;3;3;0;0;6;18;2;3;0;0;29;12;1;4;0;3;0;−
ttr;4;*69;7;5;3;15;0;−;1;4;0;0;0;2;2;6;0;*47;3;7;1;*52;0;−;0;4;0;−;6;10;5;5;4;11;4;4;7;7;0;−;2;2;0;−;2;1;4;2;0;6;0;0;0;11;2;4;0;3;0;−;1;4;5;0;29;*1871;5;*43;8;*386;0;&9;0;35;0;1;1;19;5;13;19;*813;6;36;*70;*1695;1;&17;0;15;0;2;3;18;1;6;0;&19;1;16;0;&7;0;0;0;5;0;−;0;3;3;8;0;&20;2;19;9;*207;1;4;0;5;4;7;0;6;0;−
vvi;5;5;7;13;5;10;0;0;2;5;0;1;1;1;4;5;3;2;7;1;4;3;0;−;3;5;0;1;6;19;9;5;3;6;5;8;3;7;0;0;8;7;0;−;1;2;9;5;3;2;0;−;0;5;1;9;4;6;0;−;4;2;5;4;5;9;11;11;12;13;0;2;16;20;0;−;3;1;9;1;7;11;11;5;3;2;0;−;1;3;0;0;6;4;8;6;0;0;0;18;0;−;0;3;5;2;0;0;2;0;4;8;0;0;5;5;9;0;0;0;2;6;11;11;4;9;0;1
xtr;*51;20;28;18;*74;22;0;0;*48;*42;0;−;15;13;*76;*74;*52;*52;*40;*58;18;8;0;−;26;24;0;4;*99;38;*45;17;20;7;24;17;30;9;0;0;36;16;0;0;19;16;*42;17;25;7;0;2;2;5;20;12;15;9;1;0;17;14;20;17;*60;23;*46;12;32;18;0;−;29;17;0;−;15;20;*50;16;*53;26;*70;14;*70;34;0;−;17;18;0;−;25;27;36;18;0;1;*59;*47;0;0;0;−;22;18;1;1;13;9;23;16;0;0;*46;*45;21;11;0;1;11;34;*40;17;6;15;0;1
zma;14;*67;31;17;36;*90;0;−;8;5;&8;4;4;1;7;12;3;5;10;3;5;5;0;−;1;3;0;−;31;*47;32;36;8;13;18;7;6;6;0;0;13;17;0;−;5;3;11;3;3;3;0;−;3;2;25;9;4;4;0;−;10;2;19;9;12;9;30;11;16;13;0;0;8;6;0;−;11;10;34;31;8;2;30;2;9;1;0;−;2;1;&11;0;13;2;11;10;0;−;3;17;0;3;0;−;6;4;&10;&11;3;2;8;4;0;−;10;14;20;6;0;0;2;2;17;7;12;7;0;0
;aaa1;aaa2;aac1;aac2;aag1;aag2;aat1;aat2;aca1;aca2;acc1;acc2;acg1;acg2;act1;act2;aga1;aga2;agc1;agc2;agg1;agg2;agt1;agt2;ata1;ata2;atc1;atc2;atg1;atg2;att1;att2;caa1;caa2;cac1;cac2;cag1;cag2;cat1;cat2;cca1;cca2;ccc1;ccc2;ccg1;ccg2;cct1;cct2;cga1;cga2;cgc1;cgc2;cgg1;cgg2;cgt1;cgt2;cta1;cta2;ctc1;ctc2;ctg1;ctg2;ctt1;ctt2;gaa1;gaa2;gac1;gac2;gag1;gag2;gat1;gat2;gca1;gca2;gcc1;gcc2;gcg1;gcg2;gct1;gct2;gga1;gga2;ggc1;ggc2;ggg1;ggg2;ggt1;ggt2;gta1;gta2;gtc1;gtc2;gtg1;gtg2;gtt1;gtt2;taa1;taa2;tac1;tac2;tag1;tag2;tat1;tat2;tca1;tca2;tcc1;tcc2;tcg1;tcg2;tct1;tct2;tga1;tga2;tgc1;tgc2;tgg1;tgg2;tgt1;tgt2;tta1;tta2;ttc1;ttc2;ttg1;ttg2;ttt1;ttt2
Som−;;1;;0;;1;;46;;0;;56;;2;;1;;0;;1;;1;;61;;1;;52;;0;;0;;0;;1;;0;;57;;0;;61;;0;;0;;0;;65;;8;;1;;3;;70;;0;;0;;0;;0;;0;;44;;1;;55;;0;;0;;0;;1;;4;;61;;0;;42;;1;;0;;41;;0;;53;;52;;0;;52;;0;;2;;16;;1;;1;;48;;0;;1;;1;;52
db, diff;589;1168;942;846;950;3320;5;108;295;674;25;62;118;491;477;724;193;978;443;632;212;823;25;55;153;473;6;68;1387;1231;850;618;360;1436;631;397;515;687;0;36;531;523;1;28;211;233;650;331;241;1697;2;32;84;285;543;377;122;364;1;10;368;417;491;445;601;5790;1070;794;697;2154;3;93;3200;3813;8;242;308;4178;822;1319;682;4453;916;647;444;6221;2;115;148;582;27;72;494;2108;594;559;5;164;307;1157;1;107;0;63;178;482;42;127;134;348;506;414;7;230;887;1387;430;1155;10;206;97;495;645;550;114;543;1;50
total;;1757;;1788;;4270;;113;;969;;87;;609;;1201;;1171;;1075;;1035;;80;;626;;74;;2618;;1468;;1796;;1028;;1202;;36;;1054;;29;;444;;981;;1938;;34;;369;;920;;486;;11;;785;;936;;6391;;1864;;2851;;96;;7013;;250;;4486;;2141;;5135;;1563;;6665;;117;;730;;99;;2602;;1153;;169;;1464;;108;;63;;660;;169;;482;;920;;237;;2274;;1585;;216;;592;;1195;;657;;51
db+dif;;1679;;1709;;4192;;80;;890;;64;;532;;1123;;1092;;997;;957;;62;;548;;47;;2539;;1389;;1717;;950;;1123;;14;;975;;11;;365;;902;;1859;;20;;298;;842;;410;;2;;706;;857;;6312;;1785;;2772;;61;;6935;;226;;4407;;2062;;5056;;1485;;6590;;99;;651;;62;;2524;;1074;;131;;1385;;82;;36;;581;;142;;403;;843;;174;;2196;;1507;;185;;513;;1117;;579;;24
Méthode d'estimation des duplications pour les codons excessifs[modifier | modifier le wikicode]
aga.1;double;aga;;aga.2;double;aga;;aga.3;double;aga
lma;0;0;;lma;0;0;;mmu;0;0
pfa;0;0;;pfa;0;0;;gmx;0;0
aga;0;1;;aga;0;1;;pfa;0;1
acs;0;2;;acs;0;2;;lma;0;2
dme;0;2;;dme;0;2;;tgu;0;2
dya;0;2;;dya;0;2;;cpo;0;2
gfr;0;2;;gfr;0;2;;opr;0;2
mgp;0;2;;mgp;0;2;;pha;0;2
dsi;0;3;;vvi;3;2;;lav;3;2
gga;0;3;;ppp;4;2;;ath;4;2
mun;0;3;;cel;5;2;;ppp;5;2
oga;0;3;;cbr;7;2;;mgp;7;2
tgu;0;3;;cjap;9;2;;cjap;9;2
cge;0;4;;cbre;10;2;;vvi;10;2
cpo;0;4;;dsi;0;3;;cge;0;3
ecb;0;4;;gga;0;3;;shr;0;3
eeu;0;4;;mun;0;3;;meu;0;3
ggo;0;4;;oga;0;3;;zma;0;3
mmr;0;4;;tgu;0;3;;gac;0;3
opr;0;4;;mlu;1;3;;ptr;1;3
shr;0;4;;cge;0;4;;cbr;0;4
str;0;4;;cpo;0;4;;mun;0;4
cjc;0;5;;ecb;0;4;;ecb;0;4
csi;0;5;;eeu;0;4;;eeu;0;4
hgl;0;5;;ggo;0;4;;str;0;4
hsa-18;0;5;;mmr;0;4;;rno;0;4
mcc;0;5;;opr;0;4;;osa;0;4
mdo;0;5;;shr;0;4;;aml;0;4
mmu;0;5;;str;0;4;;cpic;0;4
oaa;0;5;;cjc;0;5;;cbre;0;5
ocu;0;5;;csi;0;5;;oga;0;5
pan;0;5;;hgl;0;5;;hgl;0;5
pha;0;5;;hsa-18;0;5;;hsa-18;0;5
ptr;0;5;;mcc;0;5;;oaa;0;5
rno;0;5;;mdo;0;5;;ocu;0;5
san;0;5;;mmu;0;5;;san;0;5
sbq;0;5;;oaa;0;5;;mtr;0;5
tsy;0;5;;ocu;0;5;;sbi;0;5
nle;0;6;;pan;0;5;;bdi;0;5
cfa;0;8;;pha;0;5;;cfa;0;5
dno;0;8;;ptr;0;5;;tng;0;5
lcm;0;8;;rno;0;5;;pma;0;5
tng;0;9;;san;0;5;;tru;0;5
cmk;0;13;;sbq;0;5;;mpu;0;5
aml;0;16;;tsy;0;5;;fca;0;5
oas;0;21;;meu;1;5;;pan;1;5
bta;0;43−11,6;;ssc;1;5;;oas;1;5
ttr;0;47−11,6;;mtr;2;5;;tsy;2;5
fca;0;53−11,6;;ppy;2;5;;spu;2;5
bacu;0;54−11,6;;sbi;2;5;;cmk;2;5
lav;0;89−11,6;;zma;3;5;;bta;3;5
mlu;1;3;;pop;5;5;;lcm;5;5
meu;1;5;;osa;6;5;;nle;6;5
ssc;1;5;;nle;0;6;;ssc;0;6
ath;1;8;;bdi;2;6;;dya;2;6
tru;1;11;;gmx;10;7;;csi;10;7
mpu;1;14;;cfa;0;8;;cel;0;8
cpic;1;24;;dno;0;8;;mlu;0;8
oni;1;25;;lcm;0;8;;mdo;0;8
tma;1;121−15,6;;ath;1;8;;acs;1;8
mtr;2;5;;spu;9;8;;gmo;9;8
ppy;2;5;;tng;0;9;;ttr;0;9
sbi;2;5;;pma;8;9;;dno;8;9
bdi;2;6;;tru;1;11;;xtr;1;11
gmo;2;18;;cmk;0;13;;dsi;0;13
vvi;3;2;;mpu;1;14;;sbq;1;14
zma;3;5;;aml;0;16;;aga;0;16
ppp;4;2;;gmo;2;18;;cjc;2;18
cel;5;2;;oas;0;21;;ppy;0;21
pop;5;5;;cpic;1;24;;gga;1;24
osa;6;5;;gac;43−1,1;24;;mmr;43;24
cbr;7;2;;oni;1;25;;pop;1;25
pma;8;9;;tma;1;121−15,6;;gfr;0;43
cjap;9;2;;bta;0;43−11,6;;bacu;0;47
spu;9;8;;ttr;0;47−11,6;;tma;52;52
cbre;10;2;;xtr;52−1!9;52−23!5;;ggo;0;53
gmx;10;7;;fca;0;53−11,6;;dme;0;54
gac;43−1,1;24;;bacu;0;54−11,6;;mcc;0;89
xtr;52−1!9;52−23!5;;lav;0;89−11,6;;oni;1;121
max;10;25;;;;;;;;
Estimations des effectifs de base. Codons a,c.[modifier | modifier le wikicode]
  • Lien aux tableaux: Estimations des effectifs de base. Codons a,c.
  • Méthode
  • Légende: copier au tableur avec le séparateur : (2 points)
  • Les couleurs: pour travailler sans les couleurs supprimer dans le tableur, avec ctrl+h, les caractères spéciaux * $ § ? &_emsp;
:*double:*aaa:moyn:estim::*double:*aca:moyn:estim::*double:*aga:moyn:estim::*double:*ata:moyn:estim
x/R2:*1.05:*45:::x/R2:*0.96:*35::−:x/R2:*0.86:*11::−:x/R2:*1.48:*37::−
max:*37:*45:::max:*19:*23::−:max:*10:*25::−:max:*13:*24::−
aml:5:$49:22,13:17:cmk:$49−13:$156−8:−:13−8:bacu:0:$54:11,6:8:gac:§46:14:5,6:5
bacu:4:$81:12,11:11:xtr:§48−13:§42−8:−:13−8:bta:0:§43:11,6:8:xtr:§26:24:6,5:5
bta:10:$67:4,4:4: :::::fca:0:$53:11,6:8: ::::
gmo:17:§45:10,9:9: :::::gac:§43:$24:1:1: ::::
ttr:4:$69:12,11:11: :::::lav:0:$89:11,6:8: ::::
xtr:$51:20:16:16: :::::tma:1:$121:15,6:10: ::::
zma:14:$67:19,13:16: :::::ttr:0:§47:11,6:8: ::::
 ::::: :::::xtr:$52−9:$52−5:−:9−5: ::::
:*double:*aac:moyn:estim::*double:*acc:−:estim::*double:*agc:moyn:estim::*double:*atc:−:estim
x/R2:*0.98:*42:::x/R2:*−:*−::−:x/R2:*0.78:*40::−:x/R2:*−:*−::−
max:*31:*40:::max:*5:*4::−:max:*16:*33::−:max:*3:*5::−
gac:$82:40:12:12:cmk:0:?11::4:lav:7:$68:7,5:6:oga:0:?8::5
pma:$100−29:$67−12:−:29−12:pma:?8:?10::5−4:pma:§34:30:7:7: ::::
 :::::zma:?8:4::5:xtr:§40−14:$58−8:−:14−8: ::::
:*double:*aag:moyn:estim::*double:*acg:moyn:estim::*double:*agg:moyn:estim::*double:*atg:moyn:estim
x/R2:*0.52:*36:::x/R2:*0.89:*35::−:x/R2:*0.78:*16::−:x/R2:*1.12:*62::−
max:*45:*29:::max:*15:*22::−:max:*25:*45::−:max:*43:*111::−
aml:12:$759:3,10:6:cmk:4:$132:3,3:3:bacu:0:$66:8,6:7:gac:$99:38:27:27
cfa:10:$397:13,10:11: :::::bta:2:$113:6,6:6:pma:$221:§64:27:27
cge:11:$74:8,9:8: :::::fca:1:$51:22,6:14:xtr:$187:§90:23:23
eeu:28:$120:11,9:10: :::::ttr:1:$52:22,6:14: ::::
fca:8:$878:19,11:15: ::::: ::::: ::::
gac:$74:22:11,12:11: ::::: ::::: ::::
mpu:5:$265:12,9:10: ::::: ::::: ::::
xtr:$74:22:11,12:11: ::::: ::::: ::::
zma:36:$90:6:6: ::::: ::::: ::::
:*double:*aat:−:estim::*double:*act:moyn:estim::*double:*agt:−:estim::*double:*att:moyn:estim
x/R2:*−:*−:::x/R2:*0.77:*37::−:x/R2:*−:*−::−:x/R2:*0.57:*39::−
max:*4:*5:::max:*29:*32::−:max:*1:*4::−:max:*32:*36::−
mtr:4:?43::5:gac:$49−23:$49−11:−:23−11:oaa:?7:?10::1−4:pma:§47−25:$62−11:−:25−11
 :::::xtr:$76−23:$74−11:−:23−11:spu:?17:?8::1−4:xtr:§45:17:10:10
 ::::: ::::: :::::spu:$57:11:9,9:9
 ::::: ::::: :::::gac:$84:16:10,10:10
:::::::::::::::::::
:*double:*caa:moyn:estim::*double:*cca:moyn:estim::*double:*cga:moyn:estim::*double:*cta:moyn:estim
x/R2:*0.72:*21::−:x/R2:*0.35:*26::−:x/R2:*0.58:*17::−:x/R2:*0.68:*21::−
max:*29:*41::−:max:*48:*43::−:max:*25:*27::−:max:*26:*32::−
fca:5:$776:6,7:6:fca:4:$63:4,4:4:aml:2:$81:5,5:5:rien::::
gac:§47:12:4,4:4: :::::fca:7:$1193:5,4:4: ::::
tsy:13:$50:11,7:9: :::::gac:$65:13:1,2:1: ::::
:*double:*cac:moyn:estim::*double:*ccc:−:estim::*double:*cgc:−:estim::*double:*ctc:−:estim
x/R2:*0.47:*52::−:x/R2:*−:*−::−:x/R2:*−:*−::−:x/R2:*−:*−::−
max:*33:*26::−:max:*0:*5::−:max:*2:*2::−:max:*1:*1::−
rien:::::rien:::::bta:0:?6::2:rien::::
 ::::: :::::fca:0:?8::2: ::::
:*double:*cag:moyn:estim::*double:*ccg:moyn:estim::*double:*cgg:moyn:estim::*double:*ctg:moyn:estim
x/R2:*0.92:*38::−:x/R2:*0.6:*69::−:x/R2:*1.1:*23::−:x/R2:*0.66:*51::−
max:*30:*47::−:max:*19:*16::−:max:*13:*23::−:max:*18:*19::−
gac:$61:19:4,7:5:cmk:0:§40:2,1:1:rien:::::gmo:13:§33:7:7
pma:$60:§47:9:9: ::::: :::::pma:§37−15:§37−11:−:15−11
:*double:*cat:−:estim::*double:*cct:moyn:estim::*double:*cgt:moyn:estim::*double:*ctt:moyn:estim
x/R2:*−:*−::−:x/R2:*0.45:*48::−:x/R2:*0.35:*45::−:x/R2:*0.52:*40::−
max:*0:*4::−:max:*36:*29::−:max:*37:*29::−:max:*31:*35::−
rien:::::gac:$58:4:13,8:10:pma:$55:29:22,16:19:pma:$56−26:$55−6:−:26−6
 :::::xtr:§42:17:17:17: ::::: ::::
Estimations des effectifs de base. Codons g,t.[modifier | modifier le wikicode]
:*double:*gaa:moyn:estim::*double:*gca:moyn:estim::*double:*gga:moyn:estim::*double:*gta:moyn:estim
x/R2:*0.72:*41::−:x/R2:*0.72:*17::−:x/R2:*0.44:*27::−:x/R2:*1.71:*40::−
max:*47:*38::−:max:*36:*46::−:max:*36:*45::−:max:*29:*38::−
bacu:11:$423:5,9:7:cmk:$2889−25:$3008−15:−:25−15:bacu:25:$961:11:11:cmk:29:$115:20:20
cbre:29:$1871:10:10:dno:2:$63:7,8:7:bta:6:$384:4,3:3: ::::
cel:$60:23:10,8:9: :::::cbre:$61:4:5,6:5: ::::
cjap:7:$106:5,7:6: :::::cmk:22:§43:11:11: ::::
gac:3:$135:10,7:8: :::::gac:§40:20:12:12: ::::
spu:2:$111:7,7:7: :::::lav:3:$615:3,4:3: ::::
ssc:§47:$2320:10:10: :::::oas:1:$131:2,4:3: ::::
ttr:30:$204:10:10: :::::tma:5:$1067:4,3:3: ::::
xtr:7:$58:5,7:6: :::::ttr:19:$813:11:11: ::::
 ::::: :::::xtr:$53:26:12:12: ::::
:*double:*gac:moyn:estim::*double:*gcc:−:estim::*double:*ggc:moyn:estim::*double:*gtc:−:estim
x/R2:*0.43:*30::−:x/R2:*−:*−::−:x/R2:*0.44:*39::−:x/R2:*−:*−::−
max:*46:*48::−:max:*4:*6::−:max:*30:*36::−:max:*2:*3::−
gac:$135:§48:9:9:cmk:3:?164::6:bacu:13:$50:1,2:1:cmk:0:?15::3
pma:$56:33:8:8:str:1:?29::6:bta:8:$54:3,4:3:osa:?13:3::2
spu:$62:19:10:10: :::::xtr:$70:14:18:18:zma:?11:0::2
ssc:14:$82:16,15:15: ::::: ::::: ::::
:*double:*gag:moyn:estim::*double:*gcg:moyn:estim::*double:*ggg:moyn:estim::*double:*gtg:moyn:estim
x/R2:*0.56:*28::−:x/R2:*0.8:*25::−:x/R2:*0.91:*34::−:x/R2:*0.89:*47::−
max:*34:*47::−:max:*18:*20::−:max:*29:*34::−:max:*37:*35::−
bacu:21:$446:17:17:cmk:$100−13:$3757−9:−:13−9:bacu:$103−8:$2044−4::8−4:cmk:37:$1502:12:12
bta:3:$160:22,8:15:gac:§41:14:1:1:bta:29:$1265:4,3:3:dno:5:$75:3,4:3
cmk:22:$405:17:17: :::::cmk:7:$73:1,2:1:pma:§46:24:9,8:8
csi:4:$72:4,8:6: :::::dno:4:$321:7,4:5: ::::
oas:3:$56:22,8:15: :::::lav:2:$69:6,4:5: ::::
ttr:8:$386:4,6:5: :::::oas:2:$338:6,4:5: ::::
 ::::: :::::tma:2:$87:6,4:5: ::::
 ::::: :::::ttr:$70−8:$1695−4:−:8−4: ::::
 ::::: :::::xtr:$70:34:4:4: ::::
:*double:*gat:−:estim::*double:*gct:moyn:estim::*double:*ggt:−:estim::*double:*gtt:moyn:estim
x/R2:*−:*−::−:x/R2:*0.72:*35::−:x/R2:*−:*−::−:x/R2:*0.48:*36::−
max:*1:*5::−:max:*34:*44::−:max:*1:*8::−:max:*36:*33::−
bacu:1:?18::5:cmk:19:$55:4,4:4:bacu:1:?10::8:pma:$96−27 :$69−7 :−:27−7
ssc:1:?8::5:oaa:32:$50:21:21:bta:0:?19::8: ::::
ttr:0:?9::5:pma:$62:§43:18,16:17:dno:0:?23::8: ::::
 :::::str:4:$251:15,13:14:ttr:1:?17::8: ::::
 :::::xtr:$50:16:3,6:4: ::::: ::::
:::::::::::::::::::
:::::::::::::::::::
:::::::::::::::::::
:*double:*taa:−:estim::*double:*tca:moyn:estim::*double:*tga:−:estim::*double:*tta:moyn:estim
x/R2:*−:*−::−:x/R2:*0.92:*38::−:x/R2:*−:*−::−:x/R2:*0.91:*22::−
max:*2:*3::−:max:*22:*18::−:max:*3:*4::−:max:*29:*34::−
bacu:0:?23::3:cmk:3:$50:6,5:5:bacu:0:?16::4:rien::::
fca:1:?35::3:gac:§43:18:7:7:bta:0:?28::4: ::::
mtr:2:?29::3: :::::fca:0:?17::4: ::::
ttr:0:?19::3: :::::lav:0:?23::4: ::::
 ::::: :::::tma:0:?17::4: ::::
 ::::: :::::ttr:0:?20::4: ::::
:*double:*tac:moyn:estim::*double:*tcc:−:estim::*double:*tgc:moyn:estim::*double:*ttc:moyn:estim
x/R2:*1.25:*14::−:x/R2:*−:*−::−:x/R2:*0.86:*59::−:x/R2:*0.57:*55::−
max:*22:*47::−:max:*5:*3::−:max:*38:*34::−:max:*40:*24::−
ath:$50:32:3,3:3:bta:4:?27::3:bta:25:$312:14:14:rien::::
pma:§40−3:$49−35:−:3−35:gmo:?14:?26::5−3:gac:$72:34:21:21: ::::
xtr:$59:§47:3,3:3:tng:5:?17::3:oas:5:$55:14,10:12: ::::
 :::::zma:?10:?11::5−3:xtr:§46−32:§45−22:−:32−22: ::::
:*double:*tag:−:estim::*double:*tcg:moyn:estim::*double:*tgg:moyn:estim::*double:*ttg:moyn:estim
x/R2:*−:*−::−:x/R2:*0.53:*32::−:x/R2:*0.56:*20::−:x/R2:*1.06:*27::−
max:*1:*4::−:max:*23:*16::−:max:*21:*44::−:max:*18:*29::−
aml:0:?9::4:cmk:0:§47:3,3:3:bacu:13:$242:3,3:3:rien::::
bacu:0:?8::4: :::::bta:5:$172:5,5:5: ::::
bta:0:?12::4: :::::gac:§47:26:6:6: ::::
fca:0:?11::4: :::::ttr:9:$207:5,6:5: ::::
:*double:*tat:−:estim::*double:*tct:moyn:estim::*double:*tgt::estim::*double:*ttt:−:estim
x/R2:*−:*−::−:x/R2:*0.51:*53::−:x/R2:*−:*−::−:x/R2:*−:*−::−
max:*0:*4::−:max:*38:*21::−:max:*1:*4:−:−:max:*1:*5::−
bta:0:?10::4:rien:::::bta:?9:?133::1−4:rien::::
 ::::: :::::oas:0:?15::4: ::::
E79 codons. Les duplications excessives remplacées par les estimations du processus de base[modifier | modifier le wikicode]
;aaa1;aaa2;aac1;aac2;aag1;aag2;aat1;aat2;;aca1;aca2;acc1;acc2;acg1;acg2;act1;act2;;aga1;aga2;agc1;agc2;agg1;agg2;agt1;agt2;;ata1;ata2;atc1;atc2;atg1;atg2;att1;att2;;caa1;caa2;cac1;cac2;cag1;cag2;cat1;cat2;;cca1;cca2;ccc1;ccc2;ccg1;ccg2;cct1;cct2;;cga1;cga2;cgc1;cgc2;cgg1;cgg2;cgt1;cgt2;;cta1;cta2;ctc1;ctc2;ctg1;ctg2;ctt1;ctt2;;gaa1;gaa2;gac1;gac2;gag1;gag2;gat1;gat2;;gca1;gca2;gcc1;gcc2;gcg1;gcg2;gct1;gct2;;gga1;gga2;ggc1;ggc2;ggg1;ggg2;ggt1;ggt2;;gta1;gta2;gtc1;gtc2;gtg1;gtg2;gtt1;gtt2;;taa1;taa2;tac1;tac2;tag1;tag2;tat1;tat2;;tca1;tca2;tcc1;tcc2;tcg1;tcg2;tct1;tct2;;tga1;tga2;tgc1;tgc2;tgg1;tgg2;tgt1;tgt2;;tta1;tta2;ttc1;ttc2;ttg1;ttg2;ttt1;ttt2
'''acs;2;2;6;3;3;2;0;−;'''acs;1;1;0;−;0;0;1;2;'''acs;0;2;2;2;0;2;0;−;'''acs;0;0;0;−;4;7;4;1;'''acs;0;2;3;1;2;2;0;−;'''acs;2;0;0;0;1;0;2;0;'''acs;0;2;0;−;0;0;2;1;'''acs;0;2;0;−;2;1;2;1;'''acs;4;6;6;1;1;3;0;−;'''acs;0;5;0;−;0;2;6;5;'''acs;5;2;5;1;1;0;0;−;'''acs;0;1;0;−;2;0;2;2;'''acs;0;−;0;5;0;−;0;−;'''acs;0;0;0;−;0;1;4;0;'''acs;0;0;8;3;3;3;0;−;'''acs;0;1;4;0;1;0;0;−
'''aga;3;4;10;1;15;1;0;−;'''aga;1;0;0;−;3;2;7;0;'''aga;0;1;4;1;0;1;0;−;'''aga;0;1;0;−;13;4;10;1;'''aga;2;1;16;4;5;5;0;−;'''aga;6;1;0;−;7;5;2;4;'''aga;4;3;0;−;0;−;9;0;'''aga;1;1;0;−;8;1;3;1;'''aga;12;9;18;1;12;2;0;−;'''aga;1;1;0;−;4;1;13;3;'''aga;7;0;14;0;0;−;0;−;'''aga;2;0;0;−;21;7;24;6;'''aga;0;0;1;20;0;−;0;−;'''aga;1;0;0;−;7;0;4;1;'''aga;0;−;4;0;5;0;0;−;'''aga;1;4;8;0;0;3;0;−
'''aml;5;*17;10;17;12;*6;0;5;'''aml;1;7;0;−;0;9;4;5;'''aml;0;16;3;9;1;43;0;1;'''aml;0;5;0;−;11;12;7;4;'''aml;1;41;7;0;4;20;0;−;'''aml;3;7;0;−;3;1;7;1;'''aml;2;*5;0;0;2;4;5;2;'''aml;0;4;0;−;2;4;2;4;'''aml;3;5;5;5;3;33;0;0;'''aml;2;6;0;−;1;3;3;13;'''aml;3;3;8;1;2;4;0;−;'''aml;0;6;0;−;7;1;8;1;'''aml;0;0;1;9;0;$4;0;−;'''aml;0;5;0;−;0;3;6;3;'''aml;0;1;13;11;3;6;0;−;'''aml;1;3;8;2;2;6;0;−
'''ath;10;5;10;8;14;4;0;−;'''ath;4;4;0;0;2;3;7;2;'''ath;1;8;7;8;4;3;0;−;'''ath;3;1;1;0;16;15;15;1;'''ath;6;3;6;5;4;4;0;−;'''ath;41;5;0;−;2;2;11;4;'''ath;4;1;0;−;1;2;4;6;'''ath;6;4;0;0;2;0;9;2;'''ath;27;8;21;7;9;3;0;−;'''ath;7;2;0;−;4;2;13;2;'''ath;11;1;16;8;4;0;0;−;'''ath;4;2;1;0;6;1;12;2;'''ath;0;0;*3;32;0;−;0;−;'''ath;6;5;1;1;3;3;26;10;'''ath;0;−;4;13;11;4;0;−;'''ath;3;2;16;4;6;5;0;−
'''bacu;4;*11;17;6;5;23;0;−;'''bacu;1;6;0;−;0;3;4;8;'''bacu;0;*8;3;9;0;*7;0;−;'''bacu;0;7;0;0;8;12;6;5;'''bacu;2;7;7;3;4;15;0;−;'''bacu;2;2;0;−;2;1;5;1;'''bacu;1;7;0;−;1;19;3;5;'''bacu;0;3;0;−;3;3;4;1;'''bacu;11;*7;7;37;21;*17;1;$5;'''bacu;0;41;0;−;1;18;2;17;'''bacu;25;*11;13;*1;*8;*4;1;$8;'''bacu;0;17;0;0;8;23;5;8;'''bacu;0;$3;0;13;0;$4;0;−;'''bacu;0;4;0;0;0;3;3;6;'''bacu;0;$4;5;18;13;*3;0;1;'''bacu;1;11;4;8;0;7;0;−
'''bdi;3;8;10;5;16;1;0;−;'''bdi;2;7;2;0;2;3;2;6;'''bdi;2;6;12;5;4;5;0;−;'''bdi;1;2;0;1;25;30;13;6;'''bdi;7;7;14;6;8;2;0;2;'''bdi;8;9;0;−;5;2;11;3;'''bdi;4;0;0;0;2;3;12;3;'''bdi;6;3;0;−;7;0;7;6;'''bdi;4;10;21;4;16;2;0;−;'''bdi;7;5;0;−;9;1;16;2;'''bdi;6;2;19;8;8;0;0;−;'''bdi;2;2;2;1;8;2;11;4;'''bdi;0;−;3;13;0;−;0;0;'''bdi;5;4;1;2;4;0;8;2;'''bdi;0;−;6;8;12;5;0;−;'''bdi;2;1;13;4;9;6;0;−
'''bta;10;*5;16;13;15;24;0;−;'''bta;2;7;0;0;0;6;4;9;'''bta;0;§8;8;10;2;*6;0;3;'''bta;0;7;0;−;16;18;14;3;'''bta;2;17;14;4;8;31;0;3;'''bta;6;2;0;−;3;0;11;1;'''bta;1;10;0;$2;3;12;7;5;'''bta;0;4;0;−;3;2;6;4;'''bta;5;14;9;32;3;*15;0;5;'''bta;4;30;0;1;2;13;12;18;'''bta;6;*3;8;*3;29;*3;0;$8;'''bta;2;18;0;−;12;26;7;12;'''bta;0;3;1;37;0;$4;0;$4;'''bta;0;6;4;$3;0;6;8;4;'''bta;0;$4;25;14;5;*5;$1;$4;'''bta;0;9;12;17;0;13;0;5
'''cbr;11;4;20;2;36;3;0;−;'''cbr;6;3;0;−;5;3;20;1;'''cbr;7;2;6;2;1;0;0;−;'''cbr;8;15;0;−;18;4;17;3;'''cbr;19;4;18;2;6;3;0;−;'''cbr;30;10;0;−;2;1;2;3;'''cbr;4;5;0;−;0;−;17;4;'''cbr;3;1;0;−;2;4;21;4;'''cbr;12;38;27;6;21;8;0;−;'''cbr;13;0;0;−;2;4;22;6;'''cbr;33;8;16;4;0;4;0;−;'''cbr;2;3;0;−;3;2;18;6;'''cbr;0;−;13;5;0;−;0;−;'''cbr;3;4;0;−;4;3;14;2;'''cbr;0;−;14;1;12;0;0;−;'''cbr;2;3;16;5;1;9;0;−
'''cbre;20;8;28;4;45;3;0;−;'''cbre;12;2;0;0;6;3;26;4;'''cbre;10;2;9;4;4;6;0;−;'''cbre;13;12;0;0;24;4;31;1;'''cbre;29;10;21;4;6;4;0;0;'''cbre;48;5;1;0;4;4;13;11;'''cbre;11;5;0;−;13;10;28;3;'''cbre;6;1;0;−;3;4;29;2;'''cbre;29;*10;31;2;34;2;0;−;'''cbre;7;3;0;−;2;3;33;1;'''cbre;*5;4;25;13;11;13;0;−;'''cbre;3;4;0;−;7;7;30;2;'''cbre;0;−;20;7;0;−;0;1;'''cbre;7;6;0;−;3;5;16;3;'''cbre;1;1;16;4;19;2;0;1;'''cbre;4;2;18;5;2;11;0;−
'''cel;13;0;17;2;24;5;0;−;'''cel;9;1;0;−;2;4;14;2;'''cel;5;2;6;2;1;2;0;0;'''cel;3;3;0;−;16;2;19;1;'''cel;15;4;13;5;4;2;0;−;'''cel;23;7;0;−;3;0;2;3;'''cel;4;3;0;−;0;0;14;3;'''cel;2;0;0;−;3;1;14;5;'''cel;*9;23;20;6;19;4;0;−;'''cel;7;1;0;−;0;3;16;5;'''cel;28;5;10;3;2;0;0;−;'''cel;1;3;0;−;4;1;15;3;'''cel;0;−;7;11;0;−;0;−;'''cel;2;6;0;−;3;2;11;3;'''cel;0;1;11;1;9;2;0;−;'''cel;1;2;10;4;0;6;0;−
'''cfa;6;27;8;12;10;*11;0;0;'''cfa;1;2;0;−;0;4;2;5;'''cfa;0;8;2;5;1;27;0;−;'''cfa;0;4;0;−;6;16;4;4;'''cfa;1;41;7;1;4;15;0;−;'''cfa;1;6;0;−;2;1;7;0;'''cfa;0;14;0;−;1;2;1;4;'''cfa;0;3;0;−;4;2;3;0;'''cfa;7;5;9;3;6;15;0;1;'''cfa;3;7;0;−;0;3;3;10;'''cfa;7;3;8;2;2;6;0;−;'''cfa;0;4;0;−;5;2;2;3;'''cfa;0;2;0;8;0;2;0;−;'''cfa;0;4;0;−;1;6;5;4;'''cfa;0;0;9;11;0;5;0;−;'''cfa;0;3;4;5;0;4;0;−
'''cge;5;9;8;8;11;*8;0;−;'''cge;1;2;0;0;0;3;1;6;'''cge;0;4;3;5;1;4;0;−;'''cge;0;4;0;−;7;8;10;2;'''cge;1;3;11;2;5;5;0;−;'''cge;4;1;0;−;2;0;6;0;'''cge;2;3;0;−;0;2;3;2;'''cge;0;3;0;−;5;4;3;1;'''cge;1;3;10;4;6;13;0;−;'''cge;1;13;0;0;1;4;5;16;'''cge;5;0;9;4;2;4;0;0;'''cge;1;3;0;−;3;5;4;8;'''cge;0;−;0;10;0;−;0;−;'''cge;0;2;0;−;0;2;5;0;'''cge;0;1;24;16;2;3;0;−;'''cge;0;3;4;3;0;3;0;−
'''cjap;23;6;20;2;30;6;0;−;'''cjap;7;4;0;−;8;2;17;6;'''cjap;9;2;12;2;2;0;0;−;'''cjap;2;4;0;−;25;4;20;5;'''cjap;11;2;12;4;11;4;0;−;'''cjap;33;9;0;−;7;0;7;1;'''cjap;6;4;0;−;0;0;17;3;'''cjap;2;3;0;−;5;6;22;3;'''cjap;7;*6;32;8;31;8;0;−;'''cjap;6;4;0;−;7;0;23;7;'''cjap;36;10;24;9;0;1;0;−;'''cjap;2;4;0;−;8;4;19;3;'''cjap;0;−;22;1;0;−;0;−;'''cjap;4;2;0;−;10;4;14;4;'''cjap;0;0;12;2;14;3;0;−;'''cjap;0;4;19;4;0;6;0;0
'''cjc;5;10;9;17;4;11;0;−;'''cjc;0;6;0;0;0;3;1;8;'''cjc;0;5;3;4;1;3;0;−;'''cjc;0;4;0;2;7;12;5;7;'''cjc;0;6;5;3;5;7;0;0;'''cjc;3;2;0;−;3;0;6;0;'''cjc;0;3;2;0;1;2;4;1;'''cjc;0;3;0;−;3;8;4;3;'''cjc;10;4;8;5;6;8;0;0;'''cjc;1;4;0;1;1;2;2;12;'''cjc;6;2;9;5;1;3;0;−;'''cjc;1;4;0;2;4;6;3;3;'''cjc;0;0;10;24;0;2;0;0;'''cjc;1;3;0;−;0;3;5;3;'''cjc;0;1;9;22;1;9;0;−;'''cjc;0;10;4;3;0;6;0;−
'''cmk;5;37;16;31;11;24;0;1;'''cmk;*13;*8;0;$4;4;*3;7;16;'''cmk;0;13;10;22;5;6;0;−;'''cmk;4;18;0;−;20;§73;8;22;'''cmk;1;5;10;26;8;9;0;0;'''cmk;7;43;0;5;0;§1;1;10;'''cmk;3;21;0;−;0;1;4;4;'''cmk;2;17;0;1;5;19;6;13;'''cmk;5;9;14;34;22;*17;0;5;'''cmk;*25;*15;3;$6;*13;*9;19;*4;'''cmk;22;§11;12;6;7;*1;0;1;'''cmk;29;*20;0;$3;37;*12;6;15;'''cmk;0;0;7;28;0;3;0;0;'''cmk;3;*5;0;0;0;§3;12;13;'''cmk;0;2;5;9;10;19;0;0;'''cmk;1;11;10;24;1;29;0;2
'''cpic;4;31;5;11;2;6;0;0;'''cpic;1;16;0;−;0;4;1;15;'''cpic;1;24;1;18;0;9;0;2;'''cpic;0;12;0;0;5;10;2;8;'''cpic;1;14;2;7;1;9;0;−;'''cpic;1;2;0;0;0;1;4;7;'''cpic;1;3;0;−;0;2;2;4;'''cpic;0;3;0;0;2;3;0;1;'''cpic;5;1;4;9;2;2;0;−;'''cpic;3;11;0;0;0;3;1;9;'''cpic;10;13;5;5;1;0;0;−;'''cpic;0;4;0;−;0;5;1;14;'''cpic;0;0;0;4;0;1;0;0;'''cpic;0;14;0;−;1;8;2;21;'''cpic;0;3;4;13;1;8;0;4;'''cpic;0;12;2;19;1;5;0;1
'''cpo;4;6;9;8;7;18;0;−;'''cpo;1;2;0;−;0;2;0;9;'''cpo;0;4;3;6;1;3;0;−;'''cpo;0;4;0;−;5;9;7;2;'''cpo;2;1;6;1;3;4;0;−;'''cpo;2;1;0;−;2;0;6;1;'''cpo;0;3;0;−;0;2;4;2;'''cpo;0;2;0;−;4;1;3;1;'''cpo;14;2;6;3;4;0;0;0;'''cpo;2;6;0;3;0;4;4;23;'''cpo;2;3;6;4;1;4;0;−;'''cpo;1;1;0;0;3;2;4;1;'''cpo;0;−;4;10;0;0;0;−;'''cpo;1;1;0;−;1;2;6;1;'''cpo;0;0;18;15;1;6;0;−;'''cpo;0;3;5;2;0;5;0;−
'''csi;4;10;10;3;6;15;0;1;'''csi;2;5;0;−;0;4;3;6;'''csi;0;5;7;5;0;6;0;−;'''csi;0;4;0;−;11;14;7;5;'''csi;2;2;8;1;4;7;0;−;'''csi;4;2;0;−;2;1;8;1;'''csi;1;3;0;−;2;1;4;5;'''csi;1;2;0;−;2;1;3;2;'''csi;5;5;6;6;4;*6;0;0;'''csi;1;11;0;−;1;4;7;15;'''csi;2;1;8;1;3;5;0;−;'''csi;0;6;0;0;4;10;5;5;'''csi;0;−;0;10;0;0;0;−;'''csi;2;2;0;−;0;3;8;4;'''csi;0;0;4;19;4;3;0;−;'''csi;0;4;7;5;0;5;0;−
'''dme;4;1;9;0;12;0;0;−;'''dme;4;1;0;−;2;0;6;2;'''dme;0;2;4;1;2;0;0;−;'''dme;0;1;0;−;8;3;8;1;'''dme;2;1;4;0;4;3;0;−;'''dme;4;0;0;−;2;2;6;0;'''dme;6;3;0;−;0;−;9;0;'''dme;1;0;0;−;7;0;3;0;'''dme;2;6;11;2;10;4;0;−;'''dme;0;1;0;−;2;0;10;1;'''dme;4;1;12;1;0;−;0;−;'''dme;1;0;0;−;5;1;4;1;'''dme;0;−;0;8;0;−;0;−;'''dme;0;1;0;−;3;0;5;2;'''dme;0;0;3;3;6;1;0;−;'''dme;0;3;7;0;0;3;0;−
'''dno;4;13;17;5;13;29;0;−;'''dno;1;6;0;−;0;6;1;9;'''dno;0;8;3;6;1;45;0;−;'''dno;0;5;0;0;10;19;6;5;'''dno;2;2;6;3;3;6;0;0;'''dno;5;1;0;−;1;2;6;0;'''dno;1;6;0;−;0;4;5;4;'''dno;0;2;0;−;6;3;3;1;'''dno;2;8;12;8;7;37;0;−;'''dno;2;*7;0;1;1;15;7;15;'''dno;10;23;10;8;4;*5;0;$8;'''dno;0;15;0;0;5;*3;4;7;'''dno;0;−;3;10;0;−;0;−;'''dno;1;4;0;−;0;5;7;2;'''dno;0;0;9;12;3;11;0;−;'''dno;0;7;5;6;1;6;0;−
'''dsi;2;1;5;0;10;0;0;−;'''dsi;3;1;0;−;2;1;7;0;'''dsi;0;3;1;1;1;1;0;−;'''dsi;0;−;0;−;8;3;6;2;'''dsi;2;1;4;1;4;3;0;−;'''dsi;3;1;0;−;2;2;5;0;'''dsi;2;2;0;−;0;−;8;0;'''dsi;1;0;0;−;8;0;4;0;'''dsi;5;2;5;0;6;3;0;−;'''dsi;0;−;0;−;3;1;8;0;'''dsi;3;1;13;1;0;−;0;−;'''dsi;1;0;0;−;4;1;5;1;'''dsi;0;−;0;9;0;−;0;−;'''dsi;0;1;0;−;2;0;5;2;'''dsi;0;0;4;2;7;1;0;−;'''dsi;0;2;5;2;0;3;0;−
'''dya;3;2;10;0;12;3;0;0;'''dya;4;1;0;−;4;0;7;0;'''dya;0;2;4;3;2;1;0;−;'''dya;0;1;0;−;11;3;8;1;'''dya;3;0;4;0;3;4;0;−;'''dya;7;0;0;−;3;1;5;0;'''dya;5;1;0;−;0;−;11;0;'''dya;1;0;0;−;7;0;4;0;'''dya;4;6;14;2;11;2;0;−;'''dya;1;0;0;−;2;2;14;3;'''dya;5;1;14;1;0;0;0;−;'''dya;1;0;0;−;8;2;5;1;'''dya;0;−;0;8;0;−;0;−;'''dya;0;1;0;−;4;0;6;2;'''dya;0;0;5;2;6;1;0;−;'''dya;1;3;8;0;0;3;0;−
'''ecb;7;7;9;7;8;7;0;0;'''ecb;2;4;0;−;0;2;2;6;'''ecb;0;4;5;6;1;5;0;−;'''ecb;0;4;0;−;12;12;13;6;'''ecb;2;3;8;2;6;5;0;0;'''ecb;4;2;0;−;1;1;9;0;'''ecb;1;2;0;−;2;1;6;3;'''ecb;0;4;0;−;1;1;5;1;'''ecb;18;7;5;4;3;47;0;−;'''ecb;2;8;0;−;1;6;11;15;'''ecb;2;1;9;0;3;4;0;−;'''ecb;0;5;0;2;9;5;7;4;'''ecb;0;−;4;9;0;−;0;0;'''ecb;0;3;0;−;0;3;8;3;'''ecb;0;3;10;14;3;3;0;−;'''ecb;0;3;8;3;0;5;0;−
'''eeu;6;4;5;1;28;*10;0;−;'''eeu;0;5;0;−;0;3;2;6;'''eeu;0;4;4;2;1;5;0;−;'''eeu;0;3;0;−;10;5;7;1;'''eeu;1;2;4;0;2;5;0;−;'''eeu;3;1;0;−;2;0;8;1;'''eeu;1;3;0;−;1;1;3;2;'''eeu;0;2;0;−;2;3;4;1;'''eeu;15;3;9;3;5;3;0;−;'''eeu;0;9;0;−;0;3;4;9;'''eeu;5;1;10;3;2;2;0;−;'''eeu;0;5;0;−;2;1;3;3;'''eeu;0;−;0;12;0;−;0;−;'''eeu;0;2;0;−;0;2;5;1;'''eeu;0;1;14;19;2;4;0;−;'''eeu;0;2;5;2;0;5;0;−
'''fca;5;44;7;20;8;*15;0;4;'''fca;1;11;0;−;0;8;3;5;'''fca;0;*8;4;7;1;*14;0;1;'''fca;0;8;0;−;9;14;8;1;'''fca;5;*6;8;7;2;44;0;1;'''fca;4;*4;0;0;2;4;6;1;'''fca;7;*4;0;$2;0;23;5;3;'''fca;0;32;0;−;2;2;5;0;'''fca;10;5;7;1;3;40;0;0;'''fca;1;8;0;0;1;5;4;13;'''fca;2;45;7;2;1;4;0;1;'''fca;0;5;0;−;6;2;4;3;'''fca;1;$3;1;8;0;$4;0;−;'''fca;1;12;0;0;0;4;5;2;'''fca;0;$4;13;18;1;21;0;0;'''fca;0;18;4;7;0;7;0;0
'''gac;30;30;*12;40;*11;22;0;0;'''gac;19;15;0;−;14;8;*23;*11;'''gac;§1;24;14;15;21;4;0;−;'''gac;§5;14;0;−;*27;§64;*10;16;'''gac;§4;12;33;18;*5;19;0;−;'''gac;22;6;0;−;13;4;*10;4;'''gac;*1;13;0;−;0;1;37;11;'''gac;5;11;0;−;6;2;31;17;'''gac;3;*8;*9;48;28;24;0;−;'''gac;36;16;0;−;§1;14;31;21;'''gac;§12;20;10;1;1;2;0;−;'''gac;4;7;0;0;7;10;9;11;'''gac;0;−;4;12;0;−;0;−;'''gac;§7;18;0;−;23;5;38;13;'''gac;0;0;*21;34;§6;26;0;−;'''gac;4;7;23;11;1;5;0;−
'''gfr;2;1;1;4;1;5;0;0;'''gfr;0;3;0;−;0;0;2;2;'''gfr;0;2;3;2;0;1;0;−;'''gfr;0;1;0;0;2;3;4;1;'''gfr;0;1;0;3;1;1;0;−;'''gfr;1;3;0;−;0;0;3;0;'''gfr;0;1;0;−;0;−;1;4;'''gfr;0;−;0;−;2;4;1;2;'''gfr;0;1;1;3;4;1;0;−;'''gfr;0;4;0;−;0;1;9;6;'''gfr;2;1;7;0;1;2;0;−;'''gfr;0;0;0;0;1;1;0;1;'''gfr;0;−;4;7;0;−;0;−;'''gfr;0;2;0;−;0;0;1;0;'''gfr;0;−;5;4;0;2;0;−;'''gfr;0;10;4;1;0;1;0;−
'''gga;2;3;5;5;4;1;0;−;'''gga;1;2;0;−;0;1;0;3;'''gga;0;3;3;3;0;2;0;−;'''gga;0;1;0;−;8;5;6;0;'''gga;0;1;2;3;2;2;0;−;'''gga;1;2;0;−;1;1;6;0;'''gga;0;1;0;−;0;1;4;3;'''gga;0;1;0;−;2;4;0;2;'''gga;1;3;7;2;5;1;0;−;'''gga;3;3;0;−;0;3;13;10;'''gga;3;3;5;1;2;1;0;−;'''gga;0;2;0;0;2;4;2;4;'''gga;0;−;3;12;0;−;0;−;'''gga;1;2;0;−;1;0;4;4;'''gga;0;0;6;4;3;2;0;−;'''gga;0;2;5;4;0;2;0;−
'''ggo;3;10;9;19;5;13;0;1;'''ggo;1;4;0;−;1;4;2;6;'''ggo;0;4;4;3;1;4;0;−;'''ggo;0;5;0;2;10;6;5;8;'''ggo;1;9;6;0;5;15;0;−;'''ggo;3;3;0;−;3;0;5;4;'''ggo;1;4;0;−;2;2;3;3;'''ggo;0;4;0;−;1;3;4;4;'''ggo;3;4;7;7;2;6;0;−;'''ggo;1;5;0;1;0;4;3;19;'''ggo;1;3;5;7;4;4;0;−;'''ggo;0;7;0;0;5;5;2;6;'''ggo;1;0;1;21;0;2;0;3;'''ggo;0;4;0;1;0;4;6;4;'''ggo;0;2;5;29;2;6;0;0;'''ggo;1;7;5;7;0;8;0;−
'''gmo;17;§9;16;17;20;22;0;1;'''gmo;6;23;0;−;7;22;10;19;'''gmo;2;18;0;−;7;20;0;0;'''gmo;2;15;0;−;42;§111;5;20;'''gmo;3;7;10;15;22;22;0;0;'''gmo;6;14;0;0;10;11;25;29;'''gmo;2;14;0;1;3;6;8;22;'''gmo;4;19;0;−;13;§7;11;21;'''gmo;4;16;15;14;20;29;0;0;'''gmo;4;19;0;−;6;19;24;30;'''gmo;18;20;17;12;4;13;0;−;'''gmo;0;8;0;−;9;18;8;12;'''gmo;0;0;3;46;0;3;0;−;'''gmo;3;14;$5;$3;1;12;12;17;'''gmo;0;1;8;18;10;18;0;−;'''gmo;1;14;12;23;0;14;0;5
'''gmx;15;4;12;9;20;1;0;1;'''gmx;5;4;0;0;2;1;3;5;'''gmx;10;7;16;11;10;2;0;−;'''gmx;5;2;0;−;22;13;12;18;'''gmx;10;2;15;2;8;4;0;−;'''gmx;20;6;0;−;3;1;16;4;'''gmx;6;2;0;−;1;3;11;1;'''gmx;7;2;0;−;6;0;15;0;'''gmx;9;14;25;7;17;6;0;−;'''gmx;12;4;0;−;5;2;21;2;'''gmx;16;1;26;2;6;2;0;−;'''gmx;5;3;0;0;11;1;15;6;'''gmx;0;−;1;19;0;−;0;−;'''gmx;6;4;0;−;4;1;10;4;'''gmx;0;−;13;0;15;2;0;−;'''gmx;4;4;17;4;10;7;0;−
'''hgl;3;4;5;3;4;10;0;−;'''hgl;0;3;0;1;0;3;0;14;'''hgl;0;5;2;4;1;3;0;1;'''hgl;0;2;0;−;6;7;5;2;'''hgl;0;2;5;1;3;2;0;−;'''hgl;1;3;0;−;1;1;4;8;'''hgl;0;3;0;−;0;3;2;2;'''hgl;0;4;0;−;1;3;2;2;'''hgl;0;3;4;5;3;0;0;1;'''hgl;1;3;0;5;1;4;1;44;'''hgl;1;2;6;3;1;1;0;3;'''hgl;1;2;0;0;3;2;1;10;'''hgl;0;−;0;6;0;−;0;−;'''hgl;0;2;0;−;0;2;2;4;'''hgl;3;3;5;17;1;4;0;−;'''hgl;0;3;4;1;0;4;0;−
'''hsa-18;4;7;8;16;5;9;0;−;'''hsa-18;0;5;0;−;0;4;3;5;'''hsa-18;0;5;2;5;0;4;0;−;'''hsa-18;0;4;2;0;11;8;5;9;'''hsa-18;2;3;8;0;6;6;0;−;'''hsa-18;4;2;0;−;2;1;7;1;'''hsa-18;0;5;0;−;2;1;5;1;'''hsa-18;0;2;0;−;7;1;5;3;'''hsa-18;16;3;10;2;6;1;0;−;'''hsa-18;1;6;0;−;0;3;10;15;'''hsa-18;5;3;9;4;2;2;0;−;'''hsa-18;1;3;0;−;7;5;4;5;'''hsa-18;0;−;0;12;0;−;0;0;'''hsa-18;0;3;0;−;0;3;5;3;'''hsa-18;0;1;6;22;2;4;0;−;'''hsa-18;0;3;5;4;0;6;0;−
'''lav;14;45;14;36;14;21;0;3;'''lav;5;16;0;0;0;9;1;12;'''lav;0;*8;7;*6;2;13;0;2;'''lav;0;6;0;−;16;33;13;29;'''lav;3;10;14;12;5;22;0;2;'''lav;2;11;0;−;2;0;9;6;'''lav;4;13;0;−;0;2;4;9;'''lav;0;10;0;−;4;5;4;17;'''lav;2;9;6;13;6;17;0;−;'''lav;6;46;0;−;0;14;14;39;'''lav;3;*3;7;25;2;*5;0;3;'''lav;11;38;0;0;9;25;7;33;'''lav;0;1;0;18;0;−;0;0;'''lav;0;6;0;−;1;2;9;19;'''lav;0;$4;5;22;6;16;0;0;'''lav;1;13;13;18;3;13;0;0
'''lcm;7;12;2;6;4;8;0;2;'''lcm;1;7;0;−;0;1;3;7;'''lcm;0;8;1;6;0;7;0;−;'''lcm;0;6;0;−;3;7;1;5;'''lcm;1;8;2;2;2;6;0;−;'''lcm;3;6;0;−;0;3;2;9;'''lcm;0;3;0;−;0;0;2;1;'''lcm;1;3;0;−;0;7;1;2;'''lcm;2;3;3;15;2;5;0;0;'''lcm;1;18;0;−;1;1;3;1;'''lcm;0;4;2;4;1;0;0;−;'''lcm;0;6;0;−;1;2;0;2;'''lcm;0;0;0;7;1;1;0;1;'''lcm;0;5;0;−;0;2;0;2;'''lcm;0;3;3;13;2;12;0;4;'''lcm;0;10;1;5;0;3;0;−
'''lma;0;0;2;0;2;1;0;−;'''lma;0;0;0;−;1;0;2;0;'''lma;0;0;0;1;0;0;0;−;'''lma;0;0;0;−;2;1;2;0;'''lma;0;0;1;0;2;0;0;−;'''lma;0;0;0;−;1;0;1;0;'''lma;0;0;0;−;0;0;3;0;'''lma;0;0;0;−;1;0;2;0;'''lma;0;0;2;0;1;0;0;−;'''lma;0;0;0;−;1;0;1;0;'''lma;0;0;3;0;0;0;0;−;'''lma;0;0;0;−;1;0;1;0;'''lma;0;−;1;1;0;−;0;−;'''lma;0;0;0;−;0;0;0;0;'''lma;0;−;0;0;0;0;0;−;'''lma;0;0;1;0;0;0;0;−
'''mcc;6;12;6;20;7;8;0;1;'''mcc;0;5;0;−;0;3;3;6;'''mcc;0;5;4;3;1;5;0;−;'''mcc;0;6;0;5;5;13;4;7;'''mcc;1;14;10;3;4;9;0;−;'''mcc;3;6;0;0;2;0;6;1;'''mcc;0;4;0;−;2;1;3;2;'''mcc;0;4;0;−;2;3;2;6;'''mcc;2;3;6;8;2;3;0;0;'''mcc;0;10;0;0;1;3;4;17;'''mcc;2;2;6;8;3;4;0;−;'''mcc;1;5;0;2;4;7;3;6;'''mcc;0;1;0;30;0;1;0;0;'''mcc;4;15;0;1;0;3;5;3;'''mcc;0;1;8;19;3;5;0;1;'''mcc;1;14;5;4;1;7;0;−
'''mdo;9;3;9;3;10;8;0;−;'''mdo;5;1;0;−;0;2;6;5;'''mdo;0;5;7;1;1;3;0;−;'''mdo;0;6;0;−;14;10;12;0;'''mdo;0;6;8;0;8;2;0;−;'''mdo;5;2;0;−;2;0;10;0;'''mdo;2;2;0;−;1;2;0;4;'''mdo;0;5;0;−;5;5;5;2;'''mdo;3;12;12;11;10;2;0;0;'''mdo;3;5;0;−;2;3;9;5;'''mdo;4;6;19;4;6;1;0;−;'''mdo;1;3;0;−;6;2;6;2;'''mdo;0;−;2;12;0;−;0;−;'''mdo;1;4;0;−;0;2;6;5;'''mdo;0;−;31;14;3;5;0;3;'''mdo;0;1;8;3;1;2;0;−
'''meu;3;6;10;3;8;2;0;−;'''meu;3;2;0;−;0;2;3;4;'''meu;1;5;6;3;0;3;0;−;'''meu;0;5;0;−;7;6;4;1;'''meu;1;2;6;0;1;5;0;0;'''meu;3;0;0;−;1;0;4;2;'''meu;2;2;0;−;0;2;2;4;'''meu;1;2;0;−;1;4;2;2;'''meu;3;8;1;11;5;1;0;−;'''meu;0;5;0;−;2;2;4;8;'''meu;6;3;7;8;2;2;0;−;'''meu;0;0;0;−;3;3;5;2;'''meu;0;−;0;7;0;−;0;0;'''meu;2;1;0;−;0;1;6;1;'''meu;3;3;19;9;1;6;0;−;'''meu;0;2;3;6;0;7;0;0
'''mgp;2;1;2;1;1;1;0;−;'''mgp;0;1;0;−;0;−;0;3;'''mgp;0;2;1;4;1;1;0;−;'''mgp;0;0;0;−;7;3;1;1;'''mgp;0;0;0;2;0;0;0;−;'''mgp;0;1;0;−;0;0;5;1;'''mgp;0;0;0;−;0;1;0;1;'''mgp;0;0;0;−;1;2;0;0;'''mgp;5;1;2;0;3;2;0;−;'''mgp;2;3;0;−;0;2;4;2;'''mgp;2;1;4;0;1;1;0;−;'''mgp;0;1;0;0;0;2;0;2;'''mgp;0;−;2;3;0;−;0;−;'''mgp;0;2;0;−;0;0;2;2;'''mgp;0;−;2;2;2;2;0;−;'''mgp;0;0;2;3;0;1;0;−
'''mlu;1;1;7;1;4;6;0;−;'''mlu;2;2;0;−;0;2;2;2;'''mlu;1;3;2;2;0;4;0;−;'''mlu;0;2;0;−;8;5;6;3;'''mlu;0;2;4;2;2;4;0;4;'''mlu;0;2;0;−;2;0;5;0;'''mlu;1;3;0;−;0;1;1;4;'''mlu;0;1;0;−;3;1;1;1;'''mlu;5;1;5;2;5;0;0;−;'''mlu;0;0;0;−;0;2;3;4;'''mlu;4;1;6;1;1;1;0;−;'''mlu;0;2;0;−;4;0;3;1;'''mlu;0;−;0;4;0;−;0;−;'''mlu;0;1;0;−;0;1;4;1;'''mlu;0;−;17;9;2;1;0;−;'''mlu;0;1;3;1;0;2;0;−
'''mmr;3;1;4;4;4;1;0;−;'''mmr;0;2;0;−;0;1;0;2;'''mmr;0;4;2;4;0;2;0;−;'''mmr;1;1;0;−;8;5;2;1;'''mmr;1;2;3;2;7;4;0;−;'''mmr;1;2;0;−;2;0;6;0;'''mmr;1;1;0;−;0;1;2;3;'''mmr;0;1;0;−;4;2;3;1;'''mmr;2;4;3;1;4;3;0;−;'''mmr;0;4;0;−;0;2;3;7;'''mmr;5;1;8;2;0;1;0;−;'''mmr;0;1;0;−;3;1;2;1;'''mmr;0;−;0;7;0;−;0;−;'''mmr;0;1;0;−;0;2;1;5;'''mmr;0;−;11;8;2;3;0;0;'''mmr;0;2;6;1;0;2;0;−
'''mmu;8;5;8;4;7;18;0;−;'''mmu;1;2;0;−;0;3;2;8;'''mmu;0;5;2;5;1;3;0;−;'''mmu;0;4;0;0;8;10;7;4;'''mmu;1;5;7;2;5;6;0;0;'''mmu;3;4;0;0;2;0;5;2;'''mmu;1;3;0;−;0;2;3;2;'''mmu;0;3;0;−;6;3;2;2;'''mmu;8;6;12;3;8;5;0;−;'''mmu;3;7;0;3;3;6;4;18;'''mmu;6;1;9;5;2;4;0;1;'''mmu;2;0;0;0;4;7;2;5;'''mmu;0;0;0;10;0;−;0;−;'''mmu;1;1;0;0;0;2;5;4;'''mmu;0;0;32;27;2;5;0;0;'''mmu;2;4;4;2;0;3;0;−
'''mpu;6;24;4;7;5;*10;0;5;'''mpu;1;5;0;−;0;4;2;7;'''mpu;1;14;4;7;0;20;0;−;'''mpu;0;4;0;−;6;13;6;3;'''mpu;2;34;5;1;3;13;0;0;'''mpu;1;5;0;−;1;0;8;0;'''mpu;1;27;0;−;2;2;3;2;'''mpu;0;3;0;−;2;2;4;1;'''mpu;2;2;4;3;4;14;0;−;'''mpu;1;6;0;−;1;3;2;12;'''mpu;2;6;7;1;1;2;0;−;'''mpu;0;5;0;−;3;3;3;4;'''mpu;0;1;0;8;0;4;0;−;'''mpu;0;3;0;−;0;3;5;2;'''mpu;0;0;15;9;2;8;0;−;'''mpu;0;3;6;4;0;5;0;−
'''mtr;7;12;14;15;13;2;4;$5;'''mtr;3;6;2;1;0;0;8;1;'''mtr;2;5;6;8;2;3;0;−;'''mtr;7;6;0;−;18;22;14;8;'''mtr;10;9;10;7;2;2;0;−;'''mtr;8;2;0;0;0;0;6;0;'''mtr;3;1;0;−;1;1;5;6;'''mtr;6;3;0;−;2;1;3;5;'''mtr;22;23;16;13;8;2;0;0;'''mtr;8;7;0;−;0;2;15;9;'''mtr;9;5;19;3;1;1;0;0;'''mtr;2;4;0;2;2;4;11;5;'''mtr;2;$3;2;10;0;−;0;2;'''mtr;4;3;1;1;1;0;7;4;'''mtr;0;0;7;2;7;6;0;0;'''mtr;3;4;20;5;5;8;0;0
'''mun;1;1;4;4;3;9;0;−;'''mun;0;1;0;−;0;−;1;3;'''mun;0;3;0;7;1;2;0;−;'''mun;0;0;0;−;6;2;3;1;'''mun;1;0;0;3;0;4;0;−;'''mun;1;2;0;−;0;1;0;2;'''mun;0;0;0;−;0;0;1;1;'''mun;0;−;0;−;0;5;0;2;'''mun;13;0;4;4;0;0;0;−;'''mun;0;4;0;−;0;1;7;1;'''mun;5;5;4;5;0;0;0;−;'''mun;0;0;0;0;2;1;1;2;'''mun;0;0;2;4;0;−;0;−;'''mun;1;3;0;0;0;1;0;3;'''mun;0;0;0;4;1;2;0;−;'''mun;1;2;2;3;0;2;0;−
'''nle;8;14;7;13;6;13;0;2;'''nle;0;5;0;−;0;4;3;8;'''nle;0;6;3;5;1;3;0;−;'''nle;0;4;0;2;7;9;4;8;'''nle;2;7;7;3;3;13;0;−;'''nle;2;2;0;1;3;0;5;3;'''nle;0;6;0;−;1;1;4;2;'''nle;0;3;0;−;3;5;4;5;'''nle;3;3;5;7;7;9;0;−;'''nle;0;10;0;0;1;3;2;16;'''nle;4;1;5;7;1;8;0;−;'''nle;0;5;0;0;4;8;4;6;'''nle;0;2;0;18;0;4;0;−;'''nle;0;5;1;2;0;4;3;6;'''nle;0;2;9;13;0;9;0;0;'''nle;0;7;4;12;0;5;0;0
'''oaa;7;24;10;10;10;14;0;−;'''oaa;2;15;0;0;2;7;7;15;'''oaa;0;5;6;11;2;6;$7;$10;'''oaa;2;7;0;−;14;17;10;16;'''oaa;3;7;4;19;5;13;0;0;'''oaa;3;8;0;3;4;2;13;5;'''oaa;2;4;0;−;3;10;4;7;'''oaa;2;4;0;−;5;12;3;4;'''oaa;5;4;13;13;13;13;0;−;'''oaa;6;10;0;−;3;7;32;*21;'''oaa;6;8;17;22;4;4;0;1;'''oaa;2;12;0;0;5;4;7;15;'''oaa;0;2;2;25;0;−;0;−;'''oaa;0;5;0;3;1;6;0;−;'''oaa;0;4;18;18;5;8;0;−;'''oaa;3;6;6;17;0;9;0;0
'''oas;5;16;8;4;5;10;0;−;'''oas;1;3;0;−;0;2;0;4;'''oas;0;21;1;5;1;31;0;−;'''oas;0;4;0;−;4;13;3;2;'''oas;0;6;3;4;3;5;0;−;'''oas;2;3;0;−;0;0;3;0;'''oas;0;5;0;1;0;5;0;1;'''oas;0;2;0;−;0;1;3;2;'''oas;1;5;2;5;3;*15;0;1;'''oas;0;11;0;2;1;5;7;10;'''oas;1;*3;3;26;2;*5;0;4;'''oas;0;7;0;−;2;6;3;3;'''oas;0;−;0;15;0;2;0;1;'''oas;0;3;0;2;0;2;1;0;'''oas;0;3;5;*12;2;44;0;$4;'''oas;0;4;2;3;0;6;0;0
'''ocu;4;7;11;14;9;19;0;0;'''ocu;1;5;0;0;0;4;2;5;'''ocu;0;5;7;2;1;4;0;−;'''ocu;0;6;0;0;8;9;6;4;'''ocu;2;2;8;0;8;6;0;−;'''ocu;2;2;0;−;3;0;8;0;'''ocu;2;2;0;−;1;2;4;2;'''ocu;0;3;0;−;10;5;2;2;'''ocu;2;11;17;5;14;4;0;0;'''ocu;0;8;0;−;0;3;7;13;'''ocu;12;1;18;2;5;10;0;−;'''ocu;3;4;0;−;10;3;4;7;'''ocu;0;−;0;11;0;−;0;−;'''ocu;0;3;0;−;1;3;7;2;'''ocu;0;0;9;15;3;6;0;−;'''ocu;1;4;6;7;0;2;0;−
'''oga;4;6;8;3;4;4;0;−;'''oga;1;4;0;−;0;2;1;7;'''oga;0;3;2;4;0;4;0;1;'''oga;0;10;0;$5;5;7;6;3;'''oga;1;3;7;0;5;3;0;−;'''oga;1;2;0;−;2;0;6;0;'''oga;0;3;0;−;0;2;2;3;'''oga;0;2;0;−;5;3;3;0;'''oga;0;2;9;3;6;1;0;−;'''oga;2;4;0;−;1;1;5;7;'''oga;3;5;7;4;2;0;0;−;'''oga;1;1;0;−;3;1;3;2;'''oga;0;0;1;6;0;−;0;−;'''oga;1;1;0;−;0;2;2;3;'''oga;0;0;10;10;0;5;0;−;'''oga;0;2;4;1;0;4;0;0
'''oni;9;6;8;0;22;20;0;−;'''oni;3;21;0;0;1;6;6;11;'''oni;1;25;5;4;12;5;0;1;'''oni;5;19;0;−;20;6;12;12;'''oni;1;4;9;13;7;3;0;−;'''oni;6;4;0;−;2;1;10;3;'''oni;0;6;0;−;0;5;12;3;'''oni;1;5;0;−;8;7;5;8;'''oni;7;8;6;3;13;1;0;−;'''oni;5;5;0;−;4;7;11;6;'''oni;6;5;8;4;2;6;0;−;'''oni;2;6;0;−;7;1;6;1;'''oni;0;−;0;17;0;−;0;2;'''oni;1;8;0;−;1;4;6;3;'''oni;0;0;8;33;7;4;0;0;'''oni;0;11;9;13;0;6;0;−
'''opr;3;5;9;4;4;6;0;−;'''opr;1;4;0;−;0;6;1;5;'''opr;0;4;4;2;1;4;0;−;'''opr;0;3;0;−;11;3;6;1;'''opr;2;2;4;0;6;5;0;−;'''opr;1;2;0;−;3;0;7;0;'''opr;1;4;0;−;1;2;4;2;'''opr;0;4;0;−;8;2;2;2;'''opr;12;3;11;2;7;3;0;−;'''opr;1;5;0;−;1;2;4;10;'''opr;5;1;11;5;3;1;0;−;'''opr;0;3;0;−;5;1;2;4;'''opr;0;−;0;9;0;−;0;−;'''opr;0;2;0;−;1;2;5;1;'''opr;0;0;6;3;2;3;0;−;'''opr;0;2;4;5;0;3;0;−
'''osa;4;7;17;12;15;4;0;−;'''osa;9;6;5;2;3;1;8;2;'''osa;6;5;14;5;6;4;0;−;'''osa;2;2;0;−;31;28;14;3;'''osa;9;11;16;9;3;6;0;−;'''osa;5;8;0;−;3;5;10;3;'''osa;2;1;0;−;3;4;17;6;'''osa;5;4;0;−;8;1;11;3;'''osa;3;12;20;10;14;10;0;0;'''osa;9;0;0;0;8;4;16;3;'''osa;5;4;19;8;4;4;0;−;'''osa;3;0;$2;3;7;3;11;6;'''osa;0;−;3;16;0;−;0;1;'''osa;10;6;3;0;3;5;7;4;'''osa;0;−;8;8;11;6;0;0;'''osa;1;2;13;6;14;4;0;−
'''pan;6;12;9;19;6;10;0;1;'''pan;0;7;0;−;0;6;4;6;'''pan;0;5;4;6;1;3;0;−;'''pan;0;6;0;1;8;10;5;8;'''pan;2;11;9;0;4;9;0;−;'''pan;2;3;0;−;3;0;5;3;'''pan;0;4;0;−;2;1;4;2;'''pan;0;2;0;−;6;5;4;3;'''pan;13;8;8;6;7;2;0;1;'''pan;0;9;0;0;1;3;4;15;'''pan;6;1;10;9;3;5;0;−;'''pan;2;4;0;1;6;5;4;4;'''pan;0;2;1;22;0;−;0;3;'''pan;0;8;0;0;0;2;6;3;'''pan;0;2;12;17;4;5;0;3;'''pan;0;9;9;4;0;8;0;0
'''pfa;0;−;0;0;0;−;0;−;'''pfa;0;0;0;−;0;0;0;−;'''pfa;0;0;0;0;0;−;0;−;'''pfa;0;0;0;−;0;1;0;0;'''pfa;0;0;0;−;0;0;0;−;'''pfa;0;0;0;−;0;0;0;0;'''pfa;0;0;0;−;0;−;0;−;'''pfa;0;0;0;−;0;0;0;0;'''pfa;0;0;0;0;0;0;0;−;'''pfa;0;0;0;−;0;0;0;0;'''pfa;0;0;0;−;0;−;0;−;'''pfa;0;0;0;−;0;0;0;0;'''pfa;0;−;0;0;0;−;0;−;'''pfa;0;0;0;−;0;0;0;0;'''pfa;0;−;0;−;0;−;0;−;'''pfa;0;0;0;0;0;0;0;−
'''pha;6;5;8;9;6;5;0;0;'''pha;0;6;0;−;0;5;4;5;'''pha;0;5;4;4;1;3;0;−;'''pha;0;3;0;1;9;5;5;6;'''pha;2;3;9;0;4;6;0;−;'''pha;2;3;0;−;3;0;5;1;'''pha;1;4;0;−;2;1;3;3;'''pha;0;2;0;−;1;4;4;4;'''pha;4;8;6;3;3;0;0;0;'''pha;0;8;0;0;1;3;3;15;'''pha;2;1;6;6;3;4;0;−;'''pha;2;4;0;0;6;5;5;3;'''pha;0;0;2;12;0;−;0;−;'''pha;0;4;0;−;0;2;6;2;'''pha;0;0;13;14;3;4;0;1;'''pha;0;6;9;2;1;5;0;−
'''pma;17;6;*29;*12;13;9;0;−;'''pma;10;8;$5;$4;11;11;29;32;'''pma;8;9;§7;30;25;24;0;−;'''pma;3;6;0;−;*27;§90;§25;*11;'''pma;23;20;15;11;§9;47;0;0;'''pma;29;13;0;−;12;8;36;17;'''pma;17;8;0;0;4;5;*19;29;'''pma;26;13;0;−;§15;§11;*26;*6;'''pma;3;4;*8;33;8;2;0;1;'''pma;21;9;0;−;18;5;*17;43;'''pma;13;3;29;24;4;1;0;0;'''pma;7;18;0;0;§8;24;*27;*7;'''pma;1;0;§3;*35;0;0;0;−;'''pma;10;9;0;−;18;16;14;7;'''pma;0;0;38;29;1;7;0;−;'''pma;2;2;34;22;18;23;0;1
'''pop;13;4;11;12;15;1;0;−;'''pop;5;5;0;−;2;1;2;4;'''pop;5;5;10;5;7;3;0;0;'''pop;6;2;0;0;18;7;14;5;'''pop;10;0;9;3;4;6;0;−;'''pop;13;9;0;−;2;1;12;1;'''pop;5;1;0;−;1;4;4;7;'''pop;0;−;0;0;5;1;13;35;'''pop;3;17;29;4;13;7;0;−;'''pop;13;7;0;−;2;2;18;1;'''pop;10;6;21;4;6;0;0;−;'''pop;5;2;0;−;6;4;13;3;'''pop;0;0;2;15;0;−;0;−;'''pop;4;4;0;0;1;3;8;5;'''pop;0;0;8;5;12;1;0;0;'''pop;1;5;15;2;0;2;1;4
'''ppp;4;3;9;4;11;4;0;0;'''ppp;1;3;0;−;3;2;8;1;'''ppp;4;2;6;2;5;4;0;−;'''ppp;2;2;0;−;15;8;9;2;'''ppp;3;6;6;2;8;1;0;−;'''ppp;6;1;0;−;0;4;11;1;'''ppp;2;4;0;0;2;2;5;2;'''ppp;1;4;0;0;3;1;5;0;'''ppp;6;6;8;2;7;7;0;0;'''ppp;7;1;0;−;6;1;10;8;'''ppp;5;3;13;2;3;7;0;0;'''ppp;1;0;0;−;2;8;10;2;'''ppp;0;−;1;6;0;1;0;−;'''ppp;2;2;0;−;5;1;10;2;'''ppp;0;0;2;4;8;0;0;−;'''ppp;1;0;11;2;3;2;0;1
'''ppy;8;14;11;29;8;18;1;0;'''ppy;0;3;0;−;0;6;4;7;'''ppy;2;5;4;3;2;6;0;−;'''ppy;0;5;3;2;9;12;7;8;'''ppy;0;12;7;3;4;19;0;−;'''ppy;3;5;0;0;3;1;8;2;'''ppy;1;4;0;−;4;2;4;2;'''ppy;0;2;0;0;3;7;6;9;'''ppy;6;11;7;5;5;5;0;0;'''ppy;2;6;0;0;1;2;3;18;'''ppy;3;4;8;5;2;10;0;−;'''ppy;2;4;0;0;7;10;4;5;'''ppy;0;0;1;27;0;1;0;1;'''ppy;0;7;0;1;1;4;3;7;'''ppy;0;2;9;24;1;8;0;−;'''ppy;0;7;5;12;0;6;0;−
'''ptr;6;13;9;23;8;17;0;1;'''ptr;1;4;0;−;0;5;2;7;'''ptr;0;5;3;5;1;3;0;2;'''ptr;0;4;0;2;9;13;6;10;'''ptr;3;16;8;1;7;13;0;−;'''ptr;4;5;0;0;3;1;4;6;'''ptr;0;5;0;0;2;2;5;1;'''ptr;0;3;0;0;2;6;5;5;'''ptr;9;8;7;9;6;6;0;0;'''ptr;1;8;0;0;0;4;5;25;'''ptr;2;4;6;6;2;13;0;−;'''ptr;0;9;0;0;4;9;6;4;'''ptr;0;1;2;28;0;3;0;4;'''ptr;0;8;1;2;0;3;6;5;'''ptr;0;1;9;23;3;4;0;0;'''ptr;2;8;5;10;0;6;0;−
'''rno;0;0;8;6;10;8;0;−;'''rno;1;3;0;−;0;3;2;6;'''rno;0;5;5;6;2;5;0;0;'''rno;0;2;0;−;7;5;5;6;'''rno;1;4;9;0;4;5;0;−;'''rno;4;1;0;−;2;0;10;22;'''rno;1;3;0;−;0;2;3;2;'''rno;0;0;0;−;2;2;0;0;'''rno;6;7;12;2;5;2;1;0;'''rno;3;5;0;1;0;3;5;30;'''rno;6;2;7;3;1;3;0;−;'''rno;1;1;0;−;2;4;3;4;'''rno;0;−;0;1;0;−;0;−;'''rno;0;3;0;−;0;2;2;8;'''rno;0;0;26;13;1;6;0;−;'''rno;0;2;4;3;0;−;0;0
'''san;5;2;8;3;6;6;0;−;'''san;0;4;0;−;0;4;2;5;'''san;0;5;4;3;2;3;0;−;'''san;0;4;0;−;7;7;7;7;'''san;2;2;6;0;4;2;0;−;'''san;2;3;0;−;1;0;7;0;'''san;0;4;0;−;1;1;4;4;'''san;0;1;0;0;3;9;4;1;'''san;2;2;9;9;9;4;0;−;'''san;1;6;0;−;1;1;2;7;'''san;5;6;11;10;1;0;0;−;'''san;0;4;0;−;3;3;5;1;'''san;0;−;0;8;0;0;0;−;'''san;0;2;0;−;0;3;4;3;'''san;0;1;13;11;1;4;0;−;'''san;0;3;5;4;0;3;0;−
'''sbi;3;7;9;6;15;6;0;0;'''sbi;4;7;0;1;3;2;3;8;'''sbi;2;5;7;5;7;2;0;−;'''sbi;1;3;0;−;9;29;14;2;'''sbi;3;7;8;6;5;7;0;1;'''sbi;6;4;0;1;4;3;9;4;'''sbi;3;0;0;−;4;2;11;3;'''sbi;3;5;0;−;7;3;11;3;'''sbi;4;10;20;3;17;8;0;1;'''sbi;8;4;4;6;9;1;14;12;'''sbi;7;2;18;5;4;1;0;−;'''sbi;2;1;0;2;8;2;9;6;'''sbi;0;0;0;13;0;1;0;0;'''sbi;7;5;0;2;4;5;8;2;'''sbi;0;0;6;6;10;2;0;−;'''sbi;0;3;16;4;4;4;0;−
'''sbq;4;13;5;6;3;6;0;−;'''sbq;1;5;0;−;0;4;2;6;'''sbq;0;5;3;3;1;3;0;−;'''sbq;0;5;0;0;8;6;6;4;'''sbq;0;7;5;3;3;7;0;−;'''sbq;2;2;0;−;3;0;5;3;'''sbq;0;3;0;−;1;1;4;1;'''sbq;0;3;0;−;2;2;4;2;'''sbq;2;6;6;4;3;6;0;0;'''sbq;1;6;0;−;1;3;3;11;'''sbq;2;3;7;4;0;3;0;−;'''sbq;1;3;0;0;2;5;2;3;'''sbq;0;0;0;14;0;−;0;1;'''sbq;1;4;0;0;0;2;6;2;'''sbq;0;2;10;10;1;6;0;0;'''sbq;0;8;5;4;0;6;0;−
'''shr;8;5;12;0;9;22;0;−;'''shr;4;2;0;−;0;1;4;4;'''shr;0;4;6;1;1;2;0;−;'''shr;0;3;0;−;14;7;10;0;'''shr;16;28;8;0;7;2;0;−;'''shr;5;0;0;−;2;0;8;1;'''shr;2;2;0;−;0;2;0;3;'''shr;0;3;0;−;5;3;6;2;'''shr;3;12;12;6;8;1;0;−;'''shr;3;3;0;−;2;1;10;7;'''shr;6;2;16;2;3;2;0;−;'''shr;1;2;0;−;6;3;7;0;'''shr;0;1;1;9;0;−;0;−;'''shr;0;4;0;−;0;2;7;2;'''shr;0;1;2;5;3;4;0;−;'''shr;0;5;6;6;0;2;0;−
'''spu;37;19;30;8;30;11;0;−;'''spu;11;9;0;−;4;4;14;12;'''spu;9;8;14;2;7;11;$17;$8;'''spu;6;15;0;1;43;29;*9;11;'''spu;10;6;17;8;10;10;0;−;'''spu;15;5;0;−;4;4;14;4;'''spu;9;9;0;−;0;0;20;8;'''spu;2;5;0;−;2;2;5;12;'''spu;2;*7;*10;19;19;9;0;−;'''spu;10;6;0;−;4;2;21;10;'''spu;19;13;26;15;1;2;0;−;'''spu;5;5;0;−;0;−;17;2;'''spu;0;0;7;16;0;−;0;−;'''spu;6;8;0;−;1;4;0;−;'''spu;0;−;20;10;5;12;0;−;'''spu;5;8;0;−;6;11;0;1
'''ssc;15;22;10;7;7;8;0;1;'''ssc;3;4;0;−;0;3;6;6;'''ssc;1;5;6;3;0;3;0;−;'''ssc;1;3;0;−;12;10;12;0;'''ssc;3;5;7;2;4;7;0;−;'''ssc;2;1;0;−;2;0;8;0;'''ssc;2;2;0;−;2;0;5;1;'''ssc;2;2;0;−;3;1;5;2;'''ssc;47;*10;14;*15;5;7;1;$5;'''ssc;2;11;0;−;1;5;5;17;'''ssc;2;7;9;9;2;3;0;−;'''ssc;2;8;0;0;7;4;4;5;'''ssc;0;0;3;13;0;−;0;−;'''ssc;0;4;0;−;0;3;6;3;'''ssc;0;−;10;12;3;3;0;0;'''ssc;0;3;11;9;1;4;0;−
'''str;5;4;7;1;7;4;0;0;'''str;2;3;0;4;0;6;2;31;'''str;0;4;2;4;1;4;0;−;'''str;0;3;0;5;7;6;6;7;'''str;2;1;4;1;4;1;0;−;'''str;2;4;0;0;2;0;7;4;'''str;0;4;0;−;0;2;3;2;'''str;0;2;0;−;2;1;3;2;'''str;8;2;5;2;3;3;0;5;'''str;0;38;1;$6;1;16;4;*14;'''str;2;2;7;5;1;18;0;6;'''str;1;3;0;2;3;35;4;13;'''str;0;−;0;8;0;−;0;−;'''str;0;6;0;0;0;5;6;8;'''str;0;0;29;18;3;3;0;−;'''str;0;2;6;3;0;9;0;0
'''tgu;3;0;3;4;1;4;0;2;'''tgu;1;2;0;4;0;1;2;5;'''tgu;0;3;2;2;0;1;1;1;'''tgu;0;0;0;4;2;2;5;34;'''tgu;0;1;2;2;4;1;0;−;'''tgu;0;0;0;−;1;0;3;2;'''tgu;0;2;0;−;0;−;2;3;'''tgu;0;0;0;−;3;3;0;1;'''tgu;5;0;3;3;1;1;0;−;'''tgu;2;4;0;−;0;2;8;9;'''tgu;4;2;7;4;0;3;0;0;'''tgu;0;1;0;1;0;0;1;7;'''tgu;0;−;3;9;0;−;0;−;'''tgu;0;3;0;−;0;0;2;0;'''tgu;0;0;5;3;0;2;0;0;'''tgu;1;2;6;3;0;3;0;1
'''tma;5;25;5;17;7;8;0;0;'''tma;1;16;0;0;0;3;1;14;'''tma;1;*10;2;33;0;12;0;4;'''tma;0;7;0;0;7;13;5;7;'''tma;2;5;7;4;4;5;0;−;'''tma;3;4;0;−;2;0;7;3;'''tma;0;11;0;−;1;5;3;4;'''tma;0;4;0;−;1;3;3;4;'''tma;10;3;4;10;0;18;0;0;'''tma;3;36;0;0;1;4;4;15;'''tma;5;*3;5;17;2;*5;0;8;'''tma;0;25;0;−;3;12;3;7;'''tma;0;1;0;14;0;−;0;0;'''tma;0;5;0;−;1;2;4;9;'''tma;0;$4;2;19;2;10;0;4;'''tma;0;5;3;7;0;9;0;0
'''tng;4;10;6;10;10;10;0;−;'''tng;3;8;0;−;3;9;9;16;'''tng;0;9;5;5;6;4;0;0;'''tng;0;4;0;−;8;11;8;9;'''tng;4;4;4;7;13;4;0;−;'''tng;4;9;0;0;1;3;4;8;'''tng;0;6;0;0;0;1;10;3;'''tng;0;5;0;−;18;18;2;12;'''tng;8;4;6;12;8;4;0;−;'''tng;2;8;0;−;0;3;7;12;'''tng;5;10;5;8;1;4;0;−;'''tng;1;2;0;−;7;8;3;6;'''tng;0;−;2;10;0;−;0;3;'''tng;0;8;5;$3;1;1;5;8;'''tng;0;0;7;7;5;6;0;−;'''tng;1;3;9;9;0;11;0;0
'''tru;7;12;10;12;13;6;0;−;'''tru;1;5;0;−;1;6;7;10;'''tru;1;11;6;12;5;4;0;−;'''tru;0;5;0;−;24;11;9;2;'''tru;3;6;10;8;8;5;0;1;'''tru;4;4;0;−;2;3;7;2;'''tru;0;6;0;0;0;3;13;2;'''tru;0;3;0;−;14;6;3;7;'''tru;6;5;18;5;14;6;0;0;'''tru;3;4;0;−;0;5;7;4;'''tru;7;4;15;2;1;2;0;−;'''tru;2;6;0;−;16;12;8;10;'''tru;0;−;1;13;0;−;0;0;'''tru;0;7;0;−;0;4;5;5;'''tru;0;0;5;9;7;9;0;−;'''tru;0;6;10;12;0;9;0;0
'''tsy;4;5;6;8;0;6;0;0;'''tsy;0;3;0;−;0;3;2;6;'''tsy;0;5;2;6;0;3;0;−;'''tsy;0;3;0;−;7;4;5;2;'''tsy;13;*9;5;4;3;2;0;0;'''tsy;0;31;0;0;1;2;5;1;'''tsy;0;4;0;−;1;1;3;2;'''tsy;1;3;0;−;3;3;3;2;'''tsy;1;3;6;6;3;6;0;0;'''tsy;0;3;0;−;1;1;2;9;'''tsy;2;3;9;4;1;5;0;−;'''tsy;1;2;0;−;2;3;1;4;'''tsy;0;2;0;9;0;−;0;−;'''tsy;0;4;0;−;0;2;3;3;'''tsy;0;0;6;18;2;3;0;0;'''tsy;29;12;1;4;0;3;0;−
'''ttr;4;*11;7;5;3;15;0;−;'''ttr;1;4;0;0;0;2;2;6;'''ttr;0;§8;3;7;1;*14;0;−;'''ttr;0;4;0;−;6;10;5;5;'''ttr;4;11;4;4;7;7;0;−;'''ttr;2;2;0;−;2;1;4;2;'''ttr;0;6;0;0;0;11;2;4;'''ttr;0;3;0;−;1;4;5;0;'''ttr;30;*10;5;43;8;*5;0;$5;'''ttr;0;35;0;1;1;19;5;13;'''ttr;19;*11;6;36;*8;*4;1;$8;'''ttr;0;15;0;2;3;18;1;6;'''ttr;0;$3;1;16;0;$4;0;0;'''ttr;0;5;0;−;0;3;3;8;'''ttr;0;$4;2;19;9;*5;1;4;'''ttr;0;5;4;7;0;6;0;−
'''vvi;5;5;7;13;5;10;0;0;'''vvi;2;5;0;1;1;1;4;5;'''vvi;3;2;7;1;4;3;0;−;'''vvi;3;5;0;1;6;19;9;5;'''vvi;3;6;5;8;3;7;0;0;'''vvi;8;7;0;−;1;2;9;5;'''vvi;3;2;0;−;0;5;1;9;'''vvi;4;6;0;−;4;2;5;4;'''vvi;1;8;11;11;12;13;0;2;'''vvi;16;20;0;−;3;1;9;1;'''vvi;7;11;11;5;3;2;0;−;'''vvi;1;3;0;0;6;4;8;6;'''vvi;0;0;0;18;0;−;0;3;'''vvi;5;2;0;0;2;0;4;8;'''vvi;0;0;5;5;9;0;0;0;'''vvi;2;6;11;11;4;9;0;1
'''xtr;*16;20;28;18;*11;22;0;0;'''xtr;§13;§8;0;−;15;13;*23;*11;'''xtr;*9;*5;§14;*8;18;8;0;−;'''xtr;§5;24;0;4;*23;38;§10;17;'''xtr;20;7;24;17;30;9;0;0;'''xtr;36;16;0;0;19;16;§17;17;'''xtr;25;7;0;2;2;5;20;12;'''xtr;15;9;1;0;17;14;20;17;'''xtr;7;*6;46;12;32;18;0;−;'''xtr;29;17;0;−;15;20;*4;16;'''xtr;*12;26;*18;14;*4;34;0;−;'''xtr;17;18;0;−;25;27;36;18;'''xtr;0;1;*3;47;0;0;0;−;'''xtr;22;18;1;1;13;9;23;16;'''xtr;0;0;§32;§22;21;11;0;1;'''xtr;11;34;40;17;6;15;0;1
'''zma;14;*16;31;17;36;*6;0;−;'''zma;8;5;5;4;4;1;7;12;'''zma;3;5;10;3;5;5;0;−;'''zma;1;3;0;−;31;47;32;36;'''zma;8;13;18;7;6;6;0;0;'''zma;13;17;0;−;5;3;11;3;'''zma;3;3;0;−;3;2;25;9;'''zma;4;4;0;−;10;2;19;9;'''zma;0;16;30;11;16;13;0;0;'''zma;8;6;0;−;11;10;34;31;'''zma;8;2;30;2;9;1;0;−;'''zma;2;1;$2;0;13;2;11;10;'''zma;0;−;3;17;0;3;0;−;'''zma;6;4;$5;$3;3;2;8;4;'''zma;0;−;10;14;20;6;0;0;'''zma;2;2;17;7;12;7;0;0
E79 codons. Les carrés[modifier | modifier le wikicode]
E79fe-tg;;db,dif;;différents;;mtri;;;E79be-tg;;db,dif;;doublons;;mtri;;;E79e-tg;;db,dif;;db + dif;;mtri;
ttt;23;tct;337;tat;30;tgt;35;;ttt;1;tct;506;tat;0;tgt;2;;ttt;24;tct;843;tat;30;tgt;37
ctt;317;cct;252;cat;14;cgt;299;;ctt;461;cct;577;cat;0;cgt;507;;ctt;778;cct;829;cat;14;cgt;806
att;488;act;545;aat;37;agt;37;;att;671;act;398;aat;5;agt;25;;att;1,159;act;943;aat;42;agt;62
gtt;418;gct;923;gat;38;ggt;60;;gtt;525;gct;731;gat;3;ggt;2;;gtt;943;gct;1,654;gat;41;ggt;62
ttc;472;tcc;31;tac;1,064;tgc;945;;ttc;645;tcc;28;tac;167;tgc;822;;ttc;1,117;tcc;59;tac;1,231;tgc;1,767
ctc;1;ccc;10;cac;319;cgc;8;;ctc;1;ccc;1;cac;631;cgc;2;;ctc;2;ccc;11;cac;950;cgc;10
atc;38;acc;26;aac;712;agc;442;;atc;6;acc;19;aac;801;agc;390;;atc;44;acc;45;aac;1,513;agc;832
gtc;23;gcc;37;gac;648;ggc;469;;gtc;7;gcc;8;gac;844;ggc;864;;gtc;30;gcc;45;gac;1,492;ggc;1,333
tta;416;tca;358;taa;32;tga;70;;tta;97;tca;142;taa;5;tga;7;;tta;513;tca;500;taa;37;tga;77
cta;288;cca;385;caa;546;cga;353;;cta;122;cca;531;caa;317;cga;177;;cta;410;cca;916;caa;863;cga;530
ata;395;aca;413;aaa;781;aga;495;;ata;91;aca;224;aaa;554;aga;108;;ata;486;aca;637;aaa;1,335;aga;603
gta;408;gca;686;gaa;547;gga;405;;gta;148;gca;336;gaa;550;gga;557;;gta;556;gca;1,022;gaa;1,097;gga;962
ttg;465;tcg;225;tag;54;tgg;469;;ttg;114;tcg;134;tag;1;tgg;389;;ttg;579;tcg;359;tag;55;tgg;858
ctg;286;ccg;115;cag;608;cgg;214;;ctg;346;ccg;211;cag;408;cgg;84;;ctg;632;ccg;326;cag;1,016;cgg;298
atg;1,152;acg;285;aag;725;agg;504;;atg;957;acg;118;aag;824;agg;212;;atg;2,109;acg;403;aag;1,549;agg;716
gtg;468;gcg;351;gag;625;ggg;286;;gtg;456;gcg;181;gag;697;ggg;221;;gtg;924;gcg;532;gag;1,322;ggg;507
;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;
E79ft-tg;;db,diff;;différents;;mtri+1;;;E79bt-tg;;db,diff;;doublons;;mtri+1;;;E79t-tg;;db,diff;;db + diff;;mtri+1;
ttt;50;tct;414;tat;57;tgt;66;;ttt;1;tct;506;tat;0;tgt;2;;ttt;51;tct;920;tat;57;tgt;68
ctt;396;cct;331;cat;36;cgt;377;;ctt;461;cct;577;cat;0;cgt;507;;ctt;857;cct;908;cat;36;cgt;884
att;567;act;623;aat;70;agt;55;;att;671;act;398;aat;5;agt;25;;att;1,238;act;1,021;aat;75;agt;80
gtt;497;gct;1,002;gat;73;ggt;78;;gtt;525;gct;731;gat;3;ggt;2;;gtt;1,022;gct;1,733;gat;76;ggt;80
ttc;550;tcc;58;tac;1,143;tgc;1,023;;ttc;645;tcc;28;tac;167;tgc;822;;ttc;1,195;tcc;86;tac;1,310;tgc;1,845
ctc;10;ccc;28;cac;397;cgc;22;;ctc;1;ccc;1;cac;631;cgc;2;;ctc;11;ccc;29;cac;1,028;cgc;24
atc;65;acc;49;aac;791;agc;520;;atc;6;acc;19;aac;801;agc;390;;atc;71;acc;68;aac;1,592;agc;910
gtc;60;gcc;61;gac;727;ggc;547;;gtc;7;gcc;8;gac;844;ggc;864;;gtc;67;gcc;69;gac;1,571;ggc;1,411
tta;495;tca;437;taa;70;tga;133;;tta;97;tca;142;taa;5;tga;7;;tta;592;tca;579;taa;75;tga;140
cta;364;cca;464;caa;625;cga;432;;cta;122;cca;531;caa;317;cga;177;;cta;486;cca;995;caa;942;cga;609
ata;473;aca;492;aaa;859;aga;574;;ata;91;aca;224;aaa;554;aga;108;;ata;564;aca;716;aaa;1,413;aga;682
gta;487;gca;764;gaa;626;gga;484;;gta;148;gca;336;gaa;550;gga;557;;gta;635;gca;1,100;gaa;1,176;gga;1,041
ttg;543;tcg;304;tag;80;tgg;547;;ttg;114;tcg;134;tag;1;tgg;389;;ttg;657;tcg;438;tag;81;tgg;936
ctg;365;ccg;194;cag;687;cgg;285;;ctg;346;ccg;211;cag;408;cgg;84;;ctg;711;ccg;405;cag;1,095;cgg;369
atg;1,231;acg;362;aag;803;agg;582;;atg;957;acg;118;aag;824;agg;212;;atg;2,188;acg;480;aag;1,627;agg;794
gtg;546;gcg;430;gag;704;ggg;361;;gtg;456;gcg;181;gag;697;ggg;221;;gtg;1,002;gcg;611;gag;1,401;ggg;582
;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;
E79f-tg;;db,diff;;différents;;excès;;;E79b-tg;;db,diff;;doublons;;excès;;;E79-tg;;total;;db + diff;;excès;
ttt;50;tct;414;tat;63;tgt;206;;ttt;1;tct;506;tat;0;tgt;10;;ttt;51;tct;920;tat;63;tgt;216
ctt;445;cct;331;cat;36;cgt;377;;ctt;491;cct;650;cat;0;cgt;543;;ctt;936;cct;981;cat;36;cgt;920
att;618;act;724;aat;108;agt;55;;att;850;act;477;aat;5;agt;25;;att;1,468;act;1,201;aat;113;agt;80
gtt;559;gct;1,319;gat;93;ggt;115;;gtt;594;gct;822;gat;3;ggt;2;;gtt;1,153;gct;2,141;gat;96;ggt;117
ttc;550;tcc;127;tac;1,157;tgc;1,387;;ttc;645;tcc;42;tac;307;tgc;887;;ttc;1,195;tcc;169;tac;1,464;tgc;2,274
ctc;10;ccc;28;cac;397;cgc;32;;ctc;1;ccc;1;cac;631;cgc;2;;ctc;11;ccc;29;cac;1,028;cgc;34
atc;68;acc;62;aac;846;agc;632;;atc;6;acc;25;aac;942;agc;443;;atc;74;acc;87;aac;1,788;agc;1,075
gtc;72;gcc;242;gac;794;ggc;647;;gtc;27;gcc;8;gac;1,070;ggc;916;;gtc;99;gcc;250;gac;1,864;ggc;1,563
tta;495;tca;482;taa;164;tga;230;;tta;97;tca;178;taa;5;tga;7;;tta;592;tca;660;taa;169;tga;237
cta;364;cca;523;caa;1,436;cga;1,697;;cta;122;cca;531;caa;360;cga;241;;cta;486;cca;1,054;caa;1,796;cga;1,938
ata;473;aca;674;aaa;1,168;aga;978;;ata;153;aca;295;aaa;589;aga;193;;ata;626;aca;969;aaa;1,757;aga;1,171
gta;582;gca;3,813;gaa;5,790;gga;4,453;;gta;148;gca;3,200;gaa;601;gga;682;;gta;730;gca;7,013;gaa;6,391;gga;5,135
ttg;543;tcg;348;tag;107;tgg;1,155;;ttg;114;tcg;134;tag;1;tgg;430;;ttg;657;tcg;482;tag;108;tgg;1,585
ctg;417;ccg;233;cag;687;cgg;285;;ctg;368;ccg;211;cag;515;cgg;84;;ctg;785;ccg;444;cag;1,202;cgg;369
atg;1,231;acg;491;aag;3,320;agg;823;;atg;1,387;acg;118;aag;950;agg;212;;atg;2,618;acg;609;aag;4,270;agg;1,035
gtg;2,108;gcg;4,178;gag;2,154;ggg;6,221;;gtg;494;gcg;308;gag;697;ggg;444;;gtg;2,602;gcg;4,486;gag;2,851;ggg;6,665
;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;
E79fr-tg;;résonance;;différents;;excès − (mtr+1);;;E79br-tg;;résonance;;doublons;;excès − (mtr+1);;;E79r-tg;;résonance;;total;;excès − (mtr+1);
ttt;0;tct;0;tat;6;tgt;140;;ttt;0;tct;0;tat;0;tgt;8;;ttt;0;tct;0;tat;6;tgt;148
ctt;49;cct;0;cat;0;cgt;0;;ctt;30;cct;73;cat;0;cgt;36;;ctt;79;cct;73;cat;0;cgt;36
att;51;act;101;aat;38;agt;0;;att;179;act;79;aat;0;agt;0;;att;230;act;180;aat;38;agt;0
gtt;62;gct;317;gat;20;ggt;37;;gtt;69;gct;91;gat;0;ggt;0;;gtt;131;gct;408;gat;20;ggt;37
ttc;0;tcc;69;tac;14;tgc;364;;ttc;0;tcc;14;tac;140;tgc;65;;ttc;0;tcc;83;tac;154;tgc;429
ctc;0;ccc;0;cac;0;cgc;10;;ctc;0;ccc;0;cac;0;cgc;0;;ctc;0;ccc;0;cac;0;cgc;10
atc;3;acc;13;aac;55;agc;112;;atc;0;acc;6;aac;141;agc;53;;atc;3;acc;19;aac;196;agc;165
gtc;12;gcc;181;gac;67;ggc;100;;gtc;20;gcc;0;gac;226;ggc;52;;gtc;32;gcc;181;gac;293;ggc;152
tta;0;tca;45;taa;94;tga;97;;tta;0;tca;36;taa;0;tga;0;;tta;0;tca;81;taa;94;tga;97
cta;0;cca;59;caa;811;cga;1265;;cta;0;cca;0;caa;43;cga;64;;cta;0;cca;59;caa;854;cga;1329
ata;0;aca;182;aaa;309;aga;404;;ata;62;aca;71;aaa;35;aga;85;;ata;62;aca;253;aaa;344;aga;489
gta;95;gca;3049;gaa;5164;gga;3969;;gta;0;gca;2864;gaa;51;gga;125;;gta;95;gca;5913;gaa;5215;gga;4094
ttg;0;tcg;44;tag;27;tgg;608;;ttg;0;tcg;0;tag;0;tgg;41;;ttg;0;tcg;44;tag;27;tgg;649
ctg;52;ccg;39;cag;0;cgg;0;;ctg;22;ccg;0;cag;107;cgg;0;;ctg;74;ccg;39;cag;107;cgg;0
atg;0;acg;129;aag;2517;agg;241;;atg;430;acg;0;aag;126;agg;0;;atg;430;acg;129;aag;2643;agg;241
gtg;1562;gcg;3748;gag;1450;ggg;5860;;gtg;38;gcg;127;gag;0;ggg;223;;gtg;1600;gcg;3875;gag;1450;ggg;6083
;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;
79of-tg;;duplications;;différents;;;excès-1;;E79bo-tg;;duplications;;doublons;;;excès-1;;E79o-tg;;duplications;;total;;;excès-1
ttt;23;tct;337;tat;36;tgt;175;;ttt;1;tct;506;tat;0;tgt;10;;ttt;24;tct;843;tat;36;tgt;185
ctt;366;cct;252;cat;14;cgt;299;;ctt;491;cct;650;cat;0;cgt;543;;ctt;857;cct;902;cat;14;cgt;842
att;539;act;646;aat;75;agt;37;;att;850;act;477;aat;5;agt;25;;att;1,389;act;1,123;aat;80;agt;62
gtt;480;gct;1,240;gat;58;ggt;97;;gtt;594;gct;822;gat;3;ggt;2;;gtt;1,074;gct;2,062;gat;61;ggt;99
ttc;472;tcc;100;tac;1,078;tgc;1,309;;ttc;645;tcc;42;tac;307;tgc;887;;ttc;1,117;tcc;142;tac;1,385;tgc;2,196
ctc;1;ccc;10;cac;319;cgc;18;;ctc;1;ccc;1;cac;631;cgc;2;;ctc;2;ccc;11;cac;950;cgc;20
atc;41;acc;39;aac;767;agc;554;;atc;6;acc;25;aac;942;agc;443;;atc;47;acc;64;aac;1,709;agc;997
gtc;35;gcc;218;gac;715;ggc;569;;gtc;27;gcc;8;gac;1,070;ggc;916;;gtc;62;gcc;226;gac;1,785;ggc;1,485
tta;416;tca;403;taa;126;tga;167;;tta;97;tca;178;taa;5;tga;7;;tta;513;tca;581;taa;131;tga;174
cta;288;cca;444;caa;1,357;cga;1,618;;cta;122;cca;531;caa;360;cga;241;;cta;410;cca;975;caa;1,717;cga;1,859
ata;395;aca;595;aaa;1,090;aga;899;;ata;153;aca;295;aaa;589;aga;193;;ata;548;aca;890;aaa;1,679;aga;1,092
gta;503;gca;3,735;gaa;5,711;gga;4,374;;gta;148;gca;3,200;gaa;601;gga;682;;gta;651;gca;6,935;gaa;6,312;gga;5,056
ttg;465;tcg;269;tag;81;tgg;1,077;;ttg;114;tcg;134;tag;1;tgg;430;;ttg;579;tcg;403;tag;82;tgg;1,507
ctg;338;ccg;154;cag;608;cgg;214;;ctg;368;ccg;211;cag;515;cgg;84;;ctg;706;ccg;365;cag;1,123;cgg;298
atg;1,152;acg;414;aag;3,242;agg;745;;atg;1,387;acg;118;aag;950;agg;212;;atg;2,539;acg;532;aag;4,192;agg;957
gtg;2,030;gcg;4,099;gag;2,075;ggg;6,146;;gtg;494;gcg;308;gag;697;ggg;444;;gtg;2,524;gcg;4,407;gag;2,772;ggg;6,590
;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;
E79z-tg;;zéros;−;;;;zéros;;E79ei-tg;;indice;mtri;doublons/différents;;;;;E79ec-tg;;corel;mtri;;;corrélation;
ttt;52;tct;2;tat;52;tgt;48;;ttt;0.04;tct;1.50;tat;0.00;tgt;0.06;;ttt;0.42;tct;0.41;tat;−;tgt;0.47
ctt;0;cct;0;cat;57;cgt;1;;ctt;1.45;cct;2.29;cat;0.00;cgt;1.70;;ctt;0.39;cct;0.56;cat;−;cgt;0.39
att;0;act;1;aat;46;agt;61;;att;1.38;act;0.73;aat;0.14;agt;0.68;;att;0.26;act;0.25;aat;0.40;agt;0.78
gtt;0;gct;0;gat;44;ggt;61;;gtt;1.26;gct;0.79;gat;0.08;ggt;0.03;;gtt;0.19;gct;0.06;gat;0.37;ggt;0.50
ttc;1;tcc;52;tac;0;tgc;1;;ttc;1.37;tcc;0.90;tac;0.16;tgc;0.87;;ttc;0.40;tcc;0.65;tac;-0.02;tgc;0.37
ctc;70;ccc;61;cac;1;cgc;65;;ctc;1.00;ccc;0.10;cac;1.98;cgc;0.25;;ctc;-0.13;ccc;-0.10;cac;0.46;cgc;-0.19
atc;52;acc;56;aac;0;agc;1;;atc;0.16;acc;0.73;aac;1.13;agc;0.88;;atc;-0.08;acc;0.49;aac;0.23;agc;0.14
gtc;42;gcc;55;gac;0;ggc;1;;gtc;0.30;gcc;0.22;gac;1.30;ggc;1.84;;gtc;0.18;gcc;0.72;gac;0.03;ggc;0.13
tta;0;tca;0;taa;41;tga;16;;tta;0.23;tca;0.40;taa;0.16;tga;0.10;;tta;0.35;tca;0.49;taa;0.28;tga;0.24
cta;3;cca;0;caa;0;cga;0;;cta;0.42;cca;1.38;caa;0.58;cga;0.50;;cta;0.29;cca;0.26;caa;0.16;cga;0.09
ata;1;aca;0;aaa;1;aga;0;;ata;0.23;aca;0.54;aaa;0.71;aga;0.22;;ata;0.53;aca;0.27;aaa;0.29;aga;-0.06
gta;0;gca;1;gaa;0;gga;0;;gta;0.36;gca;0.49;gaa;1.01;gga;1.38;;gta;0.48;gca;0.10;gaa;0.22;gga;0.30
ttg;1;tcg;0;tag;53;tgg;1;;ttg;0.25;tcg;0.60;tag;0.02;tgg;0.83;;ttg;0.36;tcg;0.42;tag;-0.14;tgg;-0.05
ctg;0;ccg;0;cag;0;cgg;8;;ctg;1.21;ccg;1.83;cag;0.67;cgg;0.39;;ctg;0.45;ccg;0.77;cag;0.18;cgg;0.23
atg;0;acg;2;aag;1;agg;1;;atg;0.83;acg;0.41;aag;1.14;agg;0.42;;atg;0.65;acg;0.43;aag;-0.03;agg;0.11
gtg;1;gcg;0;gag;0;ggg;4;;gtg;0.97;gcg;0.52;gag;1.12;ggg;0.77;;gtg;0.36;gcg;0.23;gag;0.14;ggg;0.08
Zebra codons. Les carrés[modifier | modifier le wikicode]
E79fz-tg;;db,dif;;différents;;;;;E79bz-tg;;db,dif;;doublons;;;;;E79zi;;indice;;doublons/différents;;;
ttt;9;tct;175;tat;3;tgt;8;;ttt;0;tct;160;tat;1;tgt;0;;ttt;0;tct;0.91;tat;0.33;tgt;0
ctt;145;cct;137;cat;−;cgt;55;;ctt;124;cct;177;cat;−;cgt;147;;ctt;0.86;cct;1.29;cat;−;cgt;2.67
att;128;act;181;aat;14;agt;10;;att;129;act;177;aat;9;agt;3;;att;1.01;act;0.98;aat;0.64;agt;0.30
gtt;85;gct;25;gat;6;ggt;10;;gtt;146;gct;66;gat;4;ggt;0;;gtt;1.72;gct;2.64;gat;0.67;ggt;0
ttc;86;tcc;1;tac;99;tgc;37;;ttc;110;tcc;0;tac;136;tgc;98;;ttc;1.28;tcc;0;tac;1.37;tgc;2.65
ctc;1;ccc;7;cac;162;cgc;6;;ctc;2;ccc;4;cac;224;cgc;17;;ctc;2.00;ccc;0.57;cac;1.38;cgc;2.83
atc;8;acc;−;aac;469;agc;262;;atc;1;acc;−;aac;575;agc;161;;atc;0.13;acc;−;aac;1.23;agc;0.61
gtc;3;gcc;2;gac;42;ggc;444;;gtc;2;gcc;1;gac;107;ggc;391;;gtc;0.67;gcc;0.50;gac;2.55;ggc;0.88
tta;53;tca;116;taa;4;tga;11;;tta;19;tca;92;taa;1;tga;2;;tta;0.36;tca;0.79;taa;0.25;tga;0.18
cta;133;cca;96;caa;45;cga;49;;cta;110;cca;108;caa;59;cga;57;;cta;0.83;cca;1.13;caa;1.31;cga;1.16
ata;52;aca;138;aaa;249;aga;138;;ata;22;aca;151;aaa;275;aga;113;;ata;0.42;aca;1.09;aaa;1.10;aga;0.82
gta;58;gca;102;gaa;96;gga;22;;gta;171;gca;265;gaa;128;gga;24;;gta;2.95;gca;2.60;gaa;1.33;gga;1.09
ttg;117;tcg;43;tag;5;tgg;21;;ttg;123;tcg;36;tag;3;tgg;22;;ttg;1.05;tcg;0.84;tag;0.60;tgg;1.05
ctg;138;ccg;90;cag;122;cgg;34;;ctg;161;ccg;89;cag;143;cgg;24;;ctg;1.17;ccg;0.99;cag;1.17;cgg;0.71
atg;173;acg;41;aag;462;agg;28;;atg;348;acg;24;aag;490;agg;75;;atg;2.01;acg;0.59;aag;1.06;agg;2.68
gtg;95;gcg;25;gag;86;ggg;180;;gtg;131;gcg;86;gag;158;ggg;87;;gtg;1.38;gcg;3.44;gag;1.84;ggg;0.48

C42-Codons. Correlations et indices des doublons[modifier | modifier le wikicode]

C42;double;aaa;double;aac;double;aag;double;aat;C42;double;aca;double;acc;double;acg;double;act;C42;double;aga;double;agc;double;agg;double;agt;C42;double;ata;double;atc;double;atg;double;att;C42;double;caa;double;cac;double;cag;double;cat;C42;double;cca;double;ccc;double;ccg;double;cct;C42;double;cga;double;cgc;double;cgg;double;cgt;C42;double;cta;double;ctc;double;ctg;double;ctt;C42;double;gaa;double;gac;double;gag;double;gat;C42;double;gca;double;gcc;double;gcg;double;gct;C42;double;gga;double;ggc;double;ggg;double;ggt;C42;double;gta;double;gtc;double;gtg;double;gtt;C42;double;taa;double;tac;double;tag;double;tat;C42;double;tca;double;tcc;double;tcg;double;tct;C42;double;tga;double;tgc;double;tgg;double;tgt;C42;double;tta;double;ttc;double;ttg;double;ttt
'''ani;0;1;0;5;7;0;0;−;'''ani;0;1;0;−;0;1;4;1;'''ani;1;0;0;3;0;1;0;−;'''ani;0;0;0;−;2;4;2;4;'''ani;0;1;3;1;1;3;0;−;'''ani;0;1;0;−;0;1;1;4;'''ani;0;1;0;−;0;1;6;2;'''ani;0;1;0;−;0;2;0;5;'''ani;0;2;2;5;5;2;0;−;'''ani;0;1;0;−;2;0;7;0;'''ani;0;2;10;0;0;0;0;−;'''ani;0;0;0;−;0;1;6;1;'''ani;0;−;1;4;0;−;0;−;'''ani;0;0;0;−;0;1;4;0;'''ani;0;−;1;1;2;0;0;−;'''ani;0;0;2;2;0;1;0;−
'''aor;0;2;4;3;8;2;0;−;'''aor;0;1;0;−;0;1;8;1;'''aor;0;1;1;4;0;1;0;−;'''aor;0;1;0;−;0;7;5;4;'''aor;1;2;1;6;3;3;0;−;'''aor;0;2;0;−;0;−;3;5;'''aor;1;0;0;−;0;2;10;1;'''aor;0;0;0;−;0;3;0;−;'''aor;1;4;5;7;8;2;0;−;'''aor;1;1;0;−;1;2;8;1;'''aor;2;1;14;0;0;0;0;−;'''aor;0;1;0;0;0;2;8;1;'''aor;0;−;2;10;0;−;0;0;'''aor;0;0;0;−;0;2;4;2;'''aor;0;−;0;3;3;0;0;0;'''aor;0;2;1;5;0;−;0;−
'''bfu;0;2;1;4;1;8;0;−;'''bfu;0;2;0;−;0;−;2;3;'''bfu;0;4;0;4;0;0;0;−;'''bfu;0;0;0;−;3;4;0;7;'''bfu;2;3;0;3;0;1;0;−;'''bfu;0;7;0;−;0;0;0;3;'''bfu;1;2;0;−;0;1;1;4;'''bfu;0;0;0;−;0;0;1;4;'''bfu;0;5;3;5;0;8;0;−;'''bfu;0;4;0;−;0;1;7;0;'''bfu;3;3;0;7;0;1;0;0;'''bfu;0;1;0;−;0;1;0;7;'''bfu;0;−;1;4;0;−;0;−;'''bfu;1;2;0;−;0;1;6;0;'''bfu;0;−;0;4;4;1;0;−;'''bfu;0;1;2;4;0;4;0;−
'''cal;3;1;0;2;0;1;0;−;'''cal;1;0;0;−;0;0;2;1;'''cal;4;0;0;1;0;0;0;−;'''cal;0;0;0;−;2;1;0;5;'''cal;0;4;0;2;0;0;0;−;'''cal;0;3;0;−;0;−;0;0;'''cal;0;−;0;−;0;0;0;1;'''cal;0;−;0;−;0;0;0;1;'''cal;1;4;5;0;0;0;0;−;'''cal;0;1;0;−;0;−;5;0;'''cal;1;0;4;0;0;0;0;−;'''cal;0;0;0;−;0;0;3;2;'''cal;0;−;0;3;0;−;0;−;'''cal;1;1;0;−;0;0;3;0;'''cal;0;−;0;1;0;1;0;−;'''cal;3;1;1;3;1;4;0;−
'''cgr;2;0;6;2;11;0;0;−;'''cgr;2;0;0;−;0;0;8;0;'''cgr;8;0;1;1;0;0;0;−;'''cgr;0;1;0;−;5;1;8;0;'''cgr;5;0;4;1;1;0;0;−;'''cgr;5;1;0;−;0;−;0;0;'''cgr;0;−;0;−;0;0;3;0;'''cgr;3;0;0;0;0;−;0;−;'''cgr;8;0;8;0;2;0;0;−;'''cgr;4;0;0;−;0;−;9;0;'''cgr;1;0;11;0;0;0;0;−;'''cgr;0;1;0;−;0;0;9;0;'''cgr;0;−;5;0;0;−;0;−;'''cgr;1;0;0;−;0;0;8;0;'''cgr;0;−;2;0;0;4;0;−;'''cgr;2;0;5;0;3;4;0;−
'''cjd;2;2;5;1;7;0;0;−;'''cjd;1;1;0;−;0;0;5;0;'''cjd;5;1;2;0;0;−;0;−;'''cjd;0;0;0;0;3;3;5;0;'''cjd;5;0;4;1;0;1;0;−;'''cjd;6;0;0;−;0;−;0;−;'''cjd;0;−;0;−;0;0;3;2;'''cjd;1;1;0;−;0;0;3;0;'''cjd;3;1;5;2;8;0;0;−;'''cjd;1;1;0;−;0;−;5;0;'''cjd;2;1;10;0;0;0;0;−;'''cjd;0;1;0;−;2;0;7;1;'''cjd;0;−;2;3;0;−;0;−;'''cjd;0;2;0;−;0;0;6;0;'''cjd;0;0;1;1;3;0;0;−;'''cjd;0;0;4;3;6;0;0;−
'''cneg;0;0;0;3;5;1;0;−;'''cneg;0;0;0;−;0;0;0;4;'''cneg;0;0;0;1;0;2;0;−;'''cneg;0;0;0;−;1;5;1;4;'''cneg;0;1;0;3;2;0;0;−;'''cneg;0;0;0;−;0;0;0;5;'''cneg;4;0;0;−;0;0;0;2;'''cneg;0;−;0;−;0;0;2;3;'''cneg;0;2;0;1;0;9;0;−;'''cneg;0;0;0;−;0;1;0;7;'''cneg;1;1;4;4;0;1;0;−;'''cneg;0;−;0;−;0;1;1;5;'''cneg;0;−;0;3;0;−;0;−;'''cneg;0;0;0;−;0;0;1;4;'''cneg;0;−;0;2;0;2;0;−;'''cneg;0;0;0;4;0;2;0;−
'''cot;3;0;2;0;0;2;0;−;'''cot;1;0;0;−;0;0;3;0;'''cot;1;0;0;0;0;0;0;−;'''cot;0;0;0;−;0;3;3;0;'''cot;0;2;0;0;0;0;0;−;'''cot;0;2;0;−;0;−;0;0;'''cot;0;−;0;−;0;0;0;1;'''cot;0;−;0;−;0;0;0;0;'''cot;0;1;4;0;0;0;0;−;'''cot;1;0;0;−;0;−;2;0;'''cot;0;0;1;0;0;−;0;−;'''cot;0;0;0;−;0;0;2;1;'''cot;0;−;1;1;0;−;0;−;'''cot;0;1;0;−;0;0;0;1;'''cot;0;−;0;−;0;0;0;−;'''cot;2;0;0;1;0;0;0;−
'''dha;5;2;7;1;6;3;0;−;'''dha;0;2;0;−;0;0;6;1;'''dha;7;2;1;1;0;0;0;−;'''dha;0;1;0;0;1;8;8;0;'''dha;5;1;4;1;0;0;0;−;'''dha;2;4;0;−;0;−;0;0;'''dha;0;−;0;−;0;0;3;1;'''dha;0;0;0;−;0;0;0;1;'''dha;7;1;8;1;0;0;0;−;'''dha;3;1;0;−;0;0;6;0;'''dha;2;2;10;0;0;0;0;−;'''dha;0;1;0;−;0;0;8;1;'''dha;0;−;3;2;0;−;0;−;'''dha;1;2;0;−;0;0;5;0;'''dha;0;0;3;0;3;0;0;−;'''dha;8;1;5;3;3;0;0;−
'''ecu;0;0;0;1;0;0;0;−;'''ecu;0;0;0;−;0;0;0;0;'''ecu;0;0;0;0;0;0;0;−;'''ecu;0;0;0;−;0;1;0;0;'''ecu;0;0;0;0;0;0;0;−;'''ecu;0;0;0;−;0;0;0;0;'''ecu;0;0;0;−;0;−;0;0;'''ecu;0;0;0;−;0;0;0;0;'''ecu;0;0;0;0;0;0;0;−;'''ecu;0;0;0;−;0;0;0;0;'''ecu;0;0;0;0;0;0;0;−;'''ecu;0;0;0;−;0;0;0;0;'''ecu;0;−;0;0;0;−;0;−;'''ecu;0;0;0;−;0;0;0;0;'''ecu;0;−;0;0;0;0;0;−;'''ecu;0;0;0;0;0;0;0;−
'''ede;0;0;0;0;0;−;0;−;'''ede;0;0;0;−;0;0;0;1;'''ede;0;−;0;0;0;0;0;−;'''ede;0;0;0;−;0;1;0;1;'''ede;0;0;0;1;0;0;0;−;'''ede;0;0;0;−;0;0;0;−;'''ede;0;1;0;−;0;0;0;1;'''ede;0;0;0;0;0;0;0;0;'''ede;0;0;0;1;0;1;0;−;'''ede;0;0;0;−;0;0;0;1;'''ede;0;0;0;1;0;1;0;−;'''ede;0;0;0;−;0;0;0;1;'''ede;0;−;0;0;0;−;0;−;'''ede;0;0;0;−;0;0;0;0;'''ede;0;0;0;0;0;−;0;−;'''ede;0;0;0;0;0;0;0;−
'''fgr;0;2;3;5;12;3;0;−;'''fgr;1;2;0;−;1;1;7;3;'''fgr;0;2;1;6;0;2;0;−;'''fgr;0;2;0;−;0;5;8;4;'''fgr;0;4;2;4;6;0;0;−;'''fgr;0;2;0;−;0;1;4;5;'''fgr;2;6;0;−;0;0;8;1;'''fgr;0;1;0;−;2;2;11;1;'''fgr;1;3;13;0;12;6;0;−;'''fgr;0;3;0;−;0;1;5;8;'''fgr;0;5;2;11;0;0;0;−;'''fgr;0;1;0;−;0;2;11;7;'''fgr;0;−;4;3;0;−;0;−;'''fgr;0;1;0;−;0;1;5;5;'''fgr;0;0;2;2;0;3;0;−;'''fgr;0;1;3;7;0;2;0;−
'''fgr5;0;1;4;4;8;3;0;−;'''fgr5;1;2;0;−;1;1;7;3;'''fgr5;0;2;1;6;0;2;0;−;'''fgr5;0;2;0;−;0;4;6;4;'''fgr5;0;4;2;4;6;0;0;−;'''fgr5;0;2;0;−;0;1;4;5;'''fgr5;2;6;0;−;0;0;8;1;'''fgr5;0;1;0;−;2;2;5;0;'''fgr5;1;2;9;0;8;4;0;−;'''fgr5;0;2;0;−;0;2;4;8;'''fgr5;0;4;2;12;0;0;0;−;'''fgr5;0;1;0;−;0;2;10;5;'''fgr5;0;−;3;2;0;−;0;−;'''fgr5;0;1;0;−;0;1;5;5;'''fgr5;0;0;2;2;0;3;0;−;'''fgr5;0;0;2;6;0;2;0;−
'''fve;0;5;4;7;2;8;0;0;'''fve;0;2;0;−;2;1;0;6;'''fve;0;1;3;0;2;3;0;−;'''fve;0;1;0;−;8;6;9;1;'''fve;0;3;0;6;0;5;0;−;'''fve;1;2;0;−;0;1;0;3;'''fve;4;3;0;−;0;1;2;10;'''fve;0;1;0;−;1;0;2;3;'''fve;1;4;0;6;1;10;0;0;'''fve;3;5;0;−;3;1;10;2;'''fve;4;4;0;10;1;6;0;−;'''fve;0;2;0;−;1;1;5;1;'''fve;0;−;0;5;0;−;0;−;'''fve;0;1;0;−;0;2;3;3;'''fve;0;−;0;3;0;3;0;−;'''fve;0;0;0;14;0;3;0;1
'''fvr;0;1;3;4;10;4;0;0;'''fvr;1;2;0;−;0;1;4;6;'''fvr;0;1;1;5;0;1;0;−;'''fvr;0;0;0;−;2;5;4;6;'''fvr;0;3;1;4;6;1;0;−;'''fvr;0;2;0;−;0;1;1;8;'''fvr;1;5;0;−;0;0;8;1;'''fvr;0;1;0;−;1;3;7;4;'''fvr;0;4;13;0;4;11;0;0;'''fvr;1;1;0;−;1;1;1;12;'''fvr;3;1;11;2;0;0;0;−;'''fvr;0;1;0;−;0;2;11;1;'''fvr;0;−;1;6;0;−;0;−;'''fvr;0;1;0;−;0;2;6;3;'''fvr;0;−;1;3;0;4;0;−;'''fvr;0;1;1;8;0;3;0;−
'''kaf;1;6;9;0;11;0;0;−;'''kaf;2;0;0;−;0;0;8;2;'''kaf;9;1;2;1;0;0;0;−;'''kaf;0;1;0;−;5;3;12;0;'''kaf;7;1;5;0;0;0;0;−;'''kaf;1;8;0;−;0;−;0;0;'''kaf;0;−;0;−;0;0;2;1;'''kaf;0;1;0;−;0;−;0;1;'''kaf;14;0;12;0;1;0;0;−;'''kaf;3;1;0;−;0;−;11;0;'''kaf;1;2;16;0;0;0;0;−;'''kaf;0;1;0;−;0;0;11;1;'''kaf;0;−;6;2;0;−;0;−;'''kaf;3;0;0;−;0;0;8;2;'''kaf;0;−;4;0;4;1;0;−;'''kaf;11;2;2;6;0;1;0;−
'''kpa;0;2;3;0;3;1;0;−;'''kpa;0;0;0;−;0;0;3;1;'''kpa;2;1;0;1;0;0;0;−;'''kpa;0;0;0;−;1;2;4;0;'''kpa;2;0;2;0;0;1;0;−;'''kpa;3;0;0;−;0;0;1;0;'''kpa;0;0;0;−;0;0;0;1;'''kpa;0;0;0;−;0;1;0;1;'''kpa;3;1;5;0;3;0;0;−;'''kpa;1;0;0;−;0;−;4;0;'''kpa;0;2;3;1;0;0;0;−;'''kpa;0;0;0;−;0;0;3;1;'''kpa;0;−;0;3;0;−;0;−;'''kpa;1;0;0;−;0;0;3;0;'''kpa;0;−;1;0;1;1;0;−;'''kpa;0;0;4;0;0;2;0;−
'''kla;2;1;5;0;7;1;0;−;'''kla;1;0;0;−;0;0;5;0;'''kla;5;1;0;1;0;0;0;−;'''kla;0;0;0;−;3;2;6;0;'''kla;3;2;3;0;0;0;0;−;'''kla;1;5;0;−;0;−;0;0;'''kla;0;−;0;−;0;0;2;0;'''kla;0;1;0;0;0;−;0;−;'''kla;7;0;7;0;1;0;0;−;'''kla;2;0;0;−;0;−;6;0;'''kla;0;1;6;0;0;0;0;−;'''kla;0;0;0;−;0;1;6;0;'''kla;0;−;4;0;0;−;0;−;'''kla;1;0;0;−;0;0;5;0;'''kla;0;−;2;0;1;2;0;−;'''kla;1;1;4;0;4;2;0;−
'''kna;1;2;5;0;6;0;0;−;'''kna;0;1;0;−;0;0;6;0;'''kna;4;1;2;0;0;0;0;−;'''kna;0;1;0;−;2;1;6;0;'''kna;3;0;3;0;0;1;0;−;'''kna;2;3;0;−;0;−;0;0;'''kna;0;−;0;−;0;0;1;1;'''kna;1;1;0;−;0;−;0;0;'''kna;4;1;6;1;2;0;0;−;'''kna;0;0;0;−;0;0;4;2;'''kna;0;0;7;1;1;0;0;−;'''kna;0;0;0;−;0;1;6;0;'''kna;0;−;1;3;0;−;0;−;'''kna;0;0;0;−;0;0;6;0;'''kna;0;−;1;2;0;3;0;−;'''kna;2;0;1;4;2;2;0;−
'''lkl;1;3;8;0;13;0;0;−;'''lkl;1;0;0;−;0;0;9;2;'''lkl;10;1;0;3;0;0;0;−;'''lkl;0;0;0;−;8;1;10;1;'''lkl;8;1;5;0;0;0;0;−;'''lkl;5;4;0;0;0;−;0;0;'''lkl;0;−;0;−;0;0;4;0;'''lkl;0;2;0;0;0;−;0;−;'''lkl;12;0;12;0;1;1;0;−;'''lkl;3;0;0;−;0;−;11;1;'''lkl;1;0;14;0;1;0;0;−;'''lkl;0;0;0;−;2;0;13;0;'''lkl;0;−;0;6;0;−;0;−;'''lkl;1;0;0;−;0;0;4;6;'''lkl;0;−;3;1;1;3;0;−;'''lkl;2;0;4;3;4;6;0;−
'''lth;2;1;6;0;13;1;0;−;'''lth;0;1;0;−;0;0;7;1;'''lth;6;2;0;2;0;0;0;−;'''lth;0;0;0;−;4;3;9;0;'''lth;2;2;2;2;4;0;0;−;'''lth;1;6;0;−;0;−;1;0;'''lth;0;−;0;−;0;0;2;1;'''lth;0;2;1;0;0;2;0;−;'''lth;4;1;9;0;8;2;0;−;'''lth;0;2;0;−;0;1;9;0;'''lth;2;0;13;1;0;1;0;−;'''lth;0;0;0;−;2;0;9;1;'''lth;0;−;1;4;0;−;0;−;'''lth;1;0;0;−;0;1;8;0;'''lth;0;−;2;1;2;2;0;−;'''lth;1;0;0;6;1;6;0;−
'''mfa;2;3;8;3;8;1;0;−;'''mfa;3;0;0;−;1;0;9;0;'''mfa;9;0;3;2;1;0;0;−;'''mfa;1;2;0;−;5;4;10;1;'''mfa;6;1;7;0;3;0;0;−;'''mfa;2;5;0;−;0;−;1;0;'''mfa;0;−;0;−;1;0;1;2;'''mfa;0;−;0;−;1;0;2;1;'''mfa;6;1;13;0;6;1;0;−;'''mfa;6;1;0;−;1;0;10;1;'''mfa;4;1;15;0;1;0;0;−;'''mfa;1;0;0;−;2;1;10;1;'''mfa;0;−;8;1;0;−;0;−;'''mfa;3;0;0;−;1;0;7;2;'''mfa;0;−;2;1;5;0;0;−;'''mfa;2;1;9;0;12;1;0;−
'''mgr;1;0;0;5;2;6;0;−;'''mgr;0;1;0;−;0;1;1;4;'''mgr;0;0;0;2;0;2;0;−;'''mgr;0;0;0;−;2;5;0;7;'''mgr;0;1;3;0;0;5;0;−;'''mgr;0;1;0;−;0;1;1;3;'''mgr;0;1;0;−;0;1;0;5;'''mgr;0;0;0;−;0;3;1;5;'''mgr;1;1;5;4;0;8;0;−;'''mgr;0;2;0;−;0;1;0;8;'''mgr;0;2;0;13;0;2;0;−;'''mgr;0;0;0;−;0;1;0;5;'''mgr;0;−;0;4;0;−;0;−;'''mgr;0;1;0;−;0;2;0;3;'''mgr;0;−;0;2;3;0;0;−;'''mgr;0;0;2;4;0;1;0;−
'''mth;1;1;4;1;0;8;0;−;'''mth;0;1;0;−;0;2;1;4;'''mth;0;0;0;4;0;1;0;−;'''mth;0;0;0;0;1;6;0;7;'''mth;0;1;0;3;0;4;0;−;'''mth;0;1;0;−;0;2;0;5;'''mth;0;0;0;−;0;1;0;6;'''mth;0;0;0;−;0;3;0;6;'''mth;0;1;0;9;0;7;0;−;'''mth;0;1;0;−;0;2;0;6;'''mth;1;2;9;1;0;1;0;−;'''mth;0;1;0;−;0;2;4;2;'''mth;0;−;2;3;0;−;0;−;'''mth;0;2;0;−;1;1;1;3;'''mth;0;0;1;1;1;2;0;−;'''mth;0;0;1;3;0;1;0;−
'''ncr;0;1;9;2;20;3;0;−;'''ncr;0;2;0;−;0;2;9;2;'''ncr;1;3;0;5;1;3;0;−;'''ncr;0;0;0;0;9;7;0;16;'''ncr;0;2;3;5;1;9;0;−;'''ncr;1;2;0;−;0;3;8;3;'''ncr;0;1;0;−;1;1;19;1;'''ncr;0;1;0;−;0;5;2;14;'''ncr;3;1;10;7;12;11;0;−;'''ncr;0;2;0;−;0;4;6;12;'''ncr;2;1;24;1;0;5;0;−;'''ncr;0;1;0;−;0;3;18;0;'''ncr;0;−;4;5;0;0;0;−;'''ncr;0;2;0;−;1;2;12;1;'''ncr;0;−;5;1;5;1;0;−;'''ncr;0;0;8;3;0;4;0;−
'''ncs;2;5;8;1;13;0;0;−;'''ncs;1;1;0;−;0;1;10;0;'''ncs;9;0;1;2;0;0;0;−;'''ncs;0;1;0;−;7;1;11;0;'''ncs;8;0;7;0;0;0;0;−;'''ncs;2;7;0;−;0;−;0;0;'''ncs;0;−;0;−;0;1;3;1;'''ncs;0;2;0;−;0;−;0;1;'''ncs;11;1;13;0;0;0;0;−;'''ncs;3;1;0;−;0;−;10;1;'''ncs;2;0;12;0;1;0;0;−;'''ncs;0;1;0;−;1;0;10;2;'''ncs;0;−;7;1;0;−;0;−;'''ncs;2;1;0;−;0;0;10;1;'''ncs;0;−;3;0;0;6;0;−;'''ncs;5;1;3;6;0;8;0;−
'''opa;0;1;1;0;2;0;0;−;'''opa;0;0;0;−;0;0;2;0;'''opa;2;0;1;0;0;0;0;−;'''opa;0;0;0;−;2;1;3;0;'''opa;1;0;1;0;0;0;0;−;'''opa;1;1;0;−;0;−;0;−;'''opa;0;−;0;−;0;0;0;1;'''opa;0;0;0;−;0;0;0;0;'''opa;1;0;2;0;1;1;0;−;'''opa;1;0;0;−;0;−;2;0;'''opa;0;1;3;0;0;−;0;−;'''opa;0;−;0;−;0;0;2;0;'''opa;0;−;0;1;0;−;0;−;'''opa;0;0;0;−;0;0;1;0;'''opa;0;−;0;0;0;1;0;−;'''opa;0;0;2;0;2;0;0;−
'''pch;0;0;4;1;8;0;0;−;'''pch;0;2;0;−;0;1;6;5;'''pch;0;−;1;2;0;1;0;−;'''pch;0;1;0;−;1;9;7;2;'''pch;0;2;6;4;4;0;0;−;'''pch;0;−;0;−;0;0;0;−;'''pch;0;1;0;−;1;0;9;0;'''pch;0;−;0;0;0;2;5;0;'''pch;0;2;7;1;9;0;0;−;'''pch;0;1;0;−;0;1;7;0;'''pch;1;3;10;0;0;0;0;−;'''pch;0;0;0;−;2;0;4;4;'''pch;0;0;2;2;0;−;0;−;'''pch;0;0;0;−;0;1;3;3;'''pch;0;0;0;2;0;−;0;−;'''pch;0;1;3;1;0;−;0;−
'''pic;0;2;5;1;6;2;0;−;'''pic;1;0;0;−;0;0;6;0;'''pic;5;1;0;1;0;0;0;−;'''pic;0;0;0;−;1;4;6;0;'''pic;3;1;3;0;0;1;0;−;'''pic;2;3;0;−;0;−;0;0;'''pic;0;−;0;−;0;0;2;0;'''pic;0;−;0;−;0;0;2;0;'''pic;7;0;7;0;1;0;0;−;'''pic;2;0;0;−;0;−;6;0;'''pic;1;1;9;0;0;0;0;−;'''pic;0;1;0;−;0;0;4;2;'''pic;0;−;1;3;0;−;0;−;'''pic;1;0;0;−;0;1;5;0;'''pic;0;−;2;0;3;0;0;−;'''pic;2;0;4;1;7;0;0;−
'''sas;1;2;6;1;8;0;0;−;'''sas;0;2;0;−;0;1;5;1;'''sas;5;1;1;2;0;0;0;−;'''sas;0;0;0;0;4;5;8;0;'''sas;3;0;3;2;1;2;0;−;'''sas;3;4;0;−;0;−;0;0;'''sas;0;−;0;−;1;0;3;0;'''sas;1;2;0;0;0;0;0;−;'''sas;2;1;9;1;7;0;0;−;'''sas;1;4;0;−;0;1;6;0;'''sas;1;0;10;0;0;1;0;−;'''sas;1;1;0;−;1;2;5;1;'''sas;0;−;2;2;0;−;0;−;'''sas;0;2;0;−;0;2;6;0;'''sas;0;0;1;1;3;1;0;−;'''sas;1;1;3;3;4;2;0;−
'''sce;5;1;9;0;13;0;0;−;'''sce;2;1;0;−;0;0;10;0;'''sce;10;0;2;1;0;0;0;−;'''sce;0;1;0;−;8;1;12;0;'''sce;6;2;6;0;0;0;0;−;'''sce;3;6;0;−;0;−;1;0;'''sce;0;−;0;−;0;0;4;1;'''sce;1;1;0;0;0;−;0;−;'''sce;12;1;14;1;1;0;0;−;'''sce;4;0;0;−;0;−;10;0;'''sce;2;0;15;0;0;1;0;−;'''sce;1;0;0;−;1;0;12;1;'''sce;0;−;6;1;0;−;0;−;'''sce;2;0;0;−;0;0;9;1;'''sce;0;−;3;0;5;0;0;−;'''sce;6;0;5;4;5;4;0;−
'''spo;1;1;4;1;6;2;0;−;'''spo;0;1;0;−;0;0;5;1;'''spo;0;1;2;0;0;0;0;−;'''spo;0;0;0;−;3;3;6;1;'''spo;2;1;3;0;1;0;0;−;'''spo;0;1;0;−;0;0;5;0;'''spo;0;0;0;−;0;0;7;0;'''spo;0;0;0;−;0;0;3;1;'''spo;3;0;7;0;5;0;0;−;'''spo;1;0;0;−;0;0;5;0;'''spo;0;2;7;0;0;0;0;−;'''spo;1;0;0;−;0;0;7;1;'''spo;0;−;1;2;0;−;0;−;'''spo;0;1;0;−;0;0;6;0;'''spo;0;−;1;1;2;0;0;−;'''spo;0;1;3;1;3;0;0;−
'''sre;0;0;0;3;0;4;0;−;'''sre;0;0;0;−;0;0;0;3;'''sre;0;0;0;−;0;0;0;−;'''sre;0;0;0;−;0;3;0;3;'''sre;0;2;0;1;0;1;0;−;'''sre;0;0;0;−;0;0;0;2;'''sre;0;0;0;−;0;−;0;3;'''sre;0;0;0;−;0;1;0;3;'''sre;0;1;0;2;0;3;0;−;'''sre;0;0;0;−;0;0;0;2;'''sre;0;1;1;4;0;0;0;−;'''sre;0;0;0;−;0;0;0;3;'''sre;0;−;0;1;0;−;0;−;'''sre;0;0;0;−;0;1;0;1;'''sre;0;0;0;1;0;1;0;−;'''sre;0;−;0;3;0;−;0;−
'''tbl;6;2;10;0;13;1;0;−;'''tbl;1;1;0;−;0;0;11;3;'''tbl;10;2;0;5;0;0;0;−;'''tbl;0;1;0;−;5;5;13;3;'''tbl;7;2;6;0;0;0;0;−;'''tbl;0;12;0;−;0;−;0;0;'''tbl;0;−;0;−;0;0;3;0;'''tbl;0;1;4;1;0;−;0;−;'''tbl;11;4;16;2;0;0;0;−;'''tbl;3;1;0;−;0;−;16;2;'''tbl;1;1;22;0;0;0;0;−;'''tbl;0;1;0;−;0;0;15;2;'''tbl;0;−;2;6;0;−;0;−;'''tbl;3;0;0;−;0;1;13;2;'''tbl;0;−;0;−;1;5;0;−;'''tbl;10;1;5;6;3;5;0;−
'''tdl;2;2;5;1;7;2;0;−;'''tdl;1;0;0;−;0;0;7;1;'''tdl;5;1;2;0;0;0;0;−;'''tdl;0;0;0;−;5;1;7;0;'''tdl;4;1;3;0;1;0;0;−;'''tdl;4;1;0;−;0;−;0;0;'''tdl;0;−;0;−;0;0;3;0;'''tdl;0;3;0;0;0;−;0;−;'''tdl;7;0;8;0;2;1;0;−;'''tdl;3;0;0;−;0;−;7;0;'''tdl;1;0;10;0;0;0;0;−;'''tdl;0;0;0;−;1;0;10;1;'''tdl;0;−;3;3;0;−;0;−;'''tdl;1;0;0;−;0;0;6;0;'''tdl;0;−;2;0;3;0;0;−;'''tdl;2;0;2;3;3;4;0;−
'''tpf;4;1;7;1;7;1;0;−;'''tpf;0;1;0;−;0;0;6;2;'''tpf;6;1;0;2;0;0;0;−;'''tpf;1;0;0;−;4;3;9;0;'''tpf;5;1;4;0;0;0;0;−;'''tpf;0;6;0;−;0;−;0;0;'''tpf;0;−;0;−;0;0;2;0;'''tpf;0;1;0;0;0;−;0;−;'''tpf;8;2;10;1;0;0;0;−;'''tpf;2;0;0;−;0;−;7;1;'''tpf;0;1;12;0;0;0;0;−;'''tpf;1;0;0;−;0;0;9;0;'''tpf;0;−;4;1;0;−;0;−;'''tpf;1;0;0;−;0;0;7;0;'''tpf;0;−;3;0;1;2;0;−;'''tpf;8;0;6;2;1;0;0;−
'''ttt;0;1;0;2;0;5;0;−;'''ttt;0;0;0;−;0;1;0;3;'''ttt;0;0;0;2;0;1;0;−;'''ttt;0;0;0;−;0;4;0;5;'''ttt;0;1;0;2;0;3;0;−;'''ttt;0;1;0;−;0;2;0;3;'''ttt;0;0;0;−;1;1;0;5;'''ttt;0;0;0;−;0;3;1;3;'''ttt;0;1;0;5;1;5;0;−;'''ttt;0;1;0;−;0;2;0;6;'''ttt;0;1;7;2;0;1;0;−;'''ttt;0;0;0;−;0;2;3;2;'''ttt;0;−;0;3;0;−;0;−;'''ttt;0;0;0;−;0;2;2;0;'''ttt;0;−;1;1;1;2;0;−;'''ttt;0;6;0;4;0;0;0;−
'''uma;0;0;1;2;0;4;0;−;'''uma;0;0;0;−;0;0;3;0;'''uma;0;0;1;0;0;0;0;−;'''uma;0;0;0;−;0;3;2;1;'''uma;0;1;0;0;0;2;0;−;'''uma;0;0;0;−;0;0;0;3;'''uma;0;2;0;−;0;−;0;3;'''uma;0;1;0;−;0;1;1;2;'''uma;0;1;2;2;0;4;0;−;'''uma;0;0;0;−;0;0;1;3;'''uma;0;1;0;5;0;0;0;−;'''uma;0;0;0;−;0;0;1;2;'''uma;0;−;2;0;0;−;0;−;'''uma;0;0;0;−;0;2;0;2;'''uma;0;1;0;1;0;1;0;−;'''uma;0;−;1;1;0;−;0;−
'''vda;0;1;0;5;11;0;0;−;'''vda;0;2;0;−;0;2;6;1;'''vda;0;2;2;2;0;1;0;−;'''vda;0;−;0;−;4;4;8;0;'''vda;0;1;5;0;3;2;0;−;'''vda;0;2;0;−;0;1;4;3;'''vda;0;1;0;−;0;1;4;4;'''vda;0;0;0;−;0;3;6;1;'''vda;0;1;4;5;10;1;0;−;'''vda;0;1;0;−;2;1;2;8;'''vda;0;2;12;0;0;2;0;−;'''vda;0;0;0;−;0;1;2;8;'''vda;0;−;0;5;0;−;0;0;'''vda;0;2;0;0;1;2;3;2;'''vda;0;0;1;3;0;2;0;−;'''vda;0;0;2;4;0;1;0;−
'''vma;0;−;0;4;2;6;0;−;'''vma;0;2;0;−;0;1;0;3;'''vma;0;0;0;2;0;2;0;−;'''vma;0;0;0;−;3;4;0;6;'''vma;0;1;0;5;0;3;0;−;'''vma;0;1;0;−;0;0;0;0;'''vma;1;0;0;−;0;1;0;5;'''vma;0;2;0;−;0;3;3;1;'''vma;0;2;1;4;0;8;0;−;'''vma;0;1;0;−;0;1;0;6;'''vma;2;0;0;8;0;1;0;0;'''vma;0;0;0;−;0;1;0;6;'''vma;0;−;2;2;0;−;0;−;'''vma;0;0;0;−;0;2;2;2;'''vma;0;−;1;1;0;2;0;−;'''vma;0;−;1;2;0;2;0;−
'''yli;0;3;7;8;10;23;0;−;'''yli;0;2;0;−;0;1;21;0;'''yli;3;0;0;5;0;0;0;−;'''yli;0;0;0;−;11;6;14;11;'''yli;0;2;7;4;0;14;0;−;'''yli;2;0;0;−;0;1;15;5;'''yli;14;10;0;−;0;−;0;0;'''yli;0;1;0;−;6;6;9;11;'''yli;3;2;3;24;11;15;0;−;'''yli;3;0;0;−;1;0;28;1;'''yli;1;9;29;0;0;−;0;−;'''yli;1;0;0;−;3;4;21;2;'''yli;0;−;4;9;0;−;0;−;'''yli;0;1;0;−;1;2;17;3;'''yli;0;−;7;0;5;7;0;−;'''yli;0;0;6;10;0;2;0;−
'''zro;5;1;7;1;13;0;0;−;'''zro;1;0;0;−;0;1;9;0;'''zro;7;0;0;4;1;0;0;−;'''zro;0;0;0;0;7;1;9;1;'''zro;9;0;4;1;1;1;0;−;'''zro;9;0;0;−;0;−;1;1;'''zro;0;−;0;−;0;0;3;1;'''zro;0;4;0;0;0;−;0;−;'''zro;8;1;10;3;3;0;0;−;'''zro;6;2;0;−;0;−;11;0;'''zro;4;0;15;1;0;1;0;−;'''zro;0;1;0;−;3;0;10;1;'''zro;0;−;6;0;0;−;0;−;'''zro;0;2;0;−;0;1;11;0;'''zro;0;−;3;0;2;3;0;−;'''zro;3;0;4;3;0;9;0;−
;aaa1;aaa2;aac1;aac2;aag1;aag2;aat1;aat2;;aca1;aca2;acc1;acc2;acg1;acg2;act1;act2;;aga1;aga2;agc1;agc2;agg1;agg2;agt1;agt2;;ata1;ata2;atc1;atc2;atg1;atg2;att1;att2;;caa1;caa2;cac1;cac2;cag1;cag2;cat1;cat2;;cca1;cca2;ccc1;ccc2;ccg1;ccg2;cct1;cct2;;cga1;cga2;cgc1;cgc2;cgg1;cgg2;cgt1;cgt2;;cta1;cta2;ctc1;ctc2;ctg1;ctg2;ctt1;ctt2;;gaa1;gaa2;gac1;gac2;gag1;gag2;gat1;gat2;;gca1;gca2;gcc1;gcc2;gcg1;gcg2;gct1;gct2;;gga1;gga2;ggc1;ggc2;ggg1;ggg2;ggt1;ggt2;;gta1;gta2;gtc1;gtc2;gtg1;gtg2;gtt1;gtt2;;taa1;taa2;tac1;tac2;tag1;tag2;tat1;tat2;;tca1;tca2;tcc1;tcc2;tcg1;tcg2;tct1;tct2;;tga1;tga2;tgc1;tgc2;tgg1;tgg2;tgt1;tgt2;;tta1;tta2;ttc1;ttc2;ttg1;ttg2;ttt1;ttt2
'''zéros;;1;;0;;1;;40;'''zéros;;0;;42;;1;;0;'''zéros;;2;;1;;1;;42;'''zéros;;1;;36;;0;;0;'''zéros;;0;;0;;0;;42;'''zéros;;1;;41;;21;;4;'''zéros;;20;;42;;4;;0;'''zéros;;6;;30;;11;;11;'''zéros;;0;;0;;0;;40;'''zéros;;0;;42;;16;;0;'''zéros;;0;;0;;3;;40;'''zéros;;2;;41;;0;;0;'''zéros;;41;;0;;41;;40;'''zéros;;0;;41;;0;;0;'''zéros;;31;;2;;2;;41;'''zéros;;3;;0;;4;;41
'''db,diff;52;103;170;127;279;147;0;2;'''db,diff;22;78;0;0;5;61;221;111;'''db,diff;134;73;31;124;5;64;0;0;'''db,diff;2;57;0;6;132;192;231;147;'''db,diff;97;99;112;108;44;105;0;0;'''db,diff;56;149;0;1;0;36;51;104;'''db,diff;30;62;0;0;5;50;126;112;'''db,diff;7;68;5;13;13;76;66;104;'''db,diff;150;102;267;142;133;163;0;2;'''db,diff;58;83;0;0;11;49;248;141;'''db,diff;46;100;360;127;5;64;0;2;'''db,diff;6;58;0;1;21;73;276;125;'''db,diff;0;1;91;161;0;1;0;2;'''db,diff;24;68;0;1;5;75;211;99;'''db,diff;0;12;61;82;64;109;0;1;'''db,diff;71;61;111;185;64;126;0;2
'''total.diff;;155;;297;;426;;2;'''total.diff;;100;;0;;66;;332;'''total.diff;;207;;155;;69;;0;'''total.diff;;59;;6;;324;;378;'''total.diff;;196;;220;;149;;0;'''total.diff;;205;;1;;36;;155;'''total.diff;;92;;0;;55;;238;'''total.diff;;75;;18;;89;;170;'''total.diff;;252;;409;;296;;2;'''total.diff;;141;;0;;60;;389;'''total.diff;;146;;487;;69;;2;'''total.diff;;64;;1;;94;;401;'''total.diff;;1;;252;;1;;2;'''total.diff;;92;;1;;80;;310;'''total.diff;;12;;143;;173;;1;'''total.diff;;132;;296;;190;;2
'''corel;0.04;;-0.31;;-0.19;;−;;'''corel;-0.31;;−;;0.15;;-0.35;;'''corel;-0.04;;-0.29;;0.43;;−;;'''corel;0.22;;−;;-0.07;;-0.35;;'''corel;-0.36;;-0.31;;-0.15;;−;;'''corel;-0.09;;−;;−;;0.39;;'''corel;0.75;;−;;0.06;;-0.24;;'''corel;-0.06;;0.97;;0.48;;0.18;;'''corel;-0.29;;-0.33;;0.22;;−;;'''corel;-0.05;;−;;-0.09;;-0.36;;'''corel;-0.03;;-0.53;;0.17;;−;;'''corel;-0.22;;−;;0.04;;-0.31;;'''corel;−;;-0.24;;−;;−;;'''corel;-0.27;;−;;0.27;;-0.05;;'''corel;−;;-0.44;;-0.28;;−;;'''corel;0.10;;-0.15;;-0.11;;−;
'''db,dif;52;62;170;85;279;106;0;0;'''db,dif;22;36;0;0;5;20;221;69;'''db,dif;134;33;31;83;5;23;0;0;'''db,dif;2;16;0;0;132;150;231;105;'''db,dif;97;57;112;66;44;63;0;0;'''db,dif;56;108;0;0;0;15;51;66;'''db,dif;30;40;0;0;5;12;126;70;'''db,dif;7;32;5;1;13;45;66;73;'''db,dif;150;60;267;100;133;121;0;0;'''db,dif;58;41;0;0;11;23;248;99;'''db,dif;46;58;360;85;5;25;0;0;'''db,dif;6;18;0;0;21;31;276;83;'''db,dif;0;0;91;119;0;0;0;0;'''db,dif;24;26;0;0;5;33;211;57;'''db,dif;0;1;61;42;64;69;0;0;'''db,dif;71;22;111;143;64;88;0;1
'''total.dif;;114;;255;;385;;0;'''total.dif;;58;;0;;25;;290;'''total.dif;;167;;114;;28;;0;'''total.dif;;18;;0;;282;;336;'''total.dif;;154;;178;;107;;0;'''total.dif;;164;;0;;15;;117;'''total.dif;;70;;0;;17;;196;'''total.dif;;39;;6;;58;;139;'''total.dif;;210;;367;;254;;0;'''total.dif;;99;;0;;34;;347;'''total.dif;;104;;445;;30;;0;'''total.dif;;24;;0;;52;;359;'''total.dif;;0;;210;;0;;0;'''total.dif;;50;;0;;38;;268;'''total.dif;;1;;103;;133;;0;'''total.dif;;93;;254;;152;;1
'''indice;0.84;;2.00;;2.63;;−;;'''indice;0.61;;−;;0.25;;3.20;;'''indice;4.06;;0.37;;0.22;;−;;'''indice;0.13;;−;;0.88;;2.20;;'''indice;1.70;;1.70;;0.70;;−;;'''indice;0.52;;−;;0.00;;0.77;;'''indice;0.75;;−;;0.42;;1.80;;'''indice;0.22;;5.00;;0.29;;0.90;;'''indice;2.50;;2.67;;1.10;;−;;'''indice;1.41;;−;;0.48;;2.51;;'''indice;0.79;;4.24;;0.20;;−;;'''indice;0.33;;−;;0.68;;3.33;;'''indice;−;;0.76;;−;;−;;'''indice;0.92;;−;;0.15;;3.70;;'''indice;0.00;;1.45;;0.93;;−;;'''indice;3.23;;0.78;;0.73;;0.00;
'''max,29;6;6;10;8;20;23;0;0;'''max,29;3;2;0;0;2;2;21;6;'''max,29;10;4;3;6;2;3;0;0;'''max,29;1;2;0;0;11;9;14;16;'''max,29;9;4;7;6;6;14;0;0;'''max,29;9;12;0;0;0;3;15;8;'''max,29;14;10;0;0;1;2;19;10;'''max,29;3;4;4;1;6;6;11;14;'''max,29;14;5;16;24;12;15;0;0;'''max,29;6;5;0;0;3;4;28;12;'''max,29;4;9;29;13;1;6;0;0;'''max,29;1;2;0;0;3;4;21;8;'''max,29;0;0;8;10;0;0;0;0;'''max,29;3;2;0;0;1;2;17;6;'''max,29;0;1;7;4;5;7;0;0;'''max,29;11;6;9;14;12;9;0;1

C42-Codons. Les carrés[modifier | modifier le wikicode]

C42fe-tg;;db,dif;;différents;;;;;C42be-tg;;db,dif;;doubles;;;;;C42e-tg;;db,dif;;total;;;
ttt;1;tct;57;tat;0;tgt;0;;ttt;0;tct;211;tat;0;tgt;0;;ttt;1;tct;268;tat;0;tgt;0
ctt;73;cct;66;cat;0;cgt;70;;ctt;66;cct;51;cat;0;cgt;126;;ctt;139;cct;117;cat;0;cgt;196
att;105;act;69;aat;0;agt;0;;att;231;act;221;aat;0;agt;0;;att;336;act;290;aat;0;agt;0
gtt;83;gct;99;gat;0;ggt;0;;gtt;276;gct;248;gat;0;ggt;0;;gtt;359;gct;347;gat;0;ggt;0
ttc;143;tcc;0;tac;119;tgc;42;;ttc;111;tcc;0;tac;91;tgc;61;;ttc;254;tcc;0;tac;210;tgc;103
ctc;1;ccc;0;cac;66;cgc;0;;ctc;5;ccc;0;cac;112;cgc;0;;ctc;6;ccc;0;cac;178;cgc;0
atc;0;acc;0;aac;85;agc;83;;atc;0;acc;0;aac;170;agc;31;;atc;0;acc;0;aac;255;agc;114
gtc;0;gcc;0;gac;100;ggc;85;;gtc;0;gcc;0;gac;267;ggc;360;;gtc;0;gcc;0;gac;367;ggc;445
tta;22;tca;26;taa;0;tga;1;;tta;71;tca;24;taa;0;tga;0;;tta;93;tca;50;taa;0;tga;1
cta;32;cca;108;caa;57;cga;40;;cta;7;cca;56;caa;97;cga;30;;cta;39;cca;164;caa;154;cga;70
ata;16;aca;36;aaa;62;aga;33;;ata;2;aca;22;aaa;52;aga;134;;ata;18;aca;58;aaa;114;aga;167
gta;18;gca;41;gaa;60;gga;58;;gta;6;gca;58;gaa;150;gga;46;;gta;24;gca;99;gaa;210;gga;104
ttg;88;tcg;33;tag;0;tgg;69;;ttg;64;tcg;5;tag;0;tgg;64;;ttg;152;tcg;38;tag;0;tgg;133
ctg;45;ccg;15;cag;63;cgg;12;;ctg;13;ccg;0;cag;44;cgg;5;;ctg;58;ccg;15;cag;107;cgg;17
atg;150;acg;20;aag;106;agg;23;;atg;132;acg;5;aag;279;agg;5;;atg;282;acg;25;aag;385;agg;28
gtg;31;gcg;23;gag;121;ggg;25;;gtg;21;gcg;11;gag;133;ggg;5;;gtg;52;gcg;34;gag;254;ggg;30
;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;
C42f-tg;;db,diff;;différents;;;;;C42b-tg;;db,diff;;doubles;;;;;C42-tg;;db,diff;;total;;;
ttt;2;tct;99;tat;2;tgt;1;;ttt;0;tct;211;tat;0;tgt;0;;ttt;2;tct;310;tat;2;tgt;1
ctt;104;cct;104;cat;0;cgt;112;;ctt;66;cct;51;cat;0;cgt;126;;ctt;170;cct;155;cat;0;cgt;238
att;147;act;111;aat;2;agt;0;;att;231;act;221;aat;0;agt;0;;att;378;act;332;aat;2;agt;0
gtt;125;gct;141;gat;2;ggt;2;;gtt;276;gct;248;gat;0;ggt;0;;gtt;401;gct;389;gat;2;ggt;2
ttc;185;tcc;1;tac;161;tgc;82;;ttc;111;tcc;0;tac;91;tgc;61;;ttc;296;tcc;1;tac;252;tgc;143
ctc;13;ccc;1;cac;108;cgc;0;;ctc;5;ccc;0;cac;112;cgc;0;;ctc;18;ccc;1;cac;220;cgc;0
atc;6;acc;0;aac;127;agc;124;;atc;0;acc;0;aac;170;agc;31;;atc;6;acc;0;aac;297;agc;155
gtc;1;gcc;0;gac;142;ggc;127;;gtc;0;gcc;0;gac;267;ggc;360;;gtc;1;gcc;0;gac;409;ggc;487
tta;61;tca;68;taa;1;tga;12;;tta;71;tca;24;taa;0;tga;0;;tta;132;tca;92;taa;1;tga;12
cta;68;cca;149;caa;99;cga;62;;cta;7;cca;56;caa;97;cga;30;;cta;75;cca;205;caa;196;cga;92
ata;57;aca;78;aaa;103;aga;73;;ata;2;aca;22;aaa;52;aga;134;;ata;59;aca;100;aaa;155;aga;207
gta;58;gca;83;gaa;102;gga;100;;gta;6;gca;58;gaa;150;gga;46;;gta;64;gca;141;gaa;252;gga;146
ttg;126;tcg;75;tag;1;tgg;109;;ttg;64;tcg;5;tag;0;tgg;64;;ttg;190;tcg;80;tag;1;tgg;173
ctg;76;ccg;36;cag;105;cgg;50;;ctg;13;ccg;0;cag;44;cgg;5;;ctg;89;ccg;36;cag;149;cgg;55
atg;192;acg;61;aag;147;agg;64;;atg;132;acg;5;aag;279;agg;5;;atg;324;acg;66;aag;426;agg;69
gtg;73;gcg;49;gag;163;ggg;64;;gtg;21;gcg;11;gag;133;ggg;5;;gtg;94;gcg;60;gag;296;ggg;69
;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;
C42z-tg;;zéros;−;;;;;;C42ei-tg;;indice;;doubles/différents;;;;;C42ec-tg;;corel;;corrélation;;;
ttt;41;tct;0;tat;40;tgt;41;;ttt;0.00;tct;3.70;tat;−;tgt;−;;ttt;−;tct;-0.05;tat;−;tgt;−
ctt;11;cct;4;cat;42;cgt;0;;ctt;0.90;cct;0.77;cat;−;cgt;1.80;;ctt;0.18;cct;0.39;cat;−;cgt;-0.24
att;0;act;0;aat;40;agt;42;;att;2.20;act;3.20;aat;−;agt;−;;att;-0.35;act;-0.35;aat;−;agt;−
gtt;0;gct;0;gat;40;ggt;40;;gtt;3.33;gct;2.51;gat;−;ggt;−;;gtt;-0.31;gct;-0.36;gat;−;ggt;−
ttc;0;tcc;41;tac;0;tgc;2;;ttc;0.78;tcc;−;tac;0.76;tgc;1.45;;ttc;-0.15;tcc;−;tac;-0.24;tgc;-0.44
ctc;30;ccc;41;cac;0;cgc;42;;ctc;5.00;ccc;−;cac;1.70;cgc;−;;ctc;0.97;ccc;−;cac;-0.31;cgc;−
atc;36;acc;42;aac;0;agc;1;;atc;−;acc;−;aac;2.00;agc;0.37;;atc;−;acc;−;aac;-0.31;agc;-0.29
gtc;41;gcc;42;gac;0;ggc;0;;gtc;−;gcc;−;gac;2.67;ggc;4.24;;gtc;−;gcc;−;gac;-0.33;ggc;-0.53
tta;3;tca;0;taa;41;tga;31;;tta;3.23;tca;0.92;taa;−;tga;0.00;;tta;0.10;tca;-0.27;taa;−;tga;−
cta;6;cca;1;caa;0;cga;20;;cta;0.22;cca;0.52;caa;1.70;cga;0.75;;cta;-0.06;cca;-0.09;caa;-0.36;cga;0.75
ata;1;aca;0;aaa;1;aga;2;;ata;0.13;aca;0.61;aaa;0.84;aga;4.06;;ata;0.22;aca;-0.31;aaa;0.04;aga;-0.04
gta;2;gca;0;gaa;0;gga;0;;gta;0.33;gca;1.41;gaa;2.50;gga;0.79;;gta;-0.22;gca;-0.05;gaa;-0.29;gga;-0.03
ttg;4;tcg;0;tag;41;tgg;2;;ttg;0.73;tcg;0.15;tag;−;tgg;0.93;;ttg;-0.11;tcg;0.27;tag;−;tgg;-0.28
ctg;11;ccg;21;cag;0;cgg;4;;ctg;0.29;ccg;0.00;cag;0.70;cgg;0.42;;ctg;0.48;ccg;−;cag;-0.15;cgg;0.06
atg;0;acg;1;aag;1;agg;1;;atg;0.88;acg;0.25;aag;2.63;agg;0.22;;atg;-0.07;acg;0.15;aag;-0.19;agg;0.43
gtg;0;gcg;16;gag;0;ggg;3;;gtg;0.68;gcg;0.48;gag;1.10;ggg;0.20;;gtg;0.04;gcg;-0.09;gag;0.22;ggg;0.17

B42-Codons. Correlations et indices des doublons[modifier | modifier le wikicode]

B42;double;aaa;double;aac;double;aag;double;aat;B42;double;aca;double;acc;double;acg;double;act;B42;double;aga;double;agc;double;agg;double;agt;B42;double;ata;double;atc;double;atg;double;att;B42;double;caa;double;cac;double;cag;double;cat;B42;double;cca;double;ccc;double;ccg;double;cct;B42;double;cga;double;cgc;double;cgg;double;cgt;B42;double;cta;double;ctc;double;ctg;double;ctt;B42;double;gaa;double;gac;double;gag;double;gat;B42;double;gca;double;gcc;double;gcg;double;gct;B42;double;gga;double;ggc;double;ggg;double;ggt;B42;double;gta;double;gtc;double;gtg;double;gtt;B42;double;taa;double;tac;double;tag;double;tat;B42;double;tca;double;tcc;double;tcg;double;tct;B42;double;tga;double;tgc;double;tgg;double;tgt;B42;double;tta;double;ttc;double;ttg;double;ttt
'''bae;2;0;2;1;0;−;0;−;'''bae;0;2;0;0;0;−;0;−;'''bae;0;0;1;0;0;1;0;−;'''bae;0;−;1;1;3;2;0;−;'''bae;1;2;1;0;0;−;0;−;'''bae;0;0;0;−;0;−;0;−;'''bae;0;−;0;−;0;0;1;0;'''bae;1;0;0;0;0;−;0;−;'''bae;4;1;3;0;0;−;0;−;'''bae;1;1;0;0;0;−;0;−;'''bae;1;1;1;0;0;−;0;−;'''bae;2;0;0;0;0;−;0;−;'''bae;0;−;1;0;0;−;0;−;'''bae;0;1;0;0;0;−;0;−;'''bae;0;−;0;0;0;1;0;−;'''bae;0;1;1;1;0;0;0;−
'''bbd;1;0;0;0;0;−;0;−;'''bbd;0;0;0;0;0;−;0;−;'''bbd;0;0;0;0;0;0;0;−;'''bbd;0;−;0;0;0;2;0;−;'''bbd;0;0;0;0;0;−;0;−;'''bbd;0;1;0;0;0;−;0;−;'''bbd;0;0;0;−;0;−;0;0;'''bbd;0;0;0;0;0;−;0;−;'''bbd;1;0;1;1;0;−;0;−;'''bbd;0;0;0;0;0;−;0;−;'''bbd;0;0;0;0;0;−;0;−;'''bbd;1;0;0;−;0;−;0;−;'''bbd;0;−;0;0;0;−;0;−;'''bbd;0;0;0;0;0;−;0;−;'''bbd;0;−;0;0;0;0;0;−;'''bbd;0;0;0;0;0;0;0;−
'''bcef;4;1;3;1;0;−;0;−;'''bcef;1;1;0;0;0;−;0;−;'''bcef;0;−;1;0;0;−;0;−;'''bcef;0;−;3;0;2;5;0;−;'''bcef;3;1;0;0;0;−;0;−;'''bcef;1;1;0;−;0;−;0;−;'''bcef;0;−;0;−;0;0;1;1;'''bcef;1;0;0;0;0;−;0;−;'''bcef;5;1;5;0;0;−;0;−;'''bcef;3;1;0;−;0;−;0;−;'''bcef;2;1;2;1;0;−;0;−;'''bcef;4;0;0;−;0;−;0;−;'''bcef;0;−;2;0;0;−;0;−;'''bcef;0;2;0;0;0;−;0;−;'''bcef;0;−;0;0;0;1;0;−;'''bcef;1;0;1;1;0;0;0;−
'''bcoh;2;1;2;1;0;0;0;−;'''bcoh;0;1;0;0;0;0;0;−;'''bcoh;0;0;0;1;0;0;0;−;'''bcoh;0;−;1;1;3;2;0;−;'''bcoh;0;2;0;1;0;−;0;−;'''bcoh;0;1;0;−;0;0;0;0;'''bcoh;0;−;0;−;0;0;2;0;'''bcoh;0;1;0;0;0;0;0;−;'''bcoh;2;1;0;3;0;−;0;−;'''bcoh;2;1;0;0;0;0;0;−;'''bcoh;1;0;3;0;0;0;0;−;'''bcoh;1;2;0;0;0;−;0;−;'''bcoh;0;−;0;1;0;−;0;−;'''bcoh;0;1;0;0;0;0;0;−;'''bcoh;0;−;0;0;0;0;0;−;'''bcoh;0;1;0;2;1;0;0;−
'''blr;5;0;3;1;0;−;0;−;'''blr;5;0;0;1;0;−;0;−;'''blr;1;0;1;0;0;−;0;−;'''blr;0;−;2;1;3;4;0;−;'''blr;2;1;1;1;0;−;0;−;'''blr;2;1;0;0;0;−;0;−;'''blr;0;−;0;−;0;0;3;1;'''blr;3;0;0;0;0;0;0;−;'''blr;5;0;4;1;0;−;0;−;'''blr;2;1;0;0;0;−;0;−;'''blr;3;0;4;0;0;−;0;−;'''blr;4;0;0;1;0;−;0;−;'''blr;0;−;3;0;0;−;0;−;'''blr;2;0;0;1;0;−;0;−;'''blr;0;−;0;1;0;1;0;−;'''blr;0;1;1;1;1;1;0;−
'''cbl;3;0;1;1;0;1;0;−;'''cbl;1;2;0;0;0;−;0;−;'''cbl;2;0;1;0;0;0;0;−;'''cbl;0;−;0;1;2;4;0;−;'''cbl;1;0;1;0;0;0;0;−;'''cbl;2;0;0;−;0;−;0;−;'''cbl;0;0;0;−;0;−;0;0;'''cbl;1;0;0;0;0;−;0;−;'''cbl;1;1;2;1;0;0;0;−;'''cbl;2;0;0;−;0;−;0;−;'''cbl;3;0;2;0;0;0;0;−;'''cbl;4;0;0;−;0;−;0;−;'''cbl;0;−;1;0;0;−;0;−;'''cbl;1;0;0;0;0;−;0;−;'''cbl;0;0;0;1;0;0;0;−;'''cbl;1;0;2;0;0;0;0;−
'''dzc;2;0;2;0;0;0;0;−;'''dzc;0;0;0;1;0;0;0;−;'''dzc;0;0;0;0;0;0;0;−;'''dzc;0;−;2;0;2;3;0;−;'''dzc;0;0;0;0;1;0;0;−;'''dzc;0;0;0;0;0;0;0;−;'''dzc;0;0;0;−;0;0;2;0;'''dzc;0;0;0;0;6;1;0;−;'''dzc;3;0;2;0;0;−;0;−;'''dzc;2;0;5;0;0;−;0;−;'''dzc;0;0;3;0;0;0;0;−;'''dzc;7;0;0;1;0;−;0;−;'''dzc;0;−;1;0;0;−;0;−;'''dzc;0;0;1;0;0;0;0;−;'''dzc;0;−;0;0;0;0;0;−;'''dzc;0;0;1;0;0;0;0;−
'''eal;3;0;3;0;0;−;0;−;'''eal;1;0;0;1;0;0;0;−;'''eal;0;1;0;0;0;0;0;−;'''eal;0;−;2;0;4;4;0;−;'''eal;1;0;0;0;1;0;0;−;'''eal;0;0;0;0;0;0;0;−;'''eal;0;−;0;−;0;0;2;0;'''eal;0;0;0;0;2;1;0;−;'''eal;2;1;2;0;0;−;0;−;'''eal;2;0;1;0;0;−;0;−;'''eal;1;0;2;0;0;0;0;−;'''eal;1;2;0;1;0;−;0;−;'''eal;0;−;1;1;0;−;0;−;'''eal;0;0;1;0;0;0;0;−;'''eal;0;0;0;0;0;0;0;−;'''eal;0;0;1;0;0;0;0;−
'''eclx;4;0;3;1;0;−;0;−;'''eclx;0;0;1;0;0;0;0;−;'''eclx;0;0;0;0;0;0;0;−;'''eclx;0;−;2;0;4;3;0;−;'''eclx;1;0;0;0;0;1;0;−;'''eclx;1;0;0;0;0;−;0;−;'''eclx;0;−;0;−;0;0;2;1;'''eclx;0;0;0;0;1;2;0;−;'''eclx;3;0;2;0;0;−;0;−;'''eclx;2;0;0;1;0;−;0;−;'''eclx;0;0;3;0;0;0;0;−;'''eclx;2;1;0;1;0;−;0;−;'''eclx;0;−;0;2;0;−;0;−;'''eclx;1;0;1;0;0;−;0;−;'''eclx;0;0;0;0;0;0;0;−;'''eclx;0;0;1;0;0;1;0;−
'''eco;5;0;3;0;0;−;0;−;'''eco;0;0;0;1;0;1;0;−;'''eco;0;0;0;0;0;0;0;−;'''eco;0;−;2;0;3;4;0;−;'''eco;1;0;0;0;1;0;0;−;'''eco;0;0;0;0;0;0;0;−;'''eco;0;−;0;−;0;0;3;0;'''eco;0;0;0;0;1;2;0;−;'''eco;3;0;2;0;0;−;0;−;'''eco;2;0;1;0;0;−;0;−;'''eco;0;0;3;0;0;0;0;−;'''eco;4;0;0;1;0;−;0;−;'''eco;0;−;1;1;0;−;0;−;'''eco;0;0;1;0;0;0;0;−;'''eco;0;0;0;0;0;0;0;−;'''eco;0;0;1;0;0;0;0;−
'''eno;4;0;3;0;0;−;0;−;'''eno;0;0;1;0;0;0;0;−;'''eno;0;0;0;0;0;0;0;−;'''eno;0;−;2;0;3;2;0;−;'''eno;1;0;0;0;0;1;0;−;'''eno;1;0;0;0;0;−;0;−;'''eno;0;−;0;−;0;0;3;0;'''eno;0;0;0;0;1;2;0;−;'''eno;3;0;2;0;0;−;0;−;'''eno;2;0;1;0;0;−;0;−;'''eno;0;0;3;0;0;1;0;−;'''eno;2;1;0;1;0;−;0;−;'''eno;0;−;1;1;0;−;0;−;'''eno;0;1;1;0;0;−;0;−;'''eno;0;0;0;0;0;0;0;−;'''eno;0;0;1;0;0;0;0;−
'''gmc;2;1;1;2;0;−;0;−;'''gmc;1;1;0;0;0;0;0;−;'''gmc;1;0;0;1;0;−;0;−;'''gmc;0;−;1;2;2;3;0;−;'''gmc;1;2;1;0;0;−;0;−;'''gmc;2;0;0;−;0;0;0;−;'''gmc;0;−;0;−;0;0;1;2;'''gmc;0;1;0;0;0;0;0;−;'''gmc;4;0;1;2;0;−;0;−;'''gmc;3;1;0;0;0;0;0;−;'''gmc;1;1;2;2;0;0;0;−;'''gmc;2;1;0;0;0;−;0;−;'''gmc;0;−;1;0;0;−;0;0;'''gmc;1;0;0;0;0;0;0;−;'''gmc;0;−;0;1;0;0;0;−;'''gmc;1;0;1;0;0;0;0;−
'''hmo;4;0;3;0;0;−;0;−;'''hmo;0;1;1;1;0;0;0;−;'''hmo;0;0;1;0;0;0;0;−;'''hmo;0;−;3;0;4;3;0;−;'''hmo;3;0;0;1;0;−;0;−;'''hmo;0;0;1;1;0;1;0;−;'''hmo;0;−;0;−;0;1;2;0;'''hmo;0;0;1;0;1;2;0;−;'''hmo;4;1;2;1;0;−;0;−;'''hmo;1;0;4;0;0;0;0;−;'''hmo;0;0;2;4;0;0;0;−;'''hmo;1;0;3;0;0;0;0;−;'''hmo;0;−;2;1;0;−;0;−;'''hmo;0;0;0;1;0;0;0;−;'''hmo;0;0;0;2;0;1;0;−;'''hmo;0;0;1;1;0;0;0;0
'''hmr;0;0;0;0;0;0;0;−;'''hmr;0;0;0;0;0;0;0;−;'''hmr;0;0;0;0;0;0;0;−;'''hmr;0;−;1;0;0;2;0;−;'''hmr;0;0;0;0;0;0;0;−;'''hmr;0;0;0;0;0;0;0;−;'''hmr;0;0;0;0;0;0;0;−;'''hmr;0;0;0;0;0;0;0;−;'''hmr;0;0;0;0;0;0;0;−;'''hmr;1;0;0;0;0;0;0;−;'''hmr;0;0;0;0;0;0;0;−;'''hmr;0;0;0;0;0;0;0;−;'''hmr;0;−;0;0;0;−;0;−;'''hmr;0;0;0;0;0;0;0;−;'''hmr;0;−;0;0;0;0;0;−;'''hmr;0;0;0;0;0;1;0;−
'''kpn;5;0;3;0;0;−;0;−;'''kpn;0;0;1;0;0;0;0;−;'''kpn;0;0;0;0;0;0;0;−;'''kpn;0;−;2;0;4;2;0;−;'''kpn;1;0;0;0;1;0;0;−;'''kpn;0;0;0;0;0;0;0;−;'''kpn;0;−;0;−;0;0;3;0;'''kpn;0;0;0;0;2;1;0;−;'''kpn;3;0;2;0;0;−;0;−;'''kpn;2;0;1;0;0;−;0;−;'''kpn;0;0;3;0;0;0;0;−;'''kpn;4;0;0;2;0;−;0;−;'''kpn;0;−;2;0;0;−;0;−;'''kpn;0;0;1;0;0;0;0;−;'''kpn;0;0;0;0;0;0;0;−;'''kpn;0;0;1;0;0;0;0;−
'''ksa;4;0;3;0;0;−;0;−;'''ksa;0;0;1;0;0;0;0;−;'''ksa;0;0;0;0;0;0;0;−;'''ksa;0;−;2;0;3;2;0;−;'''ksa;1;0;0;0;0;1;0;−;'''ksa;0;0;0;0;0;0;0;−;'''ksa;0;−;0;−;0;0;3;0;'''ksa;0;0;0;0;0;3;0;−;'''ksa;3;0;2;0;0;−;0;−;'''ksa;2;0;1;0;0;−;0;−;'''ksa;0;0;3;0;0;0;0;−;'''ksa;3;0;0;1;0;−;0;−;'''ksa;0;−;1;1;0;−;0;−;'''ksa;0;0;0;1;0;0;0;−;'''ksa;0;0;0;0;0;0;0;−;'''ksa;0;0;1;0;0;0;0;−
'''ksk;0;0;0;1;3;0;0;−;'''ksk;0;0;1;0;0;1;0;0;'''ksk;0;0;0;0;0;0;0;−;'''ksk;0;−;0;0;2;2;0;−;'''ksk;0;0;0;0;0;1;0;−;'''ksk;0;0;0;0;0;0;0;−;'''ksk;2;0;0;−;0;0;1;0;'''ksk;0;0;1;0;0;0;0;−;'''ksk;0;0;1;0;2;0;0;−;'''ksk;0;0;2;1;0;0;0;−;'''ksk;0;0;2;1;0;1;0;−;'''ksk;0;0;1;2;1;0;0;−;'''ksk;0;−;0;0;0;−;0;−;'''ksk;0;0;0;0;0;0;0;−;'''ksk;0;−;0;3;0;0;0;−;'''ksk;0;0;0;0;0;0;0;−
'''lpl;1;0;2;2;0;0;0;−;'''lpl;0;0;0;0;0;0;0;0;'''lpl;0;0;0;0;0;0;0;−;'''lpl;0;−;2;0;1;3;0;−;'''lpl;0;1;1;0;0;0;0;−;'''lpl;1;0;0;−;0;0;0;−;'''lpl;0;−;0;−;0;0;1;0;'''lpl;0;0;0;−;0;0;0;0;'''lpl;1;0;2;0;0;0;0;−;'''lpl;1;0;0;−;0;0;0;−;'''lpl;1;1;1;0;0;0;0;−;'''lpl;2;0;0;−;0;−;0;−;'''lpl;0;−;1;0;0;1;0;−;'''lpl;0;0;0;0;0;0;0;−;'''lpl;0;−;0;0;0;1;0;−;'''lpl;1;0;1;0;0;0;0;−
'''mme;3;0;1;0;0;−;0;−;'''mme;2;1;0;0;0;−;0;−;'''mme;0;0;0;0;0;0;0;−;'''mme;0;−;2;0;3;7;0;−;'''mme;2;0;0;0;0;−;0;−;'''mme;1;0;0;0;0;−;0;−;'''mme;0;−;0;−;0;0;2;0;'''mme;1;0;0;0;0;−;0;−;'''mme;2;0;5;1;0;−;0;−;'''mme;2;0;0;0;0;−;0;−;'''mme;0;0;3;0;0;−;0;−;'''mme;5;0;0;0;0;−;0;−;'''mme;0;−;1;0;0;−;0;−;'''mme;0;0;0;0;0;−;0;−;'''mme;0;−;1;0;0;0;0;−;'''mme;1;0;1;0;1;0;0;−
'''mvs;6;0;5;0;0;−;0;−;'''mvs;3;0;0;0;0;−;0;−;'''mvs;0;0;1;0;0;0;0;−;'''mvs;0;−;10;0;8;2;0;−;'''mvs;3;0;1;2;0;−;0;−;'''mvs;3;0;0;−;0;−;0;−;'''mvs;0;−;0;−;0;0;3;1;'''mvs;4;0;0;0;0;−;0;−;'''mvs;0;−;4;0;0;−;0;−;'''mvs;10;0;0;0;0;−;0;−;'''mvs;1;2;4;0;0;−;0;−;'''mvs;6;0;0;1;0;−;0;−;'''mvs;0;−;4;0;0;−;0;−;'''mvs;6;1;0;0;0;−;0;−;'''mvs;0;−;2;0;1;0;0;−;'''mvs;3;1;3;0;0;0;0;−
'''pdi;0;1;1;1;0;1;0;−;'''pdi;2;0;0;0;0;0;0;−;'''pdi;0;0;0;0;0;0;0;−;'''pdi;0;−;6;0;1;2;0;−;'''pdi;0;0;1;0;1;0;0;−;'''pdi;0;0;0;0;0;0;0;−;'''pdi;0;−;0;−;0;0;0;2;'''pdi;0;0;0;0;1;0;0;−;'''pdi;0;1;1;1;0;0;0;−;'''pdi;5;1;0;0;0;0;0;−;'''pdi;1;0;2;0;0;0;0;−;'''pdi;2;0;0;0;0;−;0;−;'''pdi;0;−;2;0;0;−;0;−;'''pdi;0;1;1;0;0;0;0;−;'''pdi;0;−;0;1;0;1;0;−;'''pdi;0;0;0;1;0;0;0;−
'''pdix;4;0;2;1;0;−;0;−;'''pdix;4;0;0;−;0;−;0;−;'''pdix;2;1;1;0;0;−;0;−;'''pdix;0;−;0;0;5;4;0;−;'''pdix;2;0;1;0;0;−;0;−;'''pdix;2;0;0;−;0;−;0;−;'''pdix;0;−;0;−;0;−;0;0;'''pdix;1;1;0;−;0;−;0;−;'''pdix;4;0;2;1;0;−;0;−;'''pdix;4;0;0;−;0;−;0;−;'''pdix;4;0;1;0;0;−;0;−;'''pdix;2;3;0;−;0;−;0;−;'''pdix;0;−;2;0;0;−;0;−;'''pdix;2;0;0;0;0;−;0;−;'''pdix;0;0;1;0;0;0;0;−;'''pdix;3;1;2;0;0;0;0;−
'''pge;4;0;3;0;0;0;0;−;'''pge;0;0;1;0;0;0;0;−;'''pge;0;0;0;0;0;0;0;−;'''pge;0;−;2;0;4;2;0;−;'''pge;0;0;0;0;2;0;0;−;'''pge;0;0;0;0;0;0;0;−;'''pge;0;−;0;−;0;0;3;0;'''pge;0;0;0;0;3;0;0;−;'''pge;2;1;2;0;0;−;0;−;'''pge;2;0;1;0;0;−;0;−;'''pge;0;0;3;0;0;0;0;−;'''pge;3;0;0;2;0;−;0;−;'''pge;0;−;1;1;0;−;0;−;'''pge;0;0;1;0;0;0;0;−;'''pge;0;0;0;0;0;0;0;−;'''pge;0;0;0;1;0;0;0;−
'''pha;6;1;3;0;0;−;0;−;'''pha;2;0;0;0;0;−;0;−;'''pha;0;0;1;0;0;0;0;−;'''pha;0;−;1;0;4;2;0;−;'''pha;3;0;0;1;0;−;0;−;'''pha;2;0;0;0;0;−;0;−;'''pha;0;−;0;−;0;0;3;0;'''pha;2;1;0;0;0;−;0;−;'''pha;5;1;10;0;0;−;0;−;'''pha;2;0;0;0;0;−;0;−;'''pha;0;0;4;1;0;−;0;−;'''pha;5;1;0;1;0;−;0;−;'''pha;0;−;2;0;0;−;0;−;'''pha;2;1;0;0;0;−;0;−;'''pha;0;−;1;0;1;0;0;−;'''pha;2;0;1;1;0;0;0;−
'''ppoy;4;1;5;0;0;0;0;−;'''ppoy;2;1;0;0;0;0;0;−;'''ppoy;1;0;1;1;0;−;0;−;'''ppoy;0;−;1;1;1;5;0;−;'''ppoy;3;0;1;0;0;−;0;−;'''ppoy;2;1;0;0;0;−;0;−;'''ppoy;0;−;0;−;0;0;3;0;'''ppoy;1;0;0;1;1;1;0;−;'''ppoy;5;0;4;0;0;−;0;−;'''ppoy;2;2;0;0;0;−;0;−;'''ppoy;2;1;3;1;0;−;0;−;'''ppoy;4;1;0;0;0;−;0;−;'''ppoy;0;−;3;0;0;−;0;−;'''ppoy;0;0;2;0;0;0;0;−;'''ppoy;0;−;0;1;0;0;0;−;'''ppoy;0;0;2;0;1;1;0;−
'''pse;1;0;2;0;0;0;0;−;'''pse;0;0;0;1;0;0;0;−;'''pse;0;0;0;0;0;0;0;−;'''pse;0;−;7;0;1;2;0;−;'''pse;0;0;1;0;0;−;0;−;'''pse;0;0;0;0;1;0;0;−;'''pse;0;−;0;−;0;0;1;1;'''pse;0;0;0;0;2;0;0;−;'''pse;1;3;5;1;0;−;0;−;'''pse;7;0;1;1;0;0;0;−;'''pse;0;0;1;0;0;0;0;−;'''pse;3;1;0;0;1;0;0;−;'''pse;0;−;1;0;0;−;0;−;'''pse;0;0;0;0;0;0;0;−;'''pse;0;0;0;0;0;0;0;−;'''pse;0;0;1;0;0;0;0;−
'''saci;0;−;1;0;0;0;0;−;'''saci;0;0;0;0;0;0;0;−;'''saci;0;0;0;1;0;0;0;−;'''saci;0;−;0;1;4;1;0;−;'''saci;0;2;0;1;0;0;0;−;'''saci;0;0;1;0;0;−;0;−;'''saci;0;1;0;0;0;0;0;0;'''saci;0;0;0;1;0;1;0;−;'''saci;1;0;1;0;0;0;0;−;'''saci;0;1;0;0;1;1;0;−;'''saci;0;0;0;1;0;0;0;−;'''saci;0;0;1;1;0;0;0;−;'''saci;0;−;0;0;0;−;0;−;'''saci;0;0;0;1;0;1;0;−;'''saci;0;−;0;1;0;0;0;0;'''saci;0;0;0;0;0;1;0;−
'''sbn;6;3;4;0;0;−;0;−;'''sbn;2;0;0;1;0;−;0;−;'''sbn;0;0;1;0;0;0;0;−;'''sbn;0;−;2;0;4;5;0;−;'''sbn;1;1;1;0;0;−;0;−;'''sbn;2;0;0;0;0;−;0;−;'''sbn;0;−;0;−;0;0;5;0;'''sbn;0;1;0;0;0;1;0;−;'''sbn;6;0;3;0;0;−;0;−;'''sbn;2;0;1;0;0;−;0;−;'''sbn;0;0;5;0;0;−;0;−;'''sbn;3;0;1;0;0;−;0;−;'''sbn;0;−;3;0;0;−;0;−;'''sbn;2;1;0;0;0;−;0;−;'''sbn;0;0;1;0;0;0;0;−;'''sbn;2;0;2;0;0;0;0;0
'''sbz;4;0;3;0;0;−;0;−;'''sbz;0;0;0;1;0;0;0;−;'''sbz;0;1;0;0;0;1;0;−;'''sbz;0;−;2;0;3;2;0;−;'''sbz;1;0;0;0;1;0;0;−;'''sbz;0;0;0;0;0;0;0;−;'''sbz;0;−;0;−;0;0;3;0;'''sbz;0;0;0;0;2;1;0;−;'''sbz;3;0;2;0;0;−;0;−;'''sbz;2;0;1;0;0;−;0;−;'''sbz;0;0;3;0;0;0;0;−;'''sbz;3;0;0;1;0;−;0;−;'''sbz;0;−;1;1;0;−;0;−;'''sbz;0;1;1;0;0;0;0;−;'''sbz;0;0;0;0;0;0;0;−;'''sbz;0;0;1;0;0;0;0;−
'''sep;1;1;1;1;0;−;0;−;'''sep;1;1;0;−;0;0;0;−;'''sep;0;0;0;0;0;−;0;−;'''sep;0;−;1;0;1;2;0;−;'''sep;0;1;0;1;0;−;0;−;'''sep;0;1;0;−;0;−;0;−;'''sep;0;−;0;−;0;0;0;1;'''sep;0;0;0;0;0;−;0;−;'''sep;0;2;0;2;0;−;0;−;'''sep;2;0;0;−;0;−;0;−;'''sep;1;3;1;0;0;−;0;−;'''sep;1;1;0;−;0;−;0;−;'''sep;0;−;1;0;0;−;0;−;'''sep;1;1;0;0;0;−;0;−;'''sep;0;−;0;0;0;0;0;−;'''sep;1;0;0;1;0;0;0;−
'''sfr;5;0;2;2;0;−;0;−;'''sfr;1;0;0;0;0;−;0;−;'''sfr;0;0;1;0;0;0;0;−;'''sfr;0;−;2;1;4;4;0;−;'''sfr;2;0;1;0;0;−;0;−;'''sfr;3;0;0;0;0;−;0;−;'''sfr;0;−;0;−;0;0;2;1;'''sfr;0;1;0;0;0;0;0;−;'''sfr;5;0;2;1;0;−;0;−;'''sfr;2;0;0;1;0;−;0;−;'''sfr;0;0;3;1;0;−;0;−;'''sfr;4;1;1;0;0;−;0;−;'''sfr;0;−;3;0;0;−;0;0;'''sfr;2;0;0;0;0;−;0;−;'''sfr;0;−;0;1;0;0;0;−;'''sfr;1;1;1;0;0;0;0;−
'''sho;0;0;1;0;2;0;0;−;'''sho;0;0;0;1;0;0;0;−;'''sho;0;0;0;0;0;1;0;−;'''sho;0;−;0;0;3;4;0;−;'''sho;0;0;0;0;0;1;0;−;'''sho;0;0;2;0;0;0;0;−;'''sho;0;−;0;−;0;0;0;0;'''sho;0;0;0;1;0;0;0;−;'''sho;0;0;1;0;1;1;0;1;'''sho;0;0;1;0;0;0;0;−;'''sho;0;1;2;0;0;0;0;−;'''sho;0;0;1;1;1;0;0;−;'''sho;0;−;0;0;0;−;0;−;'''sho;0;0;0;0;0;1;0;−;'''sho;0;0;0;1;0;0;0;−;'''sho;0;0;0;0;0;0;0;−
'''sma;0;0;1;0;2;0;0;−;'''sma;0;0;0;1;0;0;0;−;'''sma;0;0;0;1;0;1;0;−;'''sma;0;−;0;0;3;2;0;−;'''sma;0;0;0;0;0;1;0;−;'''sma;0;0;2;0;0;0;0;−;'''sma;0;−;0;−;0;0;0;0;'''sma;0;0;1;0;0;0;0;−;'''sma;0;0;1;0;2;0;0;−;'''sma;0;0;1;0;0;0;0;−;'''sma;0;2;1;1;0;0;0;−;'''sma;0;0;0;2;0;3;0;−;'''sma;0;−;0;0;0;−;0;−;'''sma;0;1;0;0;0;3;0;0;'''sma;0;−;0;1;0;0;0;−;'''sma;0;0;0;0;0;0;0;−
'''spl;11;0;6;0;0;−;0;−;'''spl;3;0;0;0;0;−;0;−;'''spl;0;0;2;0;0;0;0;−;'''spl;0;−;2;0;8;4;0;−;'''spl;4;0;1;0;0;−;0;1;'''spl;2;0;0;0;0;−;0;−;'''spl;0;−;0;−;0;0;5;1;'''spl;4;0;0;0;0;−;0;−;'''spl;12;0;5;0;0;−;0;−;'''spl;2;0;1;0;0;−;0;−;'''spl;0;0;7;0;0;−;0;1;'''spl;10;0;1;0;0;−;0;−;'''spl;0;−;5;0;0;−;0;−;'''spl;2;1;0;0;0;−;0;−;'''spl;0;0;3;0;1;0;0;−;'''spl;3;0;3;0;0;0;0;−
'''sty;2;1;3;1;0;−;0;−;'''sty;0;0;0;1;0;0;0;−;'''sty;0;1;0;0;0;1;0;−;'''sty;0;−;2;0;3;2;0;−;'''sty;1;0;0;0;0;0;0;−;'''sty;0;0;0;0;0;0;0;−;'''sty;0;−;0;−;0;0;2;1;'''sty;0;0;0;0;2;1;0;−;'''sty;3;0;2;0;0;−;0;−;'''sty;2;0;1;0;0;−;0;−;'''sty;0;0;2;0;0;0;0;−;'''sty;1;1;0;1;0;−;0;−;'''sty;0;−;0;1;0;−;0;−;'''sty;0;0;1;0;0;1;0;−;'''sty;0;0;0;0;0;0;0;−;'''sty;0;0;1;0;0;0;0;−
'''vag;1;0;4;0;0;−;0;−;'''vag;4;0;0;1;0;−;0;−;'''vag;0;0;1;0;0;0;0;−;'''vag;0;−;6;0;4;2;0;−;'''vag;0;0;0;1;0;−;0;−;'''vag;2;0;0;−;0;−;0;−;'''vag;0;−;0;−;0;0;5;0;'''vag;1;1;0;1;0;−;0;−;'''vag;2;0;5;0;0;−;0;−;'''vag;7;0;0;0;0;−;0;−;'''vag;1;0;8;0;0;−;0;−;'''vag;1;0;0;1;0;−;0;−;'''vag;0;−;2;0;0;−;0;−;'''vag;3;0;0;0;0;−;0;−;'''vag;0;−;3;0;1;0;0;−;'''vag;1;1;2;1;0;0;0;−
'''vau;1;0;3;0;0;−;0;−;'''vau;2;1;0;1;0;−;0;−;'''vau;0;1;1;0;0;0;0;−;'''vau;0;−;2;0;4;3;0;−;'''vau;0;1;1;0;0;−;0;−;'''vau;2;0;0;0;0;−;0;−;'''vau;0;−;0;−;0;0;2;2;'''vau;1;2;0;0;0;−;0;−;'''vau;3;0;4;0;0;−;0;−;'''vau;2;1;0;0;0;−;0;−;'''vau;1;0;5;1;0;−;0;−;'''vau;1;0;0;1;0;−;0;−;'''vau;0;−;4;0;0;−;0;−;'''vau;2;0;0;0;0;−;0;−;'''vau;0;−;0;1;1;0;0;−;'''vau;1;0;1;1;0;0;0;−
'''vha;3;0;2;2;0;−;0;−;'''vha;4;0;0;1;0;−;0;−;'''vha;0;0;1;0;0;0;0;−;'''vha;0;−;4;0;5;4;0;−;'''vha;0;1;1;0;0;−;0;−;'''vha;2;0;0;−;0;−;0;−;'''vha;0;−;0;−;0;0;6;0;'''vha;3;1;1;0;0;−;0;−;'''vha;4;0;5;0;0;−;0;−;'''vha;5;1;0;0;0;−;0;−;'''vha;2;1;9;0;0;−;0;−;'''vha;3;0;0;1;0;−;0;−;'''vha;0;−;4;0;0;−;0;−;'''vha;3;0;0;0;0;−;0;−;'''vha;0;−;2;2;1;0;0;−;'''vha;2;0;2;1;0;0;0;−
'''vpf;3;0;2;2;0;−;0;−;'''vpf;4;0;0;1;0;−;0;−;'''vpf;0;0;1;0;0;0;0;−;'''vpf;0;−;2;0;7;3;0;−;'''vpf;4;1;1;0;0;−;0;−;'''vpf;2;0;0;−;0;−;0;−;'''vpf;0;−;0;−;0;0;6;0;'''vpf;8;2;1;0;0;−;0;−;'''vpf;5;0;6;0;0;−;0;−;'''vpf;4;0;0;0;0;−;0;−;'''vpf;1;0;10;0;0;−;0;−;'''vpf;3;0;0;1;0;−;0;−;'''vpf;0;−;5;1;0;−;0;−;'''vpf;3;0;0;0;0;−;0;−;'''vpf;0;−;2;1;1;0;0;−;'''vpf;1;1;2;1;0;1;0;−
'''vvm;0;0;4;0;0;−;0;−;'''vvm;3;0;0;1;0;−;0;−;'''vvm;0;1;1;0;0;0;0;−;'''vvm;0;−;7;0;6;3;0;−;'''vvm;4;0;1;0;0;−;0;−;'''vvm;2;0;0;0;0;−;0;−;'''vvm;0;−;0;−;0;0;4;1;'''vvm;4;2;1;0;0;−;0;−;'''vvm;0;0;6;0;0;−;0;−;'''vvm;6;2;0;−;0;−;0;−;'''vvm;1;0;7;0;0;−;0;−;'''vvm;0;0;0;1;0;−;0;−;'''vvm;0;−;3;0;0;−;0;−;'''vvm;2;0;0;0;0;−;0;−;'''vvm;0;−;1;1;1;0;0;−;'''vvm;0;1;2;1;0;0;0;−
'''ype;2;1;2;0;0;0;0;−;'''ype;1;0;0;1;0;−;0;−;'''ype;0;0;0;0;0;0;0;−;'''ype;0;−;2;0;3;2;0;−;'''ype;0;0;0;0;0;0;0;−;'''ype;1;0;0;0;0;−;0;−;'''ype;0;−;0;−;0;0;0;1;'''ype;0;0;0;0;0;1;0;−;'''ype;2;0;1;1;0;−;0;−;'''ype;2;0;1;0;0;−;0;−;'''ype;0;0;1;0;0;0;0;−;'''ype;2;0;0;1;0;−;0;−;'''ype;0;−;1;0;0;−;0;−;'''ype;0;1;0;1;0;−;0;−;'''ype;0;0;0;0;0;0;0;−;'''ype;0;0;1;0;0;0;0;−
'''yrb;4;0;2;0;0;0;0;−;'''yrb;1;0;0;1;0;−;0;−;'''yrb;0;0;0;0;0;0;0;−;'''yrb;0;−;2;0;4;2;0;−;'''yrb;1;0;0;0;0;0;0;−;'''yrb;1;0;0;1;0;−;0;−;'''yrb;0;−;0;−;0;0;2;0;'''yrb;0;0;0;0;2;1;0;−;'''yrb;3;0;1;1;0;−;0;−;'''yrb;2;0;1;0;0;−;0;−;'''yrb;0;0;3;0;0;0;0;−;'''yrb;2;0;2;0;0;−;0;−;'''yrb;0;−;2;0;0;−;0;−;'''yrb;0;1;0;1;0;0;0;−;'''yrb;0;0;0;0;0;0;0;−;'''yrb;0;0;1;0;0;0;0;−
;aaa1;aaa2;aac1;aac2;aag1;aag2;aat1;aat2;;aca1;aca2;acc1;acc2;acg1;acg2;act1;act2;;aga1;aga2;agc1;agc2;agg1;agg2;agt1;agt2;;ata1;ata2;atc1;atc2;atg1;atg2;att1;att2;;caa1;caa2;cac1;cac2;cag1;cag2;cat1;cat2;;cca1;cca2;ccc1;ccc2;ccg1;ccg2;cct1;cct2;;cga1;cga2;cgc1;cgc2;cgg1;cgg2;cgt1;cgt2;;cta1;cta2;ctc1;ctc2;ctg1;ctg2;ctt1;ctt2;;gaa1;gaa2;gac1;gac2;gag1;gag2;gat1;gat2;;gca1;gca2;gcc1;gcc2;gcg1;gcg2;gct1;gct2;;gga1;gga2;ggc1;ggc2;ggg1;ggg2;ggt1;ggt2;;gta1;gta2;gtc1;gtc2;gtg1;gtg2;gtt1;gtt2;;taa1;taa2;tac1;tac2;tag1;tag2;tat1;tat2;;tca1;tca2;tcc1;tcc2;tcg1;tcg2;tct1;tct2;;tga1;tga2;tgc1;tgc2;tgg1;tgg2;tgt1;tgt2;;tta1;tta2;ttc1;ttc2;ttg1;ttg2;ttt1;ttt2
'''zéros;;1;;0;;27;;42;'''zéros;;0;;2;;19;;40;'''zéros;;1;;0;;6;;42;'''zéros;;42;;0;;0;;42;'''zéros;;0;;0;;22;;41;'''zéros;;0;;12;;24;;41;'''zéros;;36;;40;;3;;1;'''zéros;;0;;2;;15;;41;'''zéros;;1;;0;;34;;41;'''zéros;;0;;6;;31;;42;'''zéros;;0;;0;;18;;41;'''zéros;;0;;6;;35;;42;'''zéros;;42;;0;;41;;40;'''zéros;;0;;0;;21;;41;'''zéros;;24;;0;;0;;41;'''zéros;;0;;0;;0;;40
'''db,diff;122;53;100;63;7;17;0;0;'''db,diff;50;54;7;58;0;25;0;2;'''db,diff;7;47;18;47;0;41;0;0;'''db,diff;0;0;93;51;138;165;0;0;'''db,diff;48;58;17;51;8;26;0;2;'''db,diff;39;48;6;32;1;19;0;1;'''db,diff;2;7;0;2;0;40;87;58;'''db,diff;36;56;6;44;27;48;0;1;'''db,diff;115;55;113;60;5;9;0;2;'''db,diff;104;55;26;40;1;12;0;0;'''db,diff;28;56;127;56;0;26;0;2;'''db,diff;108;58;11;63;3;10;0;0;'''db,diff;0;0;68;54;0;2;0;2;'''db,diff;35;57;12;48;0;27;0;1;'''db,diff;0;18;17;61;8;48;0;1;'''db,diff;25;51;44;57;4;48;0;2
'''total.diff;;175;;163;;24;;0;'''total.diff;;104;;65;;25;;2;'''total.diff;;54;;65;;41;;0;'''total.diff;;0;;144;;303;;0;'''total.diff;;106;;68;;34;;2;'''total.diff;;87;;38;;20;;1;'''total.diff;;9;;2;;40;;145;'''total.diff;;92;;50;;75;;1;'''total.diff;;170;;173;;14;;2;'''total.diff;;159;;66;;13;;0;'''total.diff;;84;;183;;26;;2;'''total.diff;;166;;74;;13;;0;'''total.diff;;0;;122;;2;;2;'''total.diff;;92;;60;;27;;1;'''total.diff;;18;;78;;56;;1;'''total.diff;;76;;101;;52;;2
'''corel;0.10;;-0.28;;-0.19;;−;;'''corel;-0.10;;-0.28;;−;;−;;'''corel;0.14;;-0.16;;−;;−;;'''corel;−;;-0.27;;0.09;;−;;'''corel;-0.12;;-0.07;;-0.45;;−;;'''corel;-0.04;;0.15;;-0.06;;−;;'''corel;-0.20;;−;;−;;-0.17;;'''corel;0.51;;-0.14;;0.13;;−;;'''corel;-0.19;;-0.35;;0.17;;−;;'''corel;0.14;;0.01;;1.00;;−;;'''corel;0.17;;-0.15;;−;;−;;'''corel;-0.12;;-0.28;;-0.35;;−;;'''corel;−;;-0.22;;−;;−;;'''corel;0.02;;-0.23;;−;;−;;'''corel;−;;-0.03;;-0.20;;−;;'''corel;0.23;;-0.10;;0.33;;−;
'''db,dif;122;12;100;21;7;2;0;0;'''db,dif;50;12;7;18;0;2;0;0;'''db,dif;7;6;18;5;0;5;0;0;'''db,dif;0;0;93;9;138;123;0;0;'''db,dif;48;16;17;9;8;6;0;1;'''db,dif;39;6;6;2;1;1;0;0;'''db,dif;2;1;0;0;0;1;87;17;'''db,dif;36;14;6;4;27;21;0;0;'''db,dif;115;14;113;18;5;1;0;1;'''db,dif;104;13;26;4;1;1;0;0;'''db,dif;28;14;127;14;0;2;0;1;'''db,dif;108;16;11;27;3;3;0;0;'''db,dif;0;0;68;12;0;1;0;0;'''db,dif;35;15;12;6;0;6;0;0;'''db,dif;0;0;17;19;8;6;0;0;'''db,dif;25;9;44;15;4;6;0;0
'''total.dif;;134;;121;;9;;0;'''total.dif;;62;;25;;2;;0;'''total.dif;;13;;23;;5;;0;'''total.dif;;0;;102;;261;;0;'''total.dif;;64;;26;;14;;1;'''total.dif;;45;;8;;2;;0;'''total.dif;;3;;0;;1;;104;'''total.dif;;50;;10;;48;;0;'''total.dif;;129;;131;;6;;1;'''total.dif;;117;;30;;2;;0;'''total.dif;;42;;141;;2;;1;'''total.dif;;124;;38;;6;;0;'''total.dif;;0;;80;;1;;0;'''total.dif;;50;;18;;6;;0;'''total.dif;;0;;36;;14;;0;'''total.dif;;34;;59;;10;;0
'''indice;10.17;;4.76;;3.50;;−;;'''indice;4.17;;0.39;;0.00;;−;;'''indice;1.17;;3.60;;0.00;;−;;'''indice;−;;10.33;;1.12;;−;;'''indice;3.00;;1.89;;1.33;;0.00;;'''indice;6.50;;3.00;;1.00;;−;;'''indice;2.00;;−;;0.00;;5.12;;'''indice;2.57;;1.50;;1.29;;−;;'''indice;8.21;;6.28;;5.00;;0.00;;'''indice;8.00;;6.50;;1.00;;−;;'''indice;2.00;;9.07;;0.00;;0.00;;'''indice;6.75;;0.41;;1.00;;−;;'''indice;−;;5.67;;0.00;;−;;'''indice;2.33;;2.00;;0.00;;−;;'''indice;−;;0.89;;1.33;;−;;'''indice;2.78;;2.93;;0.67;;−;
'''max,29;11;3;6;2;3;1;0;0;'''max,29;5;2;1;1;0;1;0;0;'''max,29;2;1;2;1;0;1;0;0;'''max,29;0;0;10;2;8;7;0;0;'''max,29;4;2;1;2;2;1;0;1;'''max,29;3;1;2;1;1;1;0;0;'''max,29;2;1;0;0;0;1;6;2;'''max,29;8;2;1;1;6;3;0;0;'''max,29;12;3;10;3;2;1;0;1;'''max,29;10;2;5;1;1;1;0;0;'''max,29;4;3;10;4;0;1;0;1;'''max,29;10;3;3;2;1;3;0;0;'''max,29;0;0;5;2;0;1;0;0;'''max,29;6;2;2;1;0;3;0;0;'''max,29;0;0;3;3;1;1;0;0;'''max,29;3;1;3;2;1;1;0;0

B42-Codons. Les carrés[modifier | modifier le wikicode]

B42fe-tg;;db,dif;;différents;;;;;B42be-tg;;db,dif;;doubles;;;;;B42e-tg;;db,dif;;total;;;
ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0
ctt;0;cct;0;cat;1;cgt;17;;ctt;0;cct;0;cat;0;cgt;87;;ctt;0;cct;0;cat;1;cgt;104
att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0
gtt;0;gct;0;gat;1;ggt;1;;gtt;0;gct;0;gat;0;ggt;0;;gtt;0;gct;0;gat;1;ggt;1
ttc;15;tcc;6;tac;12;tgc;19;;ttc;44;tcc;12;tac;68;tgc;17;;ttc;59;tcc;18;tac;80;tgc;36
ctc;4;ccc;2;cac;9;cgc;0;;ctc;6;ccc;6;cac;17;cgc;0;;ctc;10;ccc;8;cac;26;cgc;0
atc;9;acc;18;aac;21;agc;5;;atc;93;acc;7;aac;100;agc;18;;atc;102;acc;25;aac;121;agc;23
gtc;27;gcc;4;gac;18;ggc;14;;gtc;11;gcc;26;gac;113;ggc;127;;gtc;38;gcc;30;gac;131;ggc;141
tta;9;tca;15;taa;0;tga;0;;tta;25;tca;35;taa;0;tga;0;;tta;34;tca;50;taa;0;tga;0
cta;14;cca;6;caa;16;cga;1;;cta;36;cca;39;caa;48;cga;2;;cta;50;cca;45;caa;64;cga;3
ata;0;aca;12;aaa;12;aga;6;;ata;0;aca;50;aaa;122;aga;7;;ata;0;aca;62;aaa;134;aga;13
gta;16;gca;13;gaa;14;gga;14;;gta;108;gca;104;gaa;115;gga;28;;gta;124;gca;117;gaa;129;gga;42
ttg;6;tcg;6;tag;1;tgg;6;;ttg;4;tcg;0;tag;0;tgg;8;;ttg;10;tcg;6;tag;1;tgg;14
ctg;21;ccg;1;cag;6;cgg;1;;ctg;27;ccg;1;cag;8;cgg;0;;ctg;48;ccg;2;cag;14;cgg;1
atg;123;acg;2;aag;2;agg;5;;atg;138;acg;0;aag;7;agg;0;;atg;261;acg;2;aag;9;agg;5
gtg;3;gcg;1;gag;1;ggg;2;;gtg;3;gcg;1;gag;5;ggg;0;;gtg;6;gcg;2;gag;6;ggg;2
;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;
B42f-tg;;db,diff;;différents;;;;;B42b-tg;;db,diff;;doubles;;;;;B42-tg;;db,diff;;total;;;
ttt;2;tct;1;tat;2;tgt;1;;ttt;0;tct;0;tat;0;tgt;0;;ttt;2;tct;1;tat;2;tgt;1
ctt;1;cct;1;cat;2;cgt;58;;ctt;0;cct;0;cat;0;cgt;87;;ctt;1;cct;1;cat;2;cgt;145
att;0;act;2;aat;0;agt;0;;att;0;act;0;aat;0;agt;0;;att;0;act;2;aat;0;agt;0
gtt;0;gct;0;gat;2;ggt;2;;gtt;0;gct;0;gat;0;ggt;0;;gtt;0;gct;0;gat;2;ggt;2
ttc;57;tcc;48;tac;54;tgc;61;;ttc;44;tcc;12;tac;68;tgc;17;;ttc;101;tcc;60;tac;122;tgc;78
ctc;44;ccc;32;cac;51;cgc;2;;ctc;6;ccc;6;cac;17;cgc;0;;ctc;50;ccc;38;cac;68;cgc;2
atc;51;acc;58;aac;63;agc;47;;atc;93;acc;7;aac;100;agc;18;;atc;144;acc;65;aac;163;agc;65
gtc;63;gcc;40;gac;60;ggc;56;;gtc;11;gcc;26;gac;113;ggc;127;;gtc;74;gcc;66;gac;173;ggc;183
tta;51;tca;57;taa;0;tga;18;;tta;25;tca;35;taa;0;tga;0;;tta;76;tca;92;taa;0;tga;18
cta;56;cca;48;caa;58;cga;7;;cta;36;cca;39;caa;48;cga;2;;cta;92;cca;87;caa;106;cga;9
ata;0;aca;54;aaa;53;aga;47;;ata;0;aca;50;aaa;122;aga;7;;ata;0;aca;104;aaa;175;aga;54
gta;58;gca;55;gaa;55;gga;56;;gta;108;gca;104;gaa;115;gga;28;;gta;166;gca;159;gaa;170;gga;84
ttg;48;tcg;27;tag;2;tgg;48;;ttg;4;tcg;0;tag;0;tgg;8;;ttg;52;tcg;27;tag;2;tgg;56
ctg;48;ccg;19;cag;26;cgg;40;;ctg;27;ccg;1;cag;8;cgg;0;;ctg;75;ccg;20;cag;34;cgg;40
atg;165;acg;25;aag;17;agg;41;;atg;138;acg;0;aag;7;agg;0;;atg;303;acg;25;aag;24;agg;41
gtg;10;gcg;12;gag;9;ggg;26;;gtg;3;gcg;1;gag;5;ggg;0;;gtg;13;gcg;13;gag;14;ggg;26
;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;
B42z-tg;;zéros;−;;;;;;B42ei-tg;;indice;;doubles/différents;;;;;B42ec-tg;;corel;;corrélation;;;
ttt;40;tct;41;tat;40;tgt;41;;ttt;−;tct;−;tat;−;tgt;−;;ttt;−;tct;−;tat;−;tgt;−
ctt;41;cct;41;cat;41;cgt;1;;ctt;−;cct;−;cat;0.00;cgt;5.12;;ctt;−;cct;−;cat;−;cgt;-0.17
att;42;act;40;aat;42;agt;42;;att;−;act;−;aat;−;agt;−;;att;−;act;−;aat;−;agt;−
gtt;42;gct;42;gat;41;ggt;41;;gtt;−;gct;−;gat;0.00;ggt;0.00;;gtt;−;gct;−;gat;−;ggt;−
ttc;0;tcc;0;tac;0;tgc;0;;ttc;2.93;tcc;2.00;tac;5.67;tgc;0.89;;ttc;-0.10;tcc;-0.23;tac;-0.22;tgc;-0.03
ctc;2;ccc;12;cac;0;cgc;40;;ctc;1.50;ccc;3.00;cac;1.89;cgc;−;;ctc;-0.14;ccc;0.15;cac;-0.07;cgc;−
atc;0;acc;2;aac;0;agc;0;;atc;10.33;acc;0.39;aac;4.76;agc;3.60;;atc;-0.27;acc;-0.28;aac;-0.28;agc;-0.16
gtc;6;gcc;6;gac;0;ggc;0;;gtc;0.41;gcc;6.50;gac;6.28;ggc;9.07;;gtc;-0.28;gcc;0.01;gac;-0.35;ggc;-0.15
tta;0;tca;0;taa;42;tga;24;;tta;2.78;tca;2.33;taa;−;tga;−;;tta;0.23;tca;0.02;taa;−;tga;−
cta;0;cca;0;caa;0;cga;36;;cta;2.57;cca;6.50;caa;3.00;cga;2.00;;cta;0.51;cca;-0.04;caa;-0.12;cga;-0.20
ata;42;aca;0;aaa;1;aga;1;;ata;−;aca;4.17;aaa;10.17;aga;1.17;;ata;−;aca;-0.10;aaa;0.10;aga;0.14
gta;0;gca;0;gaa;1;gga;0;;gta;6.75;gca;8.00;gaa;8.21;gga;2.00;;gta;-0.12;gca;0.14;gaa;-0.19;gga;0.17
ttg;0;tcg;21;tag;41;tgg;0;;ttg;0.67;tcg;0.00;tag;0.00;tgg;1.33;;ttg;0.33;tcg;−;tag;−;tgg;-0.20
ctg;15;ccg;24;cag;22;cgg;3;;ctg;1.29;ccg;1.00;cag;1.33;cgg;0.00;;ctg;0.13;ccg;-0.06;cag;-0.45;cgg;−
atg;0;acg;19;aag;27;agg;6;;atg;1.12;acg;0.00;aag;3.50;agg;0.00;;atg;0.09;acg;−;aag;-0.19;agg;−
gtg;35;gcg;31;gag;34;ggg;18;;gtg;1.00;gcg;1.00;gag;5.00;ggg;0.00;;gtg;-0.35;gcg;1.00;gag;0.17;ggg;−

Total des génomes par codon, corrélations et indices des doublons[modifier | modifier le wikicode]

;;;;;;;;;;;;mtri dif;;;;mtri diff;;;;total;;
A10tg;;néant;;B42tg;;2 diags;;C42tg;;2 diags;;E79e-tg;;2 diags;;E79t-tg;;néant;;E79-tg;;néant
A10-tg;Ab-tg;Af-tg;;B42-tg;Bb-tg;Bf-tg;;C42o-tg;Cb-tg;Cf-tg;;Ee-tg;Ebe-tg;Efe-tg;;Et-tg;Ebt-tg;Eft-tg;;E79-tg;Eb-tg;Ef-tg
ttt;0;0;;ttt;0;0;;tgt;0;0;;cat;0;14;;cat;0;36;;cat;0;14
gtt;0;0;;gtt;0;0;;ggt;0;0;;tat;0;30;;tat;0;57;;tat;0;36
ctt;0;0;;ctt;0;0;;agt;0;0;;ccc;1;10;;ctc;1;10;;ctc;1;1
att;0;0;;att;0;0;;tat;0;0;;ctc;1;1;;ccc;1;28;;ccc;1;10
tgt;0;0;;tgt;0;0;;gat;0;0;;tag;1;54;;ttt;1;50;;ttt;1;23
ggt;0;0;;agt;0;0;;cat;0;0;;ttt;1;23;;tag;1;80;;tag;1;81
cgt;0;0;;tct;0;0;;aat;0;0;;cgc;2;8;;cgc;2;22;;cgc;2;18
agt;0;0;;gct;0;0;;tag;0;0;;ggt;2;60;;tgt;2;66;;ggt;2;97
tct;0;0;;cct;0;0;;gtc;0;0;;tgt;2;35;;ggt;2;78;;gat;3;58
gct;0;0;;act;0;0;;atc;0;0;;gat;3;38;;gat;3;73;;aat;5;75
cct;0;0;;tat;0;0;;cgc;0;0;;aat;5;37;;aat;5;70;;taa;5;126
act;0;0;;aat;0;0;;tcc;0;0;;taa;5;32;;taa;5;70;;atc;6;41
tat;0;0;;cgc;0;0;;gcc;0;0;;atc;6;38;;atc;6;65;;tga;7;167
gat;0;0;;ata;0;0;;ccc;0;0;;gtc;7;23;;gtc;7;60;;gcc;8;218
cat;0;0;;tga;0;0;;acc;0;0;;tga;7;70;;tga;7;133;;tgt;10;175
aat;0;0;;taa;0;0;;taa;0;0;;gcc;8;37;;gcc;8;61;;agt;25;37
gtg;0;0;;ggt;0;1;;ttt;0;1;;acc;19;26;;acc;19;49;;acc;25;39
ggg;0;0;;gat;0;1;;tga;0;1;;agt;25;37;;agt;25;55;;gtc;27;35
cgg;0;0;;cat;0;1;;ctc;5;1;;tcc;28;31;;tcc;28;58;;tcc;42;100
agg;0;0;;tag;0;1;;cgg;5;12;;cgg;84;214;;cgg;84;285;;cgg;84;214
tcg;0;0;;cgg;0;1;;ccg;0;15;;ata;91;395;;ata;91;473;;tta;97;416
gcg;0;0;;ggg;0;2;;ata;2;16;;tta;97;416;;tta;97;495;;ttg;114;465
ccg;0;0;;acg;0;2;;gta;6;18;;aga;108;495;;aga;108;574;;acg;118;414
acg;0;0;;agg;0;5;;acg;5;20;;ttg;114;465;;ttg;114;543;;cta;122;288
tag;0;0;;tcg;0;6;;tta;71;22;;acg;118;285;;acg;118;362;;tcg;134;269
gag;0;0;;gcg;1;1;;agg;5;23;;cta;122;288;;cta;122;364;;gta;148;503
gcc;0;0;;ccg;1;1;;gcg;11;23;;tcg;134;225;;tcg;134;304;;ata;153;395
ccc;0;0;;cga;2;1;;ggg;5;25;;tca;142;358;;tca;142;437;;tca;178;403
cac;0;0;;gtg;3;3;;tca;24;26;;gta;148;408;;gta;148;487;;aga;193;899
ata;0;0;;ttg;4;6;;gtg;21;31;;tac;167;1064;;tac;167;1,143;;ccg;211;154
tga;0;0;;gag;5;1;;cta;7;32;;cga;177;353;;cga;177;432;;agg;212;745
taa;0;0;;ccc;6;2;;tcg;5;33;;gcg;181;351;;gcg;181;430;;cga;241;1618
tgg;0;1;;ctc;6;4;;aga;134;33;;ccg;211;115;;ccg;211;194;;aca;295;595
cag;0;1;;aag;7;2;;aca;22;36;;agg;212;504;;agg;212;582;;tac;307;1078
agc;0;1;;aga;7;6;;cga;30;40;;ggg;221;286;;ggg;221;361;;gcg;308;4099
tcc;0;1;;acc;7;18;;gca;58;41;;aca;224;413;;aca;224;492;;caa;360;1357
acc;0;1;;tgg;8;6;;tgc;61;42;;caa;317;546;;caa;317;625;;ctg;368;338
cta;0;1;;cag;8;6;;ctg;13;45;;gca;336;686;;gca;336;764;;tgg;430;1077
cga;0;1;;gtc;11;27;;caa;97;57;;ctg;346;286;;ctg;346;365;;agc;443;554
aga;0;1;;tcc;12;6;;tct;211;57;;tgg;389;469;;tgg;389;547;;ggg;444;6146
tca;0;1;;cac;17;9;;gga;46;58;;agc;390;442;;agc;390;520;;act;477;646
cca;0;1;;tgc;17;19;;gaa;150;60;;act;398;545;;act;398;623;;ctt;491;366
aaa;0;1;;agc;18;5;;aaa;52;62;;cag;408;608;;cag;408;687;;gtg;494;2030
ttg;0;2;;tta;25;9;;cag;44;63;;gtg;456;468;;gtg;456;546;;tct;506;337
ctg;0;2;;gcc;26;4;;cct;51;66;;ctt;461;317;;ctt;461;396;;cag;515;608
gga;0;2;;ctg;27;21;;cac;112;66;;tct;506;337;;tct;506;414;;cca;531;444
caa;0;2;;gga;28;14;;tgg;64;69;;cgt;507;299;;cgt;507;377;;cgt;543;299
tta;0;3;;tca;35;15;;act;221;69;;gtt;525;418;;gtt;525;497;;aaa;589;1090
aag;1;0;;cta;36;14;;cgt;126;70;;cca;531;385;;cca;531;464;;gtt;594;480
cgc;1;0;;cca;39;6;;ctt;66;73;;gaa;550;547;;gaa;550;626;;gaa;601;5711
gta;1;0;;ttc;44;15;;agc;31;83;;aaa;554;781;;aaa;554;859;;cac;631;319
tac;1;1;;caa;48;16;;gtt;276;83;;gga;557;405;;gga;557;484;;ttc;645;472
gac;2;2;;aca;50;12;;aac;170;85;;cct;577;252;;cct;577;331;;cct;650;252
aca;2;2;;tac;68;12;;ggc;360;85;;cac;631;319;;cac;631;397;;gga;682;4374
ctc;2;4;;cgt;87;17;;ttg;64;88;;ttc;645;472;;ttc;645;550;;gag;697;2075
atc;3;2;;atc;93;9;;gct;248;99;;att;671;488;;att;671;567;;gct;822;1240
gtc;4;1;;aac;100;21;;gac;267;100;;gag;697;625;;gag;697;704;;att;850;539
aac;4;1;;gca;104;13;;att;231;105;;gct;731;923;;gct;731;1,002;;tgc;887;1309
gaa;4;1;;gta;108;16;;aag;279;106;;aac;801;712;;aac;801;791;;ggc;916;569
ttc;4;2;;gac;113;18;;cca;56;108;;tgc;822;945;;tgc;822;1,023;;aac;942;767
tgc;4;16;;gaa;115;14;;tac;91;119;;aag;824;725;;aag;824;803;;aag;950;3242
atg;*5;*22;;aaa;122;12;;gag;133;121;;gac;844;648;;gac;844;727;;gac;1070;715
ggc;6;3;;ggc;127;14;;ttc;111;143;;ggc;864;469;;ggc;864;547;;atg;1387;1152
gca;7;1;;atg;138;123;;atg;132;150;;atg;957;1152;;atg;957;1,231;;gca;3200;3735
;;;;;;;;;;;;;;;;;;;;;;
correl.;0.42;0.27;;;0.66;0.55;;;0.71;0.60;;;0.75;0.52;;;0.76;0.52;;;0.45;0.32
total;46;58;;;1535;415;;;4179;2781;;;18969;22508;;;18969;26546;;;24801;56149
Indice db;0.79;;;;3.70;;;;1.50;;;;0.84;;;;0.71;;;;0.44;

Comparaisons croisées par les corrélations entre totaux[modifier | modifier le wikicode]

Les corrélations diff, intra groupe[modifier | modifier le wikicode]
;db;diff;;;db;diff;;;db;diff
ccF;0.518;;;ccF;0.614;;;ccF;0.572;
cTc;0.759;;;cTc;0.702;;;cTc;0.704;
E79t;Ebt-tg;Eft-tg;;C42t;Cbt-tg;Cft-tg;;B42t;Bbt-tg;Bft-tg
cat;0;36;;acc;0;0;;aat;0;0
tat;0;57;;agt;0;0;;agt;0;0
ctc;1;10;;cat;0;0;;ata;0;0
ccc;1;28;;cgc;0;0;;att;0;0
ttt;1;50;;gcc;0;0;;gct;0;0
tag;1;80;;ccc;0;1;;gtt;0;0
cgc;2;22;;gtc;0;1;;taa;0;0
tgt;2;66;;taa;0;1;;cct;0;1
ggt;2;78;;tag;0;1;;ctt;0;1
gat;3;73;;tcc;0;1;;tct;0;1
aat;5;70;;tgt;0;1;;tgt;0;1
taa;5;70;;aat;0;2;;act;0;2
atc;6;65;;gat;0;2;;cat;0;2
gtc;7;60;;ggt;0;2;;cgc;0;2
tga;7;133;;tat;0;2;;gat;0;2
gcc;8;61;;ttt;0;2;;ggt;0;2
acc;19;49;;atc;0;6;;tag;0;2
agt;25;55;;tga;0;12;;tat;0;2
tcc;28;58;;ctc;5;13;;ttt;0;2
cgg;84;285;;ccg;0;36;;tga;0;18
ata;91;473;;gcg;11;49;;acg;0;25
tta;97;495;;cgg;5;50;;ggg;0;26
aga;108;574;;ata;2;57;;tcg;0;27
ttg;114;543;;gta;6;58;;cgg;0;40
acg;118;362;;acg;5;61;;agg;0;41
cta;122;364;;tta;71;61;;gcg;1;12
tcg;134;304;;cga;30;62;;ccg;1;19
tca;142;437;;agg;5;64;;cga;2;7
gta;148;487;;ggg;5;64;;gtg;3;10
tac;167;1,143;;cta;7;68;;ttg;4;48
cga;177;432;;tca;24;68;;gag;5;9
gcg;181;430;;gtg;21;73;;ccc;6;32
ccg;211;194;;aga;134;73;;ctc;6;44
agg;212;582;;tcg;5;75;;aag;7;17
ggg;221;361;;ctg;13;76;;aga;7;47
aca;224;492;;aca;22;78;;acc;7;58
caa;317;625;;tgc;61;82;;cag;8;26
gca;336;764;;gca;58;83;;tgg;8;48
ctg;346;365;;caa;97;99;;gtc;11;63
tgg;389;547;;tct;211;99;;tcc;12;48
agc;390;520;;gga;46;100;;cac;17;51
act;398;623;;gaa;150;102;;tgc;17;61
cag;408;687;;aaa;52;103;;agc;18;47
gtg;456;546;;cct;51;104;;tta;25;51
ctt;461;396;;ctt;66;104;;gcc;26;40
tct;506;414;;cag;44;105;;ctg;27;48
cgt;507;377;;cac;112;108;;gga;28;56
gtt;525;497;;tgg;64;109;;tca;35;57
cca;531;464;;act;221;111;;cta;36;56
gaa;550;626;;cgt;126;112;;cca;39;48
aaa;554;859;;agc;31;124;;ttc;44;57
gga;557;484;;gtt;276;125;;caa;48;58
cct;577;331;;ttg;64;126;;aca;50;54
cac;631;397;;aac;170;127;;tac;68;54
ttc;645;550;;ggc;360;127;;cgt;87;58
att;671;567;;gct;248;141;;atc;93;51
gag;697;704;;gac;267;142;;aac;100;63
gct;731;1,002;;att;231;147;;gca;104;55
aac;801;791;;aag;279;147;;gta;108;58
tgc;822;1,023;;cca;56;149;;gac;113;60
aag;824;803;;tac;91;161;;gaa;115;55
gac;844;727;;gag;133;163;;aaa;122;53
ggc;864;547;;ttc;111;185;;ggc;127;56
atg;957;1,231;;atg;132;192;;atg;138;165
Les corrélations diff, entre groupes[modifier | modifier le wikicode]
;db;diff;db;diff;;;db;diff;db;diff;;;db;diff;db;diff;;;db+diff;db+diff;db+diff
ccF;0.684;0.719;0.374;0.592;;ccF;0.353;0.378;0.236;0.432;;ccF;0.436;0.456;0.357;0.477;;ccF;0.404;0.548;0.718
cTc;0.768;0.851;0.580;0.851;;cTc;0.492;0.553;0.494;0.760;;cTc;0.585;0.597;0.665;0.766;;cTc;0.641;0.741;0.852
Eet-Ct;Ebet-tg;Efet-tg;Cbt-tg;Cft-tg;;Bt-Ct;Bbt-tg;Bft-tg;Cbt-tg;Cft-tg;;Eet-Bt;Bbt-tg;Bft-tg;Ebet-tg;Efet-tg;;total;B42t;C42t;E79t
cat;0;36;0;0;;agt;0;0;0;0;;aat;0;0;5;70;;§ctc;1;18;11
tat;0;57;0;2;;§gcc;0;0;0;0;;taa;0;0;5;70;;cgc;2;0;24
ctc;1;10;5;13;;§gtc;0;0;0;1;;§atc;0;0;6;65;;§ccc;1;1;29
ccc;1;28;0;1;;taa;0;0;0;1;;§gtc;0;0;7;60;;cat;2;0;36
ttt;1;50;0;2;;aat;0;0;0;2;;§gcc;0;0;8;61;;ttt;2;2;51
tag;1;80;0;1;;§atc;0;0;0;6;;agt;0;0;25;55;;tat;2;2;57
cgc;2;22;0;0;;§ccc;0;1;0;1;;§ctc;0;1;1;10;;§gtc;0;1;67
tgt;2;66;0;1;;§tcc;0;1;0;1;;§ccc;0;1;1;28;;§acc;2;0;68
ggt;2;78;0;2;;tgt;0;1;0;1;;tgt;0;1;2;66;;tgt;1;1;68
gat;3;73;0;2;;§ctc;0;1;5;13;;§tcc;0;1;28;58;;gcc;0;0;69
taa;5;70;0;1;;§acc;0;2;0;0;;cat;0;2;0;36;;atc;0;6;71
aat;5;70;0;2;;cat;0;2;0;0;;tat;0;2;0;57;;taa;0;1;75
atc;6;65;0;6;;cgc;0;2;0;0;;ttt;0;2;1;50;;aat;0;2;75
gtc;7;60;0;1;;tag;0;2;0;1;;tag;0;2;1;80;;gat;2;2;76
tga;7;133;0;12;;gat;0;2;0;2;;cgc;0;2;2;22;;agt;0;0;80
gcc;8;61;0;0;;ggt;0;2;0;2;;ggt;0;2;2;78;;ggt;2;2;80
acc;19;49;0;0;;tat;0;2;0;2;;gat;0;2;3;73;;tag;2;1;81
agt;25;55;0;0;;ttt;0;2;0;2;;§acc;0;2;19;49;;§tcc;1;1;86
tcc;28;58;0;1;;tga;0;18;0;12;;tga;0;18;7;133;;tga;18;12;140
cgg;84;285;5;50;;acg;0;25;5;61;;acg;0;25;118;362;;cgg;40;55;369
ata;91;473;2;57;;ggg;0;26;5;64;;ggg;0;26;221;361;;ccg;20;36;405
tta;97;495;71;61;;tcg;0;27;5;75;;tcg;0;27;134;304;;tcg;27;80;438
aga;108;574;134;73;;cgg;0;40;5;50;;cgg;0;40;84;285;;acg;25;66;480
ttg;114;543;64;126;;agg;0;41;5;64;;agg;0;41;212;582;;cta;92;75;486
acg;118;362;5;61;;gcg;1;12;11;49;;gcg;1;12;181;430;;ata;*0;59;564
cta;122;364;7;68;;ccg;1;19;0;36;;ccg;1;19;211;194;;tca;92;92;579
tcg;134;304;5;75;;cga;2;7;30;62;;cga;2;7;177;432;;ggg;26;69;582
tca;142;437;24;68;;gtg;3;10;21;73;;gtg;3;10;456;546;;tta;76;132;592
gta;148;487;6;58;;ttg;4;48;64;126;;ttg;4;48;114;543;;cga;9;92;609
tac;167;1,143;91;161;;gag;5;9;133;163;;gag;5;9;697;704;;gcg;13;60;611
cga;177;432;30;62;;§cct;6;32;51;104;;§cct;6;32;577;331;;gta;166;64;635
gcg;181;430;11;49;;§ctt;6;44;66;104;;§ctt;6;44;461;396;;ttg;52;190;657
ccg;211;194;0;36;;aag;7;17;279;147;;aag;7;17;824;803;;aga;54;207;682
agg;212;582;5;64;;aga;7;47;134;73;;aga;7;47;108;574;;ctg;75;89;711
ggg;221;361;5;64;;§act;7;58;221;111;;§act;7;58;398;623;;aca;104;100;716
aca;224;492;22;78;;cag;8;26;44;105;;cag;8;26;408;687;;agg;41;69;794
caa;317;625;97;99;;tgg;8;48;64;109;;tgg;8;48;389;547;;§ctt;50;170;857
gca;336;764;58;83;;§gtt;11;63;276;125;;§gtt;11;63;525;497;;cgt;145;238;884
ctg;346;365;13;76;;§tct;12;48;211;99;;§tct;12;48;506;414;;§cct;38;155;908
tgg;389;547;64;109;;cac;17;51;112;108;;cac;17;51;631;397;;agc;65;155;910
agc;390;520;31;124;;tgc;17;61;61;82;;tgc;17;61;822;1,023;;§tct;60;310;920
act;398;623;221;111;;agc;18;47;31;124;;agc;18;47;390;520;;tgg;56;173;936
cag;408;687;44;105;;tta;25;51;71;61;;tta;25;51;97;495;;caa;106;196;942
gtg;456;546;21;73;;§gct;26;40;248;141;;§gct;26;40;731;1,002;;cca;87;205;995
ctt;461;396;66;104;;ctg;27;48;13;76;;ctg;27;48;346;365;;gtg;13;94;1002
tct;506;414;211;99;;gga;28;56;46;100;;gga;28;56;557;484;;§act;65;332;1021
cgt;507;377;126;112;;tca;35;57;24;68;;tca;35;57;142;437;;§gtt;74;401;1022
gtt;525;497;276;125;;cta;36;56;7;68;;cta;36;56;122;364;;cac;68;220;1028
cca;531;464;56;149;;cca;39;48;56;149;;cca;39;48;531;464;;gga;84;146;1041
gaa;550;626;150;102;;ttc;44;57;111;185;;ttc;44;57;645;550;;cag;34;149;1095
aaa;554;859;52;103;;caa;48;58;97;99;;caa;48;58;317;625;;gca;159;141;1100
gga;557;484;46;100;;aca;50;54;22;78;;aca;50;54;224;492;;gaa;170;252;1176
cct;577;331;51;104;;tac;68;54;91;161;;tac;68;54;167;1,143;;ttc;101;296;1195
cac;631;397;112;108;;cgt;87;58;126;112;;cgt;87;58;507;377;;§att;144;378;1238
ttc;645;550;111;185;;§att;93;51;231;147;;§att;93;51;671;567;;tac;122;252;1310
att;671;567;231;147;;aac;100;63;170;127;;aac;100;63;801;791;;gag;14;296;1401
gag;697;704;133;163;;gca;104;55;58;83;;gca;104;55;336;764;;ggc;183;487;1411
gct;731;1,002;248;141;;gta;108;58;6;58;;gta;108;58;148;487;;aaa;175;155;1413
aac;801;791;170;127;;gac;113;60;267;142;;gac;113;60;844;727;;gac;173;409;1571
tgc;822;1,023;61;82;;gaa;115;55;150;102;;gaa;115;55;550;626;;aac;163;297;1592
aag;824;803;279;147;;aaa;122;53;52;103;;aaa;122;53;554;859;;aag;24;426;1627
gac;844;727;267;142;;ggc;127;56;360;127;;ggc;127;56;864;547;;§gct;66;389;1733
ggc;864;547;360;127;;atg;138;165;132;192;;atg;138;165;957;1,231;;tgc;78;143;1845
atg;957;1,231;132;192;;ata;*0;*0;*2;*57;;ata;*0;*0;91;473;;atg;303;324;2188
Tableau synthétique des corrélations diff et dif[modifier | modifier le wikicode]
colonnes;;a;b;c;d;;a;b;c;d;;a;b;c;d;;a;b;c
corrélation;;a-c;a-d;b-c;b-d;;a-c;a-d;b-c;b-d;;a-c;a-d;b-c;b-d;;a-b;a-c;b-c
;;;;;;;;;;;;;;;;;;;
dif;;E/C;;db;dif;;B/C;;db;dif;;E/B;;db;dif;;total;;db+dif
groupes;;Ebe-tg;Efe-tg;Cb-tg;Cf-tg;;Bb-tg;Bf-tg;Cb-tg;Cf-tg;;Bb-tg;Bf-tg;Ebe-tg;Efe-tg;;Be;Ce;Ee
ccF;;0.684;0.717;0.374;0.571;;0.353;0.358;0.175;0.410;;0.436;0.455;0.393;0.504;;0.391;0.572;0.713
cTc;;0.768;0.845;0.577;0.789;;0.492;0.537;0.310;0.513;;0.585;0.599;0.502;0.568;;0.549;0.673;0.821
;;;;;;;;;;;;;;;;;;;
diff;;E/C;;db;diff;;B/C;;db;diff;;E/B;;db;diff;;total;;db+diff
groupes;;Ebet-tg;Efet-tg;Cbt-tg;Cft-tg;;Bbt-tg;Bft-tg;Cbt-tg;Cft-tg;;Bbt-tg;Bft-tg;Ebet-tg;Efet-tg;;B42t;C42t;E79t
ccF;;0.684;0.719;0.374;0.592;;0.353;0.378;0.236;0.432;;0.436;0.456;0.357;0.477;;0.404;0.548;0.718
cTc;;0.768;0.851;0.580;0.851;;0.492;0.553;0.494;0.760;;0.585;0.597;0.665;0.766;;0.641;0.741;0.852
;;;;;;;;;;;;;;;;;;;
100x(diff − dif);;E/C;;;;;B/C;;;;;E/B;;;;;total;;
ccF;;0.0;0.2;0.1;2.1;;0.0;2.0;6.1;2.2;;0.0;0.1;-3.6;-2.7;;1.3;-2.4;0.5
cTc;;0.0;0.6;0.3;6.2;;0.0;1.6;18.4;24.7;;0.0;-0.2;16.4;19.7;;9.3;6.8;3.1

Comparaison par les indices de multiplicité[modifier | modifier le wikicode]

Bactéries de la base gtRNAdb et E79t diff[modifier | modifier le wikicode]

Légende:

E79tm. Multiplicité de E79t-tg;;;;;;;;;E79tm9. E79tm / 8.91;;;;;;;
ttt;&0.65;tcc;@1.09;tat;&0.72;tgt;&0.86;;ttt;&0.07;tcc;@0.12;tat;&0.08;tgt;&0.10
atc;@0.90;acc;@0.86;aat;&0.95;agt;&1.01;;atc;@0.10;acc;@0.10;aat;&0.11;agt;&0.11
ctc;@0.14;ccc;@0.37;cat;&0.46;cgc;@0.30;;ctc;@0.02;ccc;@0.04;cat;&0.05;cgc;@0.03
gtc;@0.85;gcc;@0.87;gat;&0.96;ggt;&1.01;;gtc;@0.10;gcc;@0.10;gat;&0.11;ggt;&0.11
ttc;*15.13;tct;§11.65;tac;*16.58;tgc;$23.35;;ttc;*1.70;tct;§1.31;tac;*1.86;tgc;$2.62
att;*15.67;act;?12.92;aac;$20.15;agc;§11.52;;att;*1.76;act;?1.45;aac;$2.26;agc;§1.29
ctt;§10.85;cct;§11.49;cac;?13.01;cgt;§11.19;;ctt;§1.22;cct;§1.29;cac;?1.46;cgt;§1.26
gtt;?12.94;gct;$21.94;gac;$19.89;ggc;*17.86;;gtt;?1.45;gct;$2.46;gac;$2.23;ggc;*2.00
tta;°7.49;tca;°7.33;taa;ù0.95;tga;ù1.77;;tta;°0.84;tca;°0.82;taa;ù−;tga;ù0.20
ata;°7.14;aca;§9.06;aaa;*17.89;aga;§8.63;;ata;°0.8;aca;§1.02;aaa;*2.01;aga;§0.97
cta;£6.15;cca;?12.59;caa;§11.92;cga;°7.71;;cta;£0.69;cca;?1.41;caa;§1.34;cga;°0.87
gta;°8.04;gca;*13.92;gaa;*14.89;gga;?13.18;;gta;°0.9;gca;*1.56;gaa;*1.67;gga;?1.48
ttg;°8.32;tcg;£5.54;tag;ù1.03;tgg;§11.85;;ttg;°0.93;tcg;£0.62;tag;ù−;tgg;§1.33
atg;$27.7;acg;£6.08;aag;$20.59;agg;§10.05;;atg;$3.11;acg;£0.68;aag;$2.31;agg;§1.13
ctg;§9;ccg;£5.13;cag;*13.86;cgg;£4.67;;ctg;§1.01;ccg;£0.58;cag;*1.56;cgg;£0.52
gtg;?12.68;gcg;°7.73;gag;*17.73;ggg;°7.37;;gtg;?1.42;gcg;°0.87;gag;*1.99;ggg;°0.83
;;;;;;;;;;;;;;;;
I 1;B4032m. Multiplicité des bactéries;;;;;;;;Sensibilité relative en %.  -10, 521.;;;;;;;
ttt;&0.25;tct;&0.12;tat;&0.10;tgt;&0.07;;ttt;27;tcc;93;tat;77;tgt;123
att;&0.12;act;&2.55;aat;&0.12;agt;&0.02;;atc;77;acc;3;aat;81;agt;436
ctt;&9.15;cct;&0.25;cat;&0.10;cgc;@8.26;;ctc;-1;ccc;15;cat;48;cgc;-1
gtt;&0.22;gct;&0.05;gat;&0;ggt;&0.02;;gtc;40;gcc;187;gat;−;ggt;436
ttc;*1.51;tcc;§1.12;tac;*1.59;tgc;§1.11;;ttc;&12;tct;&17;tac;&17;tgc;*136
atc;$2.28;acc;§1.12;aac;$2.17;agc;§1.10;;att;&-23;act;&30;aac;&4;agc;&18
ctc;§0.95;ccc;£0.68;cac;*1.17;cgt;$1.85;;ctt;&28;cct;?90;cac;&25;cgt;&-32.3
gtc;§1.10;gcc;§1.03;gac;$2.24;ggc;$2.30;;gtt;&32.1;gct;*138;gac;&0;ggc;&-13
tta;*1.18;tca;*1.31;taa;ù−;tga;ù0.33;;tta;&-29;tca;§-37.4;taa;−;tga;-39
ata;ù0.01;aca;*1.46;aaa;$2.26;aga;*1.19;;ata;−;aca;§-30;aaa;&-11;aga;&-19
cta;*1.23;cca;*1.35;caa;*1.58;cga;£0.22;;cta;§-44;cca;&5;caa;&-16;cga;*293
gta;$2.2;gca;$2.53;gaa;$2.4;gga;*1.37;;gta;?-59;gca;§-38;gaa;&-30;gga;&8
ttg;§0.99;tcg;£0.65;tag;ù−;tgg;§1.08;;ttg;&-6;tcg;&-4;tag;−;tgg;&23
atg;$4.47;acg;£0.68;aag;£0.6;agg;§0.86;;atg;&-30;acg;&0;aag;*284;agg;&31.8
ctg;*1.29;ccg;£0.54;cag;£0.59;cgg;§0.83;;ctg;&-21;ccg;&6;cag;*163;cgg;§-37
gtg;£0.33;gcg;£0.3;gag;£0.34;ggg;£0.56;;gtg;*337;gcg;*186;gag;*478;ggg;§47
Bactéries de la base gtRNAdb et champignons C42t diff[modifier | modifier le wikicode]

Légende:

C42tm. Multiplicité de C42t-tg;;;;;;;;;C42tm4. C42tm / 4.17;;;;;;;
ttt;&0.05;tcc;@0.02;tat;&0.05;tgt;&0.02;;ttt;&0.01;tcc;@0;tat;&0.01;tgt;&0
atc;@0.14;acc;@0;aat;&0.05;agt;&0;;atc;@0.03;acc;@0;aat;&0.01;agt;&0
ctc;@0.43;ccc;@0.02;cat;&0;cgc;@0;;ctc;@0.1;ccc;@0;cat;&0;cgc;@0
gtc;@0.02;gcc;@0;gat;&0.05;ggt;&0.05;;gtc;@0;gcc;@0;gat;&0.01;ggt;&0.01
ttc;$7.05;tct;$7.38;tac;*6.00;tgc;§3.4;;ttc;$1.69;tct;$1.77;tac;*1.44;tgc;§0.82
att;$9.00;act;$7.90;aac;$7.07;agc;§3.69;;att;$2.16;act;$1.89;aac;$1.7;agc;§0.88
ctt;*4.05;cct;§3.69;cac;*5.24;cgt;*5.67;;ctt;*0.97;cct;§0.88;cac;*1.26;cgt;*1.36
gtt;$9.55;gct;$9.26;gac;$9.74;ggc;$11.6;;gtt;$2.29;gct;$2.22;gac;$2.34;ggc;$2.78
tta;§3.14;tca;§2.19;taa;ù0.02;tga;ù0.29;;tta;§0.75;tca;§0.53;taa;ù0;tga;ù0.07
ata;£1.4;aca;§2.38;aaa;§3.69;aga;*4.93;;ata;£0.34;aca;§0.57;aaa;§0.88;aga;*1.18
cta;£1.79;cca;*4.88;caa;*4.67;cga;§2.19;;cta;£0.43;cca;*1.17;caa;*1.12;cga;§0.53
gta;£1.52;gca;*3.36;gaa;*6.00;gga;§3.48;;gta;£0.36;gca;§0.81;gaa;*1.44;gga;§0.83
ttg;*4.52;tcg;£1.9;tag;ù0.02;tgg;*4.12;;ttg;*1.08;tcg;£0.46;tag;ù0;tgg;*0.99
atg;$7.71;acg;£1.57;aag;$10.14;agg;£1.64;;atg;$1.85;acg;£0.38;aag;$2.43;agg;£0.39
ctg;§2.12;ccg;£0.86;cag;§3.55;cgg;£1.31;;ctg;§0.51;ccg;£0.21;cag;§0.85;cgg;£0.31
gtg;§2.24;gcg;£1.43;gag;$7.05;ggg;£1.64;;gtg;§0.54;gcg;£0.34;gag;$1.69;ggg;£0.39
;;;;;;;;;;;;;;;;
I 1;B4032m. Multiplicité des bactéries;;;;;;;;Sensibilité relative en %.  -16.1, 263.;;;-123;320;;;
ttt;&0.25;tct;&0.12;tat;&0.1;tgt;&0.07;;ttt;4;tcc;3;tat;12;tgt;6
att;&0.12;act;&2.55;aat;&0.12;agt;&0.02;;atc;29;acc;-1;aat;10;agt;-1
ctt;&9.15;cct;&0.25;cat;&0.1;cgc;@8.26;;ctc;0;ccc;1;cat;-1;cgc;-1
gtt;&0.22;gct;&0.05;gat;&0;ggt;&0.02;;gtc;1;gcc;-1;gat;-;ggt;52
ttc;*1.51;tcc;§1.12;tac;*1.59;tgc;§1.11;;ttc;&12;tct;?58;tac;&-10;tgc;&-27
atc;$2.28;acc;§1.12;aac;$2.17;agc;§1.10;;att;&-5;act;?69;aac;&-22;agc;&-19
ctc;§0.95;ccc;£0.68;cac;*1.17;cgt;$1.85;;ctt;&2;cct;&30;cac;&7;cgt;&-27
gtc;§1.10;gcc;§1.03;gac;$2.24;ggc;$2.3;;gtt;*108;gct;*115;gac;&4;ggc;&21
tta;*1.18;tca;*1.31;taa;ù−;tga;ù0.33;;tta;§-36;tca;?-60;taa;−;tga;-79
ata;ù0.01;aca;*1.46;aaa;$2.26;aga;*1.19;;ata;−;aca;?-61;aaa;?-61;aga;&-1
cta;*1.23;cca;*1.35;caa;*1.58;cga;£0.22;;cta;?-65;cca;&-13;caa;&-29;cga;*139
gta;$2.2;gca;$2.53;gaa;$2.4;gga;*1.37;;gta;?-83;gca;?-68;gaa;§-40;gga;§-39
ttg;§0.99;tcg;£0.65;tag;ù−;tgg;§1.08;;ttg;&9;tcg;&-30;tag;−;tgg;&-9
atg;$4.47;acg;£0.68;aag;£0.60;agg;§0.86;;atg;?-59;acg;§-45;aag;*304;agg;?-54
ctg;*1.29;ccg;£0.54;cag;£0.59;cgg;§0.83;;ctg;?-60;ccg;?-62;cag;§44;cgg;?-62
gtg;£0.33;gcg;£0.3;gag;£0.34;ggg;£0.56;;gtg;?65;gcg;&13;gag;*391;ggg;&-30

Tableaux des génomes, corrélations et indice double[modifier | modifier le wikicode]

E79-Genomes. Correlations et indices des doublons[modifier | modifier le wikicode]

E79;;;acs;;aga;;aml;;ath;;bacu;;bdi;;bta;;cbr;;cbre;;cel;;cfa;;cge;;cjap;;cjc;;cmk;;cpic;;cpo;;csi;;dme;;dno;;dsi;;dya;;ecb;;eeu;;fca;;gac;;gfr;;gga;;ggo;;gmo;;gmx;;hgl;;homo-18;;lav;;lcm;;lma;;mcc;;mdo;;meu;;mgp;;mlu;;mmr;;mmu;;mpu;;mtr;;mun;;nle;;oaa;;oas;;ocu;;oga;;oni;;opr;;osa;;pan;;pfa;;pha;;pma;;pop;;ppp;;ppy;;ptr;;rno;;san;;sbi;;sbq;;shr;;spu;;ssc;;str;;tgu;;tma;;tng;;tru;;tsy;;ttr;;vvi;;xtr;;zma;;;dre;
;;;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;;double;dif
Phe;AAA;ttt;0;−;0;−;0;−;0;−;0;−;0;−;0;5;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;2;0;1;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;5;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;0;0;0;0;0;0;−;0;0;0;−;0;−;0;−;0;0;0;−;0;−;0;1;1;4;0;1;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;1;0;−;0;0;0;1;0;0;0;0;0;0;0;−;0;−;0;1;0;1;0;0;;0;9
Val;AAC;gtt;2;2;24;6;8;1;12;2;5;8;11;4;7;12;18;6;30;2;15;3;2;3;4;8;19;3;3;3;6;15;1;14;4;1;5;5;4;1;4;7;5;1;5;1;7;4;3;3;4;3;9;11;0;1;2;4;2;6;8;12;15;6;1;10;4;5;7;33;0;2;1;0;3;6;6;2;5;2;0;2;3;1;2;1;2;5;3;4;11;5;1;2;4;6;7;15;3;3;4;7;3;2;6;1;2;4;11;6;4;4;0;0;5;3;96;69;13;3;10;2;4;5;6;4;3;4;5;1;9;6;2;3;7;0;17;2;4;5;4;13;1;7;3;7;3;6;8;10;1;4;1;6;8;6;36;18;11;10;;146;85
Leu;AAG;ctt;2;1;3;1;2;4;9;2;4;1;7;6;6;4;21;4;29;2;14;5;3;0;3;1;22;3;4;3;6;13;0;1;3;1;3;2;3;0;3;1;4;0;4;0;5;1;4;1;5;0;31;17;1;2;0;2;4;4;11;21;15;0;2;2;5;3;4;17;1;2;2;0;2;6;5;2;2;2;0;0;1;1;3;1;2;2;4;1;3;5;0;2;4;5;3;4;3;2;2;2;3;0;5;8;2;2;11;3;4;3;0;0;4;4;56;55;13;35;5;0;6;9;5;5;0;0;4;1;11;3;4;2;6;2;5;12;5;2;3;2;0;1;3;4;2;12;3;7;3;2;5;0;5;4;20;17;19;9;;124;145
Ile;AAT;att;4;1;10;1;7;4;15;1;6;5;13;6;14;3;17;3;31;1;19;1;4;4;10;2;20;5;5;7;8;22;2;8;7;2;7;5;8;1;6;5;6;2;8;1;13;6;7;1;8;1;84;16;4;1;6;0;5;8;5;20;12;18;5;2;5;9;13;29;1;5;2;0;4;7;12;0;4;1;1;1;6;3;2;1;7;4;6;3;14;8;3;1;4;8;10;16;3;2;6;4;6;3;12;12;6;1;14;3;5;8;0;0;5;6;47;62;14;5;9;2;7;8;6;10;5;6;7;7;14;2;6;4;10;0;57;11;12;0;6;7;5;34;5;7;8;9;9;2;5;2;5;5;9;5;45;17;32;36;;129;128
Cys;ACA;tgt;0;−;0;−;0;−;0;−;0;1;0;−;9;133;0;−;0;1;0;−;0;−;0;−;0;−;0;−;0;0;0;4;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;0;0;4;0;−;0;1;0;3;0;−;0;−;0;−;0;0;0;0;0;−;0;0;0;−;0;0;0;−;0;15;0;−;0;−;0;0;0;−;0;0;0;3;0;−;0;1;0;−;0;0;0;−;0;−;0;0;0;−;0;−;0;−;0;0;0;−;0;−;0;0;0;−;0;0;0;4;0;−;0;−;0;0;1;4;0;0;0;1;0;0;;0;8
Gly;ACC;ggt;0;−;0;−;0;−;0;−;1;10;0;−;0;19;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;1;0;−;0;−;0;−;0;−;0;23;0;−;0;−;0;−;0;−;0;1;0;−;0;−;0;−;0;−;0;−;0;−;0;3;0;−;0;3;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;1;0;−;0;0;0;−;0;−;0;1;0;4;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;6;0;0;0;8;0;−;0;−;0;−;1;17;0;−;0;−;0;−;;0;10
Arg;ACG;cgt;2;1;9;0;5;2;4;6;3;5;12;3;7;5;17;4;28;3;14;3;1;4;3;2;17;3;4;1;4;4;2;4;4;2;4;5;9;0;5;4;8;0;11;0;6;3;3;2;5;3;37;11;1;4;4;3;3;3;8;22;11;1;2;2;5;1;4;9;2;1;3;0;3;2;0;4;2;4;0;1;1;4;2;3;3;2;3;2;5;6;1;1;4;2;4;7;0;1;4;2;2;3;12;3;4;2;17;6;4;2;0;−;3;3;55;29;4;7;5;2;4;2;5;1;3;2;4;4;11;3;4;1;0;3;20;8;5;1;3;2;2;3;3;4;10;3;13;2;3;2;2;4;1;9;20;12;25;9;;147;55
Ser;ACT;agt;0;−;0;−;0;1;0;−;0;−;0;−;0;3;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;2;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;1;0;−;0;−;0;−;0;−;0;0;0;−;0;1;0;−;0;2;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;7;10;0;−;0;−;0;1;0;1;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;2;0;0;0;−;0;−;0;−;0;−;17;8;0;−;0;−;1;1;0;4;0;0;0;−;0;−;0;−;0;−;0;−;0;−;;3;10
Ser;AGA;tct;4;0;4;1;6;3;26;10;3;6;8;2;8;4;14;2;16;3;11;3;5;4;5;0;14;4;5;3;12;13;2;21;6;1;8;4;5;2;7;2;5;2;6;2;8;3;5;1;5;2;38;13;1;0;4;4;6;4;12;17;10;4;2;4;5;3;9;19;0;2;0;0;5;3;6;5;6;1;2;2;4;1;1;5;5;4;5;2;7;4;0;3;3;6;0;−;1;0;7;2;2;3;6;3;5;1;7;4;6;3;0;0;6;2;14;7;8;5;10;2;3;7;6;5;2;8;4;3;8;2;6;2;7;2;0;−;6;3;6;8;2;0;4;9;5;8;5;5;3;3;3;8;4;8;23;16;8;4;;160;175
Ala;AGC;gct;6;5;13;3;3;13;13;2;2;17;16;2;12;18;22;6;33;1;16;5;3;10;5;16;23;7;2;12;19;55;1;9;4;23;7;15;10;1;7;15;8;0;14;3;11;15;4;9;4;13;31;21;9;6;13;10;3;19;24;30;21;2;1;44;10;15;14;39;3;1;1;0;4;17;9;5;4;8;4;2;3;4;3;7;4;18;2;12;15;9;7;1;2;16;32;50;7;10;7;13;5;7;11;6;4;10;16;3;4;15;0;0;3;15;62;43;18;1;10;8;3;18;5;25;5;30;2;7;14;12;3;11;10;7;21;10;5;17;4;251;8;9;4;15;7;12;7;4;2;9;5;13;9;1;50;16;34;31;;66;25
Pro;AGG;cct;2;0;2;4;7;1;11;4;5;1;11;3;11;1;2;3;13;11;2;3;7;0;6;0;7;1;6;0;1;10;4;7;6;1;8;1;6;0;6;0;5;0;5;0;9;0;8;1;6;1;58;4;3;0;6;0;5;4;25;29;16;4;4;8;7;1;9;6;2;9;1;0;6;1;10;0;4;2;5;1;5;0;6;0;5;2;8;0;6;0;0;2;5;3;13;5;3;0;8;0;6;0;10;3;7;0;10;3;5;3;0;0;5;1;36;17;12;1;11;1;8;2;4;6;10;22;7;0;9;4;5;3;8;1;14;4;8;0;7;4;3;2;7;3;4;8;7;2;5;1;4;2;9;5;42;17;11;3;;177;137
Thr;AGT;act;1;2;7;0;4;5;7;2;4;8;2;6;4;9;20;1;26;4;14;2;2;5;1;6;17;6;1;8;7;16;1;15;0;9;3;6;6;2;1;9;7;0;7;0;2;6;2;6;3;5;49;49;2;2;0;3;2;6;10;19;3;5;0;14;3;5;1;12;3;7;2;0;3;6;6;5;3;4;0;3;2;2;0;2;2;8;2;7;8;1;1;3;3;8;7;15;0;4;2;5;1;7;6;11;1;5;8;2;4;6;0;−;4;5;29;32;2;4;8;1;4;7;2;7;2;6;2;5;3;8;2;6;4;4;14;12;6;6;2;31;2;5;1;14;9;16;7;10;2;6;2;6;4;5;76;74;7;12;;177;181
Tyr;ATA;tat;0;−;0;−;0;−;0;−;0;−;0;0;0;10;0;−;0;1;0;−;0;−;0;−;0;−;0;0;0;0;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;3;0;−;0;−;0;−;0;0;0;0;0;1;0;−;0;0;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;2;0;−;0;−;0;−;0;1;0;−;0;−;0;2;0;−;0;1;0;3;0;−;0;−;0;−;0;−;0;−;0;1;0;4;0;−;0;−;0;0;0;1;0;−;0;−;0;−;0;−;0;−;0;0;0;3;0;0;0;−;0;0;0;3;0;−;0;−;;1;3
Asp;ATC;gat;0;−;0;−;0;0;0;−;1;18;0;−;0;5;0;−;0;−;0;−;0;1;0;−;0;−;0;0;0;5;0;−;0;0;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;0;0;−;0;1;0;−;0;−;0;0;0;−;0;0;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;1;0;0;0;−;0;−;0;−;0;0;0;1;0;−;0;0;0;1;0;−;0;0;0;0;0;0;1;0;0;−;0;1;0;0;0;−;0;−;1;8;0;5;0;−;0;0;0;−;0;0;0;0;0;9;0;2;0;−;0;0;;4;6
His;ATG;cat;0;−;0;−;0;−;0;−;0;−;0;2;0;3;0;−;0;0;0;−;0;−;0;−;0;−;0;0;0;0;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;0;0;−;0;1;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;2;0;−;0;−;0;−;0;−;0;0;0;−;0;4;0;−;0;0;0;0;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;1;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;1;0;0;0;−;0;0;0;0;0;0;;0;−
Asn;ATT;aat;0;−;0;−;0;5;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;1;0;0;0;−;0;1;0;−;0;−;0;−;0;0;0;0;0;−;0;4;0;0;0;0;0;−;0;1;0;1;0;1;0;−;0;−;0;3;0;2;0;−;0;1;0;−;0;−;0;−;0;−;0;−;0;−;0;5;4;43;0;−;0;2;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;1;0;−;0;0;0;−;0;−;0;0;1;0;0;1;0;−;0;−;0;0;0;−;0;−;0;−;0;1;0;0;0;2;0;0;0;−;0;−;0;0;0;−;0;0;0;0;0;−;;9;14
Leu;CAA;ttg;1;0;0;3;2;6;6;5;0;7;9;6;0;13;1;9;2;11;0;6;0;4;0;3;0;6;0;6;1;29;1;5;0;5;0;5;0;3;1;6;0;3;0;3;0;5;0;5;0;7;1;5;0;1;0;2;0;8;0;14;10;7;0;4;0;6;3;13;0;3;0;0;1;7;1;2;0;7;0;1;0;2;0;2;0;3;0;5;5;8;0;2;0;5;0;9;0;6;0;2;0;4;0;6;0;3;14;4;0;8;0;0;1;5;18;23;0;2;3;2;0;6;0;6;0;−;0;3;4;4;0;6;0;2;6;11;1;4;0;9;0;3;0;9;0;11;0;9;0;3;0;6;4;9;6;15;12;7;;123;117
Val;CAC;gtg;2;0;21;7;7;1;6;1;8;23;8;2;12;26;3;2;7;7;4;1;5;2;3;5;8;4;4;6;37;1502;0;5;3;2;4;10;5;1;5;75;4;1;8;2;9;5;2;1;6;2;7;10;1;1;2;4;5;5;9;18;11;1;3;2;7;5;9;25;1;2;1;0;4;7;6;2;3;3;0;2;4;0;3;1;4;7;3;3;2;4;2;1;4;8;5;4;2;6;10;3;3;1;7;1;5;1;7;3;6;5;0;0;6;5;46;24;6;4;2;8;7;10;4;9;2;4;3;3;8;2;2;5;6;3;0;−;7;4;3;35;0;0;3;12;7;8;16;12;2;3;3;18;6;4;25;27;13;2;;131;95
Leu;CAG;ctg;2;1;8;1;2;4;2;0;3;3;7;0;3;2;2;4;3;4;3;1;4;2;5;4;5;6;3;8;5;19;2;3;4;1;2;1;7;0;6;3;8;0;7;0;1;1;2;3;2;2;6;2;2;4;2;4;1;3;13;33;6;0;1;3;7;1;4;5;0;7;1;0;2;3;5;5;1;4;1;2;3;1;4;2;6;3;2;2;2;1;0;5;3;5;5;12;0;1;10;5;5;3;8;7;8;2;8;1;6;5;0;0;1;4;37;37;5;1;3;1;3;7;2;6;2;2;3;9;7;3;2;2;5;3;2;2;3;1;2;1;3;3;1;3;18;18;14;6;3;3;1;4;4;2;17;14;10;2;;161;138
Met;CAT;atg;4;7;13;4;11;12;16;15;8;12;25;30;16;18;18;4;24;4;16;2;6;16;7;8;25;4;7;12;20;73;5;10;5;9;11;14;8;3;10;19;8;3;11;3;12;12;10;5;9;14;221;64;2;3;8;5;10;6;42;111;22;13;6;7;11;8;16;33;3;7;2;1;5;13;14;10;7;6;7;3;8;5;8;5;8;10;6;13;18;22;6;2;7;9;14;17;4;13;8;9;5;7;20;6;11;3;31;28;8;10;0;1;9;5;187;90;18;7;15;8;9;12;9;13;7;5;7;7;9;29;8;6;14;7;43;29;12;10;7;6;2;2;7;13;8;11;24;11;7;4;6;10;6;19;99;38;31;47;;348;173
Trp;CCA;tgg;3;3;5;0;3;6;11;4;13;242;12;5;5;172;12;0;19;2;9;2;0;5;2;3;14;3;1;9;10;19;1;8;1;6;4;3;6;1;3;11;7;1;6;1;3;3;2;4;1;21;47;26;0;2;3;2;2;6;10;18;15;2;1;4;2;4;6;16;2;12;0;0;3;5;3;5;1;6;2;2;2;1;2;3;2;5;2;8;7;6;1;2;0;9;5;8;2;44;3;6;0;5;7;4;2;3;11;6;4;5;0;−;3;4;1;7;12;1;8;0;1;8;3;4;1;6;1;4;10;2;1;6;3;4;5;12;3;3;3;3;0;2;2;10;5;6;7;9;2;3;9;207;9;0;21;11;20;6;;22;21
Gly;CCC;ggg;1;0;0;−;2;4;4;0;103;2044;8;0;29;1265;0;4;11;13;2;0;2;6;2;4;0;1;1;3;7;73;1;0;1;4;3;5;0;−;4;321;0;−;0;0;3;4;2;2;1;4;1;2;1;2;2;1;4;4;4;13;6;2;1;1;2;2;2;69;1;0;0;0;3;4;6;1;2;2;1;1;1;1;0;1;2;4;1;2;1;1;0;0;1;8;4;4;2;338;5;10;2;0;2;6;3;1;4;4;3;5;0;−;3;4;4;1;6;0;3;7;2;10;2;13;1;3;1;0;4;1;0;3;3;2;1;2;2;3;1;18;0;3;2;87;1;4;1;2;1;5;70;1695;3;2;70;34;9;1;;87;180
Arg;CCG;cgg;0;0;0;−;2;4;1;2;1;19;2;3;3;12;0;−;13;10;0;0;1;2;0;2;0;0;1;2;0;1;0;2;0;2;2;1;0;−;0;4;0;−;0;−;2;1;1;1;0;23;0;1;0;−;0;1;2;2;3;6;1;3;0;3;2;1;0;2;0;0;0;0;2;1;1;2;0;2;0;1;0;1;0;1;0;2;2;2;1;1;0;0;1;1;3;10;0;5;1;2;0;2;0;5;1;2;3;4;2;1;0;−;2;1;4;5;1;4;2;2;4;2;2;2;0;2;1;1;4;2;1;1;0;2;0;0;2;0;0;2;0;−;1;5;0;1;0;3;1;1;0;11;0;5;2;5;3;2;;24;34
Arg;CCT;agg;0;2;0;1;1;43;4;3;0;66;4;5;2;113;1;0;4;6;1;2;1;27;1;4;2;0;1;3;5;6;0;9;1;3;0;6;2;0;1;45;1;1;2;1;1;5;1;5;1;51;21;4;0;1;0;2;1;4;7;20;10;2;1;3;0;4;2;13;0;7;0;0;1;5;1;3;0;3;1;1;0;4;0;2;1;3;0;20;2;3;1;2;1;3;2;6;1;31;1;4;0;4;12;5;1;4;6;4;1;3;0;−;1;3;25;24;7;3;5;4;2;6;1;3;2;5;2;3;7;2;1;3;1;2;7;11;0;3;1;4;0;1;0;12;6;4;5;4;0;3;1;52;4;3;18;8;5;5;;75;28
Ser;CGA;tcg;0;1;7;0;0;3;3;3;0;3;4;0;0;6;4;3;3;5;3;2;1;6;0;2;10;4;0;3;0;47;1;8;1;2;0;3;3;0;0;5;2;0;4;0;0;3;0;2;0;4;23;5;0;0;1;0;0;4;1;12;4;1;0;2;0;3;1;2;0;2;0;0;0;3;0;2;0;1;0;0;0;1;0;2;0;2;0;3;1;0;0;1;0;4;1;6;0;2;1;3;0;2;1;4;1;2;3;5;0;2;0;0;0;2;18;16;1;3;5;1;1;4;0;3;0;2;0;3;4;5;0;2;0;2;1;4;0;3;0;5;0;0;1;2;1;1;0;4;0;2;0;3;2;0;13;9;3;2;;36;43
Ala;CGC;gcg;0;2;4;1;1;3;4;2;1;18;9;1;2;13;2;4;2;3;0;3;0;3;1;4;7;0;1;2;100;3757;0;3;0;4;1;4;2;0;1;15;3;1;2;2;1;6;0;3;1;5;41;14;0;1;0;3;0;4;6;19;5;2;1;4;0;3;0;14;1;1;1;0;1;3;2;3;2;2;0;2;0;2;0;2;3;6;1;3;0;2;0;1;1;3;3;7;1;5;0;3;1;1;4;7;1;2;8;4;1;3;0;0;1;3;18;5;2;2;6;1;1;2;0;4;0;3;1;1;9;1;1;3;2;1;4;2;1;5;1;16;0;2;1;4;0;3;0;5;1;1;1;19;3;1;15;20;11;10;;86;25
Pro;CGG;ccg;1;0;7;5;3;1;2;2;2;1;5;2;3;0;2;1;4;4;3;0;2;1;2;0;7;0;3;0;0;40;0;1;2;0;2;1;2;2;1;2;2;2;3;1;1;1;2;0;2;4;13;4;0;0;1;1;3;0;10;11;3;1;1;1;2;1;2;0;0;3;1;0;2;0;2;0;1;0;0;0;2;0;2;0;2;0;1;0;0;0;0;1;3;0;4;2;0;0;3;0;2;0;2;1;3;0;3;5;3;0;0;0;3;0;12;8;2;1;0;4;3;1;3;1;2;0;1;0;4;3;3;0;2;0;4;4;2;0;2;0;1;0;2;0;1;3;2;3;1;2;2;1;1;2;19;16;5;3;;89;90
Thr;CGT;acg;0;0;3;2;0;9;2;3;0;3;2;3;0;6;5;3;6;3;2;4;0;4;0;3;8;2;0;3;4;132;0;4;0;2;0;4;2;0;0;6;2;1;4;0;0;2;0;3;0;8;14;8;0;0;0;1;1;4;7;22;2;1;0;3;0;4;0;9;0;1;1;0;0;3;0;2;0;2;0;−;0;2;0;1;0;3;0;4;0;0;0;−;0;4;2;7;0;2;0;4;0;2;1;6;0;6;3;1;0;6;0;0;0;5;11;11;2;1;3;2;0;6;0;5;0;3;0;4;3;2;0;4;0;1;4;4;0;3;0;6;0;1;0;3;3;9;1;6;0;3;0;2;1;1;15;13;4;1;;24;41
Stp;CTA;tag;0;−;0;−;0;9;0;−;0;8;0;−;0;12;0;−;0;−;0;−;0;2;0;−;0;−;0;2;0;3;0;1;0;0;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;11;0;−;0;−;0;−;0;2;0;3;0;−;0;−;0;−;0;−;1;1;0;−;0;1;0;−;0;−;0;−;0;−;0;−;0;−;0;4;0;−;0;−;0;4;0;−;0;2;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;1;0;1;0;3;0;−;0;0;0;1;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;7;0;−;0;0;0;3;;3;5
Glu;CTC;gag;1;3;12;2;3;33;9;3;21;446;16;2;3;160;21;8;34;2;19;4;6;15;6;13;31;8;6;8;22;405;2;2;4;0;4;72;10;4;7;37;6;3;11;2;3;47;5;3;3;40;28;24;4;1;5;1;2;6;20;29;17;6;3;0;6;1;6;17;2;5;1;0;2;3;10;2;5;1;3;2;5;0;4;3;8;5;4;14;8;2;0;0;7;9;13;13;3;56;14;4;6;1;13;1;7;3;14;10;7;2;0;0;3;0;8;2;13;7;7;7;5;5;6;6;5;2;9;4;17;8;3;6;8;1;19;9;5;7;3;3;1;1;0;18;8;4;14;6;3;6;8;386;12;13;32;18;16;13;;158;86
Gln;CTG;cag;2;2;5;5;4;20;4;4;4;15;8;2;8;31;6;3;6;4;4;2;4;15;5;5;11;4;5;7;8;9;1;9;3;4;4;7;4;3;3;6;4;3;3;4;6;5;2;5;2;44;61;19;1;1;2;2;5;15;22;22;8;4;3;2;6;6;5;22;2;6;2;0;4;9;8;2;1;5;0;0;2;4;7;4;5;6;3;13;2;2;0;4;3;13;5;13;3;5;8;6;5;3;7;3;6;5;3;6;4;9;0;0;4;6;60;47;4;6;8;1;4;19;7;13;4;5;4;2;5;7;3;7;7;2;10;10;4;7;4;1;4;1;4;5;13;4;8;5;3;2;7;7;3;7;30;9;6;6;;143;122
Lys;CTT;aag;3;2;15;1;12;759;14;4;5;23;16;1;15;24;36;3;45;3;24;5;10;397;11;74;30;6;4;11;11;24;2;6;7;18;6;15;12;0;13;29;10;0;12;3;8;7;28;120;8;878;74;22;1;5;4;1;5;13;20;22;20;1;4;10;5;9;14;21;4;8;2;1;7;8;10;8;8;2;1;1;4;6;4;1;7;18;5;265;13;2;3;9;6;13;10;14;5;10;9;19;4;4;22;20;4;6;15;4;6;10;0;−;6;5;13;9;15;1;11;4;8;18;8;17;10;8;6;6;15;6;3;6;9;22;30;11;7;8;7;4;1;4;7;8;10;10;13;6;0;6;3;15;5;10;74;22;36;90;;490;462
Phe;GAA;ttc;4;0;8;0;8;2;16;4;4;8;13;4;12;17;16;5;18;5;10;4;4;5;4;3;19;4;4;3;10;24;2;19;5;2;7;5;7;0;5;6;5;2;8;0;8;3;5;2;4;7;23;11;4;1;5;4;5;7;12;23;17;4;4;1;5;4;13;18;1;5;1;0;5;4;8;3;3;6;2;3;3;1;6;1;4;2;6;4;20;5;2;3;4;12;6;17;2;3;6;7;4;1;9;13;4;5;13;6;9;4;0;0;9;2;34;22;15;2;11;2;5;12;5;10;4;3;5;4;16;4;5;4;6;6;0;−;11;9;6;3;6;3;3;7;9;9;10;12;1;4;4;7;11;11;40;17;17;7;;110;86
Val;GAC;gtc;0;−;0;−;0;−;1;0;0;0;2;1;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;2;0;15;0;−;0;0;0;0;0;−;0;0;0;−;0;−;0;2;0;−;0;−;0;0;0;0;0;0;0;0;0;−;0;0;0;0;0;−;0;0;0;−;0;−;0;2;0;−;0;−;0;0;0;−;0;−;0;0;0;−;0;2;0;0;0;0;0;0;0;−;0;−;0;−;0;−;0;−;13;3;0;1;0;−;0;0;0;0;0;−;0;−;0;0;0;0;0;−;0;−;0;2;0;0;0;−;0;−;0;0;0;2;0;1;0;−;0;−;0;−;0;−;0;2;0;0;0;−;11;0;;2;3
Leu;GAG;ctc;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;1;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;0;0;0;0;0;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;1;0;0;−;;2;1
Ile;GAT;atc;0;−;0;−;0;−;1;0;0;0;0;1;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;2;0;−;0;0;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;2;0;−;0;−;0;−;2;0;0;−;0;−;0;−;0;5;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;2;0;−;0;−;0;0;0;8;0;−;0;−;0;−;0;1;0;−;0;1;0;−;0;0;0;−;3;2;0;2;0;−;0;−;0;−;0;0;0;−;0;1;0;−;0;5;0;4;0;0;0;−;0;−;0;−;0;−;0;1;0;4;0;−;;1;8
Cys;GCA;tgc;8;3;4;0;13;11;4;13;5;18;6;8;25;312;14;1;16;4;11;1;9;11;24;16;12;2;9;22;5;9;4;13;18;15;4;19;3;3;9;12;4;2;5;2;10;14;14;19;13;18;72;34;5;4;6;4;5;29;8;18;13;0;5;17;6;22;5;22;3;13;0;0;8;19;31;14;19;9;2;2;17;9;11;8;32;27;15;9;7;2;0;4;9;13;18;18;5;55;9;15;10;10;8;33;6;3;8;8;12;17;0;−;13;14;38;29;8;5;2;4;9;24;9;23;26;13;13;11;6;6;10;10;2;5;20;10;10;12;29;18;5;3;2;19;7;7;5;9;6;18;2;19;5;5;46;45;10;14;;98;37
Gly;GCC;ggc;5;1;14;0;8;1;16;8;13;50;19;8;8;54;16;4;25;13;10;3;8;2;9;4;24;9;9;5;12;6;5;5;6;4;8;1;12;1;10;8;13;1;14;1;9;0;10;3;7;2;10;1;7;0;5;1;5;7;17;12;26;2;6;3;9;4;7;25;2;4;3;0;6;8;19;4;7;8;4;0;6;1;8;2;9;5;7;1;19;3;4;5;5;7;17;22;3;26;18;2;7;4;8;4;11;5;19;8;10;9;0;−;6;6;29;24;21;4;13;2;8;5;6;6;7;3;11;10;18;5;7;4;16;2;26;15;9;9;7;5;7;4;5;17;5;8;15;2;9;4;6;36;11;5;70;14;30;2;;391;444
Arg;GCG;cgc;0;−;0;−;0;0;0;−;0;−;0;0;0;6;0;−;0;−;0;−;0;−;0;−;0;−;2;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;8;0;−;0;−;0;−;0;−;0;1;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;1;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;0;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;0;0;−;0;0;0;−;0;2;0;−;;17;6
Ser;GCT;agc;2;2;4;1;3;9;7;8;3;9;12;5;8;10;6;2;9;4;6;2;2;5;3;5;12;2;3;4;10;22;1;18;3;6;7;5;4;1;3;6;1;1;4;3;5;6;4;2;4;7;14;15;3;2;3;3;4;3;0;−;16;11;2;4;2;5;7;68;1;6;0;1;4;3;7;1;6;3;1;4;2;2;2;4;2;5;4;7;6;8;0;7;3;5;6;11;1;5;7;2;2;4;5;4;4;2;14;5;4;6;0;0;4;4;34;30;10;5;6;2;4;3;3;5;5;6;4;3;7;5;3;3;6;1;14;2;6;3;2;4;2;2;2;33;5;5;6;12;2;6;3;7;7;1;40;58;10;3;;161;262
Ser;GGA;tcc;0;−;0;−;0;−;1;1;0;0;1;2;4;27;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;1;14;26;0;−;0;−;0;−;0;−;0;−;0;−;0;1;0;−;0;−;0;−;0;−;0;−;0;0;0;−;1;1;0;0;1;2;0;3;0;2;0;−;0;−;0;−;0;−;3;0;0;0;0;−;0;−;0;−;0;0;0;−;0;1;1;2;0;−;0;−;0;2;0;0;0;−;0;−;0;−;0;0;0;−;0;−;5;17;0;−;0;−;0;−;0;0;1;1;10;11;;0;1
Ala;GGC;gcc;0;−;0;−;0;−;0;−;0;−;0;−;0;1;0;−;0;−;0;−;0;−;0;0;0;−;0;1;3;164;0;0;0;3;0;−;0;−;0;1;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;1;0;−;0;−;0;5;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;3;0;−;0;−;0;−;0;0;0;−;0;2;0;−;0;−;0;−;0;−;0;0;0;0;0;−;0;0;0;−;0;−;0;−;0;0;0;0;0;1;0;−;4;6;0;−;0;−;0;−;0;−;1;29;0;−;0;0;0;−;0;−;0;−;0;1;0;−;0;−;0;−;;1;2
Pro;GGG;ccc;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;1;0;0;−;0;−;0;−;0;−;0;−;0;5;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;0;0;−;0;1;0;3;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;0;0;−;0;−;0;1;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;0;0;−;0;0;0;−;0;−;0;0;0;−;;4;7
Thr;GGT;acc;0;−;0;−;0;−;0;0;0;−;2;0;0;0;0;−;0;0;0;−;0;−;0;0;0;−;0;0;0;11;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;1;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;2;1;0;−;0;−;0;0;0;−;0;0;0;−;0;0;0;−;5;2;0;−;0;−;0;−;8;10;0;−;0;−;0;−;0;−;0;−;0;−;0;1;0;−;0;−;0;−;0;−;0;4;0;4;0;0;0;−;0;−;0;−;0;0;0;1;0;−;8;4;;0;−
Tyr;GTA;tac;0;5;1;20;1;9;50;32;0;13;3;13;1;37;13;5;20;7;7;11;0;8;0;10;22;1;10;24;7;28;0;4;4;10;0;10;0;8;3;10;0;9;0;8;4;9;0;12;1;8;4;12;4;7;3;12;1;21;3;46;1;19;0;6;0;12;0;18;0;7;1;1;0;30;2;12;0;7;2;3;0;4;0;7;0;10;0;8;2;10;2;4;0;18;2;25;0;15;0;11;1;6;0;17;0;9;3;16;1;22;0;0;2;12;40;49;2;15;1;6;1;27;2;28;0;1;0;8;0;13;0;14;1;9;7;16;3;13;0;8;3;9;0;14;2;10;1;13;0;9;1;16;0;18;59;47;3;17;;136;99
Asp;GTC;gac;6;1;18;1;5;5;21;7;7;37;21;4;9;32;27;6;31;2;20;6;9;3;10;4;32;8;8;5;14;34;4;9;6;3;6;6;11;2;12;8;5;0;14;2;5;4;9;3;7;1;135;48;1;3;7;2;7;7;15;14;25;7;4;5;10;2;6;13;3;15;2;0;6;8;12;11;1;11;2;0;5;2;3;1;12;3;4;3;16;13;4;4;5;7;13;13;2;5;17;5;9;3;6;3;11;2;20;10;8;6;0;0;6;3;56;33;29;4;8;2;7;5;7;9;12;2;9;9;20;3;6;4;12;6;62;19;14;82;5;2;3;3;4;10;6;12;18;5;6;6;5;43;11;11;46;12;30;11;;107;42
His;GTG;cac;3;1;16;4;7;0;6;5;7;3;14;6;14;4;18;2;21;4;13;5;7;1;11;2;12;4;5;3;10;26;2;7;6;1;8;1;4;0;6;3;4;1;4;0;8;2;4;0;8;7;33;18;0;3;2;3;6;0;10;15;15;2;5;1;8;0;14;12;2;2;1;0;10;3;8;0;6;0;0;2;4;2;3;2;7;2;5;1;10;7;0;3;7;3;4;19;3;4;8;0;7;0;9;13;4;0;16;9;9;0;0;−;9;0;15;11;9;3;6;2;7;3;8;1;9;0;6;0;8;6;5;3;8;0;17;8;7;2;4;1;2;2;7;4;4;7;10;8;5;4;4;4;5;8;24;17;18;7;;224;162
Asn;GTT;aac;6;3;10;1;10;17;10;8;17;6;10;5;16;13;20;2;28;4;17;2;8;12;8;8;20;2;9;17;16;31;5;11;9;8;10;3;9;0;17;5;5;0;10;0;9;7;5;1;7;20;82;40;1;4;5;5;9;19;16;17;12;9;5;3;8;16;14;36;2;6;2;0;6;20;9;3;10;3;2;1;7;1;4;4;8;4;4;7;14;15;4;4;7;13;10;10;8;4;11;14;8;3;8;0;9;4;17;12;9;19;0;0;8;9;100;67;11;12;9;4;11;29;9;23;8;6;8;3;9;6;5;6;12;0;30;8;10;7;7;1;3;4;5;17;6;10;10;12;6;8;7;5;7;13;28;18;31;17;;575;469
Leu;TAA;tta;0;1;1;4;1;3;3;2;1;11;2;1;0;9;2;3;4;2;1;2;0;3;0;3;0;4;0;10;1;11;0;12;0;3;0;4;0;3;0;7;0;2;1;3;0;3;0;2;0;18;4;7;0;10;0;2;1;7;1;14;4;4;0;3;0;3;1;13;0;10;0;0;1;14;0;1;0;2;0;0;0;1;0;2;2;4;0;3;3;4;1;2;0;7;3;6;0;4;1;4;0;2;0;11;0;2;1;2;0;9;0;0;0;6;2;2;1;5;1;0;0;7;2;8;0;2;0;3;0;3;0;8;0;5;5;8;0;3;0;2;1;2;0;5;1;3;0;6;29;12;0;5;2;6;11;34;2;2;;19;53
Val;TAC;gta;0;1;2;0;0;6;4;2;0;17;2;2;2;18;2;3;3;4;1;3;0;4;1;3;2;4;1;4;29;115;0;4;1;1;0;6;1;0;0;15;1;0;1;0;0;5;0;5;0;5;4;7;0;0;0;2;0;7;0;8;5;3;1;2;1;3;11;38;0;6;0;0;1;5;1;3;0;0;0;1;0;2;0;1;2;0;0;5;2;4;0;0;0;5;2;12;0;7;3;4;1;1;2;6;0;3;3;0;2;4;0;0;2;4;7;18;5;2;1;0;2;4;0;9;1;1;0;4;2;1;1;3;1;2;5;5;2;8;1;3;0;1;0;25;1;2;2;6;1;2;0;15;1;3;17;18;2;1;;171;58
Leu;TAG;cta;0;2;1;1;0;4;6;4;0;3;6;3;0;4;3;1;6;1;2;0;0;3;0;3;2;3;0;3;2;17;0;3;0;2;1;2;1;0;0;2;1;0;1;0;0;4;0;2;0;32;5;11;0;−;0;1;0;4;4;19;7;2;0;4;0;2;0;10;1;3;0;0;0;4;0;5;1;2;0;0;0;1;0;1;0;3;0;3;6;3;0;−;0;3;2;4;0;2;0;3;0;2;1;5;0;4;5;4;0;2;0;0;0;2;26;13;0;−;1;4;0;2;0;3;0;0;0;1;3;5;0;3;0;3;2;5;2;2;0;2;0;0;0;4;0;5;0;3;1;3;0;3;4;6;15;9;4;4;;110;133
Ile;TAT;ata;0;0;0;1;0;5;3;1;0;7;1;2;0;7;8;15;13;12;3;3;0;4;0;4;2;4;0;4;4;18;0;12;0;4;0;4;0;1;0;5;0;−;0;1;0;4;0;3;0;8;46;14;0;1;0;1;0;5;2;15;5;2;0;2;0;4;0;6;0;6;0;0;0;6;0;6;0;5;0;0;0;2;1;1;0;4;0;4;7;6;0;0;0;4;2;7;0;4;0;6;0;10;5;19;0;3;2;2;0;6;0;0;0;3;3;6;6;2;2;2;0;5;0;4;0;2;0;4;1;3;0;5;0;3;6;15;1;3;0;3;0;0;0;7;0;4;0;5;0;3;0;4;3;5;26;24;1;3;;22;52
SeC;TCA;tga;0;0;0;−;0;1;0;−;0;16;0;−;0;28;0;−;1;1;0;1;0;0;0;1;0;0;0;1;0;2;0;3;0;0;0;0;0;0;0;0;0;0;0;0;0;3;0;1;0;17;0;0;0;−;0;0;0;2;0;1;0;−;3;3;0;1;0;23;0;3;0;−;0;1;0;−;3;3;0;−;0;−;0;−;0;0;0;0;0;0;0;0;0;2;0;4;0;3;0;0;0;0;0;0;0;0;0;−;0;2;0;−;0;0;0;0;0;0;0;0;0;2;0;1;0;0;0;1;0;0;0;2;0;1;0;−;0;−;0;0;0;0;0;17;0;0;0;0;0;0;0;20;0;0;0;0;0;−;;2;11
Gly;TCC;gga;5;2;7;0;3;3;11;1;25;961;6;2;6;384;33;8;61;4;28;5;7;3;5;0;36;10;6;2;22;43;10;13;2;3;2;1;4;1;10;23;3;1;5;1;2;1;5;1;2;45;40;20;2;1;3;3;1;3;18;20;16;1;1;2;5;3;3;615;0;4;0;0;2;2;4;6;6;3;2;1;4;1;5;1;6;1;2;6;9;5;5;5;4;1;6;8;1;131;12;1;3;5;6;5;5;1;5;4;6;1;0;0;2;1;13;3;10;6;5;3;3;4;2;4;6;2;5;6;7;2;2;3;6;2;19;13;2;7;2;2;4;2;5;1067;5;10;7;4;2;3;19;813;7;11;53;26;8;2;;24;22
Arg;TCG;cga;0;2;4;3;2;81;4;1;1;7;4;0;1;10;4;5;11;5;4;3;0;14;2;3;6;4;0;3;3;21;1;3;0;3;1;3;6;3;1;6;2;2;5;1;1;2;1;3;7;1193;65;13;0;1;0;1;1;4;2;14;6;2;0;3;0;5;4;13;0;3;0;0;0;4;2;2;2;2;0;0;1;3;1;1;1;3;1;27;3;1;0;0;0;6;2;4;0;5;2;2;0;3;0;6;1;4;2;1;0;4;0;0;1;4;17;8;5;1;2;4;1;4;0;5;1;3;0;4;3;0;0;3;2;2;9;9;2;2;0;4;0;2;0;11;0;6;0;6;0;4;0;6;3;2;25;7;3;3;;57;49
Arg;TCT;aga;0;2;0;1;0;16;1;8;0;54;2;6;0;43;7;2;10;2;5;2;0;8;0;4;9;2;0;5;0;13;1;24;0;4;0;5;0;2;0;8;0;3;0;2;0;4;0;4;0;53;43;24;0;2;0;3;0;4;2;18;10;7;0;5;0;5;0;89;0;8;0;0;0;5;0;5;1;5;0;2;1;3;0;4;0;5;1;14;2;5;0;3;0;6;0;5;0;21;0;5;0;3;1;25;0;4;6;5;0;5;0;0;0;5;8;9;5;5;4;2;2;5;0;5;0;5;0;5;2;5;0;5;0;4;9;8;1;5;0;4;0;3;1;121;0;9;1;11;0;5;0;47;3;2;52;52;3;5;;113;138
Ser;TGA;tca;0;0;1;0;0;5;6;5;0;4;5;4;0;6;3;4;7;6;2;6;0;4;0;2;4;2;1;3;3;50;0;14;1;1;2;2;0;1;1;4;0;1;0;1;0;3;0;2;1;12;43;18;0;2;1;2;0;4;3;14;6;4;0;2;0;3;0;6;0;5;0;0;4;15;1;4;2;1;0;2;0;1;0;1;1;1;0;3;4;3;1;3;0;5;0;5;0;3;0;3;1;1;1;8;0;2;10;6;0;8;0;0;0;4;10;9;4;4;2;2;0;7;0;8;0;3;0;2;7;5;1;4;0;4;6;8;0;4;0;6;0;3;0;5;0;8;0;7;0;4;0;5;5;2;22;18;6;4;;92;116
Ala;TGC;gca;0;5;1;1;2;6;7;2;0;41;7;5;4;30;13;0;7;3;7;1;3;7;1;13;6;4;1;4;2889;3008;3;11;2;6;1;11;0;1;2;63;0;−;1;0;2;8;0;9;1;8;36;16;0;4;3;3;1;5;4;19;12;4;1;3;1;6;6;46;1;18;0;0;0;10;3;5;0;5;2;3;0;0;0;4;3;7;1;6;8;7;0;4;0;10;6;10;0;11;0;8;2;4;5;5;1;5;9;0;0;9;0;0;0;8;21;9;13;7;7;1;2;6;1;8;3;5;1;6;8;4;1;6;3;3;10;6;2;11;0;38;2;4;3;36;2;8;3;4;0;3;0;35;16;20;29;17;8;6;;265;102
Pro;TGG;cca;2;0;6;1;3;7;41;5;2;2;8;9;6;2;30;10;48;5;23;7;1;6;4;1;33;9;3;2;7;43;1;2;2;1;4;2;4;0;5;1;3;1;7;0;4;2;3;1;4;63;22;6;1;3;1;2;3;3;6;14;20;6;1;3;4;2;2;11;3;6;0;0;3;6;5;2;3;0;0;1;0;2;1;2;3;4;1;5;8;2;1;2;2;2;3;8;2;3;2;2;1;2;6;4;1;2;5;8;2;3;0;0;2;3;29;13;13;9;6;1;3;5;4;5;4;1;2;3;6;4;2;2;5;0;15;5;2;1;2;4;0;0;3;4;4;9;4;4;0;31;2;2;8;7;36;16;13;17;;108;96
Thr;TGT;aca;1;1;1;0;1;7;4;4;1;6;2;7;2;7;6;3;12;2;9;1;1;2;1;2;7;4;0;6;49;156;1;16;1;2;2;5;4;1;1;6;3;1;4;1;2;4;0;5;1;11;19;15;0;3;1;2;1;4;6;23;5;4;0;3;0;5;5;16;1;7;0;0;0;5;5;1;3;2;0;1;2;2;0;2;1;2;1;5;3;6;0;1;0;5;2;15;1;3;1;5;1;4;3;21;1;4;9;6;0;7;0;0;0;6;10;8;5;5;1;3;0;3;1;4;1;3;0;4;4;7;1;5;4;2;11;9;3;4;2;3;1;2;1;16;3;8;1;5;0;3;1;4;2;5;48;42;8;5;;151;138
Stp;TTA;taa;0;−;0;0;0;0;0;0;0;23;0;−;0;3;0;−;0;−;0;−;0;2;0;−;0;−;0;0;0;0;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;1;35;0;−;0;−;0;−;1;0;0;0;0;−;0;−;0;−;0;1;0;0;0;−;0;1;0;−;0;−;0;−;0;−;0;−;0;0;0;1;2;29;0;0;0;2;0;2;0;−;0;−;0;0;0;−;0;−;0;−;0;2;0;−;0;0;1;0;0;0;0;−;0;0;0;1;0;−;0;−;0;0;0;0;0;1;0;0;0;0;0;−;0;−;0;1;0;−;0;−;0;2;0;19;0;0;0;1;0;−;;1;4
Glu;TTC;gaa;5;1;8;2;4;6;7;8;47;2320;8;6;11;423;15;3;27;8;14;2;4;10;2;4;16;3;3;17;7;58;0;16;2;3;4;6;5;0;5;14;2;2;5;1;5;5;3;4;4;10;22;23;0;3;2;6;3;12;12;38;12;3;2;3;3;4;7;106;2;8;0;0;2;9;10;3;6;5;1;3;1;3;3;5;5;2;1;5;13;8;0;2;2;11;3;12;3;135;9;8;1;3;6;7;3;3;10;5;7;5;0;0;6;6;3;8;13;0;5;1;9;14;6;11;5;4;1;8;8;4;4;16;10;4;18;7;30;204;2;2;0;1;2;111;3;12;4;8;2;6;29;1871;5;9;60;23;12;9;;128;96
Gln;TTG;caa;0;2;2;1;1;41;6;3;2;7;7;7;2;17;19;4;29;10;15;4;1;41;1;3;11;2;0;6;1;5;1;14;2;1;2;2;2;1;2;2;2;1;3;0;2;3;1;2;5;776;47;12;0;1;0;1;1;9;3;7;10;2;0;2;2;3;3;10;1;8;0;0;1;14;0;6;1;2;0;0;0;2;1;2;1;5;2;34;10;9;1;0;2;7;3;7;0;6;2;2;1;3;1;4;2;2;9;11;2;11;0;0;2;3;23;20;10;0;3;6;0;12;3;16;1;4;2;2;3;7;0;7;16;28;10;6;3;5;2;1;0;1;2;5;4;4;3;6;13;50;4;11;3;6;20;7;8;13;;59;45
Lys;TTT;aaa;2;2;3;4;5;49;10;5;4;81;3;8;10;67;11;4;20;8;13;0;6;27;5;9;23;6;5;10;5;37;4;31;4;6;4;10;4;1;4;13;2;1;3;2;7;7;6;4;5;44;30;30;2;1;2;3;3;10;17;45;15;4;3;4;4;7;14;45;7;12;0;0;6;12;9;3;3;6;2;1;1;1;3;1;8;5;6;24;7;12;1;1;8;14;7;24;5;16;4;7;4;6;9;6;3;5;4;7;6;12;0;−;6;5;17;6;13;4;4;3;8;14;6;13;0;0;5;2;3;7;4;13;8;5;37;19;15;22;5;4;3;0;5;25;4;10;7;12;4;5;4;69;5;5;51;20;14;67;;275;249
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
corrélation;;;0.23;;0.10;;0.35;;0.68;;0.88;;0.44;;0.57;;0.25;;0.09;;0.35;;0.36;;0.38;;0.67;;0.56;;0.61;;0.37;;0.43;;0.15;;-0.11;;0.06;;-0.27;;0.02;;0.20;;0.77;;0.30;;0.81;;0.20;;0.44;;0.38;;0.76;;0.17;;0.06;;0.27;;0.06;;0.44;;0.17;;0.31;;0.40;;0.25;;0.30;;0.42;;0.30;;0.67;;0.13;;0.30;;0.29;;0.43;;0.77;;0.14;;0.26;;0.14;;0.14;;-0.11;;0.63;;0.34;;−;;0.35;;0.91;;0.22;;0.23;;0.53;;0.56;;0.44;;0.43;;0.25;;0.26;;0.36;;0.63;;0.76;;0.07;;0.43;;0.19;;0.52;;0.32;;0.40;;0.88;;0.53;;0.71;;0.60;;;0.91;
total;;;92;72;284;94;172;1250;431;217;342;6717;381;215;320;3678;530;169;817;226;416;133;139;723;173;276;607;173;146;290;3402;10269;74;426;140;194;161;308;195;54;190;878;161;55;228;58;194;250;163;276;158;3561;1694;747;63;94;114;122;129;324;452;990;501;189;85;230;164;221;253;1695;59;266;34;4;132;341;259;175;144;160;50;60;110;96;105;107;185;230;124;582;319;308;52;102;125;327;276;529;79;1045;225;231;124;153;273;351;150;142;438;260;174;301;0;1;156;203;1401;1032;387;208;249;128;175;381;161;392;160;198;146;181;334;237;117;226;230;171;639;381;236;522;146;602;78;148;111;1851;205;357;271;294;135;271;231;5586;236;290;1588;997;601;548;;6569;5642
idble;;;1.28;;3.02;;0.14;;1.99;;0.05;;1.77;;0.09;;3.14;;3.62;;3.13;;0.19;;0.63;;3.51;;0.50;;0.33;;0.17;;0.72;;0.52;;3.61;;0.22;;2.93;;3.93;;0.78;;0.59;;0.04;;2.27;;0.67;;0.93;;0.40;;0.46;;2.65;;0.37;;0.74;;0.15;;0.22;;8.50;;0.39;;1.48;;0.90;;0.83;;1.15;;0.98;;0.80;;0.21;;1.04;;0.51;;0.38;;0.52;;0.08;;0.97;;0.81;;0.78;;1.06;;1.68;;0.58;;0.00;;0.77;;1.36;;1.86;;1.95;;0.46;;0.41;;0.81;;0.81;;1.41;;0.52;;1.35;;1.68;;0.45;;0.24;;0.53;;0.06;;0.57;;0.92;;0.50;;0.04;;0.81;;1.59;;1.10;;;1.16;
total tRNAs;;;164;;378;;1422;;648;;7059;;596;;3998;;699;;1043;;549;;862;;449;;780;;436;;13671;;500;;334;;469;;249;;1068;;216;;286;;444;;439;;3719;;2441;;157;;236;;453;;1442;;690;;315;;385;;1948;;325;;38;;473;;434;;304;;110;;206;;212;;415;;706;;627;;154;;452;;805;;1124;;456;;277;;624;;292;;698;;475;;1;;359;;2433;;595;;377;;556;;553;;358;;327;;571;;343;;401;;1020;;758;;748;;226;;1962;;562;;565;;406;;5817;;526;;2585;;1149;;;;
;;;acs;;aga;;aml;;ath;;bacu;;bdi;;bta;;cbr;;cbre;;cel;;cfa;;cge;;cjap;;cjc;;cmk;;cpic;;cpo;;csi;;dme;;dno;;dsi;;dya;;ecb;;eeu;;fca;;gac;;gfr;;gga;;ggo;;gmo;;gmx;;hgl;;hsa-18;;lav;;lcm;;lma;;mcc;;mdo;;meu;;mgp;;mlu;;mmr;;mmu;;mpu;;mtr;;mun;;nle;;oaa;;oas;;ocu;;oga;;oni;;opr;;osa;;pan;;pfa;;pha;;pma;;pop;;ppp;;ppy;;ptr;;rno;;san;;sbi;;sbq;;shr;;spu;;ssc;;str;;tgu;;tma;;tng;;tru;;tsy;;ttr;;vvi;;xtr;;zma;;;dre;
;;;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;;double;dif
E79 génomes. Les duplications excessives remplacées par les estimations du processus de base[modifier | modifier le wikicode]
  • Lien au tableaux: E79 génomes. Les duplications excessives remplacées par les estimations du processus de base
  • Méthode: remplacement manuel. S'il faut recalculer les corrélations et les totaux par colonne, il suffit de copier le "lien tableur" de ce tableau dans un tableur puis remplacer tout "*" et ":" par rien (ctrl+H), récupérer les résultats et non le tableau. S'il nécessaire de republier le tableau, reprendre "le lien tableur" sans supprimer les "*" et les ":", puis faire les modifications nécessaires avant de publier.
  • Légende:
    Couleurs pour effectif supérieur à 49 remplacé par la méthode des 4 proches voisins (ref.).
  • Total des codons par génome:Les duplications excessives remplacées par les estimations du processus de base
E79;double;acs;double;aga;double;aml;double;ath;double;bacu;double;bdi;double;bta;double;cbr;E79;double;cbre;double;cel;double;cfa;double;cge;double;cjap;double;cjc;double;cmk;double;cpic;E79;double;cpo;double;csi;double;dme;double;dno;double;dsi;double;dya;double;ecb;double;eeu;E79;double;fca;double;gac;double;gfr;double;gga;double;ggo;double;gmo;double;gmx;double;hgl;E79;double;hsa-18;double;lav;double;lcm;double;lma;double;mcc;double;mdo;double;meu;double;mgp;E79;double;mlu;double;mmr;double;mmu;double;mpu;double;mtr;double;mun;double;nle;double;oaa;E79;double;oas;double;ocu;double;oga;double;oni;double;opr;double;osa;double;pan;double;pfa;E79;double;pha;double;pma;double;pop;double;ppp;double;ppy;double;ptr;double;rno;double;san;E79;double;sbi;double;sbq;double;shr;double;spu;double;ssc;double;str;double;tgu;double;tma;E79;double;tng;double;tru;double;tsy;double;ttr;double;vvi;double;xtr;double;zma
'''aaa;2;2;3;4;5;*17;10;5;4;*11;3;8;10;*5;11;4;'''aaa;20;8;13;0;6;27;5;9;23;6;5;10;5;37;4;31;'''aaa;4;6;4;10;4;1;4;13;2;1;3;2;7;7;6;4;'''aaa;5;44;30;30;2;1;2;3;3;10;17;§9;15;4;3;4;'''aaa;4;7;14;45;7;12;0;0;6;12;9;3;3;6;2;1;'''aaa;1;1;3;1;8;5;6;24;7;12;1;1;8;14;7;24;'''aaa;5;16;4;7;4;6;9;6;3;5;4;7;6;12;0;−;'''aaa;6;5;17;6;13;4;4;3;8;14;6;13;0;0;5;2;'''aaa;3;7;4;13;8;5;37;19;15;22;5;4;3;0;5;25;'''aaa;4;10;7;12;4;5;4;*11;5;5;*16;20;14;*16
'''aac;6;3;10;1;10;17;10;8;17;6;10;5;16;13;20;2;'''aac;28;4;17;2;8;12;8;8;20;2;9;17;16;31;5;11;'''aac;9;8;10;3;9;0;17;5;5;0;10;0;9;7;5;1;'''aac;7;20;*12;40;1;4;5;5;9;19;16;17;12;9;5;3;'''aac;8;16;14;36;2;6;2;0;6;20;9;3;10;3;2;1;'''aac;7;1;4;4;8;4;4;7;14;15;4;4;7;13;10;10;'''aac;8;4;11;14;8;3;8;0;9;4;17;12;9;19;0;0;'''aac;8;9;*29;*12;11;12;9;4;11;29;9;23;8;6;8;3;'''aac;9;6;5;6;12;0;30;8;10;7;7;1;3;4;5;17;'''aac;6;10;10;12;6;8;7;5;7;13;28;18;31;17
'''aag;3;2;15;1;12;*6;14;4;5;23;16;1;15;24;36;3;'''aag;45;3;24;5;10;*11;11;*8;30;6;4;11;11;24;2;6;'''aag;7;18;6;15;12;0;13;29;10;0;12;3;8;7;28;*10;'''aag;8;*15;*11;22;1;5;4;1;5;13;20;22;20;1;4;10;'''aag;5;9;14;21;4;8;2;1;7;8;10;8;8;2;1;1;'''aag;4;6;4;1;7;18;5;*10;13;2;3;9;6;13;10;14;'''aag;5;10;9;19;4;4;22;20;4;6;15;4;6;10;0;−;'''aag;6;5;13;9;15;1;11;4;8;18;8;17;10;8;6;6;'''aag;15;6;3;6;9;22;30;11;7;8;7;4;1;4;7;8;'''aag;10;10;13;6;0;6;3;15;5;10;*11;22;36;*6
'''aat;0;−;0;−;0;5;0;−;0;−;0;−;0;−;0;−;'''aat;0;−;0;−;0;0;0;−;0;−;0;−;0;1;0;0;'''aat;0;−;0;1;0;−;0;−;0;−;0;0;0;0;0;−;'''aat;0;4;0;0;0;0;0;−;0;1;0;1;0;1;0;−;'''aat;0;−;0;3;0;2;0;−;0;1;0;−;0;−;0;−;'''aat;0;−;0;−;0;−;0;5;4;$5;0;−;0;2;0;−;'''aat;0;−;0;0;0;−;0;−;0;−;0;−;0;1;0;−;'''aat;0;0;0;−;0;−;0;0;1;0;0;1;0;−;0;−;'''aat;0;0;0;−;0;−;0;−;0;1;0;0;0;2;0;0;'''aat;0;−;0;−;0;0;0;−;0;0;0;0;0;−
'''aca;1;1;1;0;1;7;4;4;1;6;2;7;2;7;6;3;'''aca;12;2;9;1;1;2;1;2;7;4;0;6;*13;*8;1;16;'''aca;1;2;2;5;4;1;1;6;3;1;4;1;2;4;0;5;'''aca;1;11;19;15;0;3;1;2;1;4;6;23;5;4;0;3;'''aca;0;5;5;16;1;7;0;0;0;5;5;1;3;2;0;1;'''aca;2;2;0;2;1;2;1;5;3;6;0;1;0;5;2;15;'''aca;1;3;1;5;1;4;3;21;1;4;9;6;0;7;0;0;'''aca;0;6;10;8;5;5;1;3;0;3;1;4;1;3;0;4;'''aca;4;7;1;5;4;2;11;9;3;4;2;3;1;2;1;16;'''aca;3;8;1;5;0;3;1;4;2;5;§13;§8;8;5
'''acc;0;−;0;−;0;−;0;0;0;−;2;0;0;0;0;−;'''acc;0;0;0;−;0;−;0;0;0;−;0;0;0;$4;0;−;'''acc;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''acc;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;1;'''acc;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;'''acc;0;−;0;−;0;−;0;−;2;1;0;−;0;−;0;0;'''acc;0;−;0;0;0;−;0;0;0;−;5;2;0;−;0;−;'''acc;0;−;$5;$4;0;−;0;−;0;−;0;−;0;−;0;−;'''acc;0;1;0;−;0;−;0;−;0;−;0;4;0;4;0;0;'''acc;0;−;0;−;0;−;0;0;0;1;0;−;5;4
'''acg;0;0;3;2;0;9;2;3;0;3;2;3;0;6;5;3;'''acg;6;3;2;4;0;4;0;3;8;2;0;3;4;*3;0;4;'''acg;0;2;0;4;2;0;0;6;2;1;4;0;0;2;0;3;'''acg;0;8;14;8;0;0;0;1;1;4;7;22;2;1;0;3;'''acg;0;4;0;9;0;1;1;0;0;3;0;2;0;2;0;−;'''acg;0;2;0;1;0;3;0;4;0;0;0;−;0;4;2;7;'''acg;0;2;0;4;0;2;1;6;0;6;3;1;0;6;0;0;'''acg;0;5;11;11;2;1;3;2;0;6;0;5;0;3;0;4;'''acg;3;2;0;4;0;1;4;4;0;3;0;6;0;1;0;3;'''acg;3;9;1;6;0;3;0;2;1;1;15;13;4;1
'''act;1;2;7;0;4;5;7;2;4;8;2;6;4;9;20;1;'''act;26;4;14;2;2;5;1;6;17;6;1;8;7;16;1;15;'''act;0;9;3;6;6;2;1;9;7;0;7;0;2;6;2;6;'''act;3;5;*23;*11;2;2;0;3;2;6;10;19;3;5;0;14;'''act;3;5;1;12;3;7;2;0;3;6;6;5;3;4;0;3;'''act;2;2;0;2;2;8;2;7;8;1;1;3;3;8;7;15;'''act;0;4;2;5;1;7;6;11;1;5;8;2;4;6;0;−;'''act;4;5;29;32;2;4;8;1;4;7;2;7;2;6;2;5;'''act;3;8;2;6;4;4;14;12;6;6;2;31;2;5;1;14;'''act;9;16;7;10;2;6;2;6;4;5;*23;*11;7;12
'''aga;0;2;0;1;0;16;1;8;0;*8;2;6;0;§8;7;2;'''aga;10;2;5;2;0;8;0;4;9;2;0;5;0;13;1;24;'''aga;0;4;0;5;0;2;0;8;0;3;0;2;0;4;0;4;'''aga;0;*8;§1;24;0;2;0;3;0;4;2;18;10;7;0;5;'''aga;0;5;0;*8;0;8;0;0;0;5;0;5;1;5;0;2;'''aga;1;3;0;4;0;5;1;14;2;5;0;3;0;6;0;5;'''aga;0;21;0;5;0;3;1;25;0;4;6;5;0;5;0;0;'''aga;0;5;8;9;5;5;4;2;2;5;0;5;0;5;0;5;'''aga;2;5;0;5;0;4;9;8;1;5;0;4;0;3;1;*10;'''aga;0;9;1;11;0;5;0;§8;3;2;*9;*5;3;5
'''agc;2;2;4;1;3;9;7;8;3;9;12;5;8;10;6;2;'''agc;9;4;6;2;2;5;3;5;12;2;3;4;10;22;1;18;'''agc;3;6;7;5;4;1;3;6;1;1;4;3;5;6;4;2;'''agc;4;7;14;15;3;2;3;3;4;3;0;−;16;11;2;4;'''agc;2;5;7;*6;1;6;0;1;4;3;7;1;6;3;1;4;'''agc;2;2;2;4;2;5;4;7;6;8;0;7;3;5;6;11;'''agc;1;5;7;2;2;4;5;4;4;2;14;5;4;6;0;0;'''agc;4;4;§7;30;10;5;6;2;4;3;3;5;5;6;4;3;'''agc;7;5;3;3;6;1;14;2;6;3;2;4;2;2;2;33;'''agc;5;5;6;12;2;6;3;7;7;1;§14;*8;10;3
'''agg;0;2;0;1;1;43;4;3;0;*7;4;5;2;*6;1;0;'''agg;4;6;1;2;1;27;1;4;2;0;1;3;5;6;0;9;'''agg;1;3;0;6;2;0;1;45;1;1;2;1;1;5;1;5;'''agg;1;*14;21;4;0;1;0;2;1;4;7;20;10;2;1;3;'''agg;0;4;2;13;0;7;0;0;1;5;1;3;0;3;1;1;'''agg;0;4;0;2;1;3;0;20;2;3;1;2;1;3;2;6;'''agg;1;31;1;4;0;4;12;5;1;4;6;4;1;3;0;−;'''agg;1;3;25;24;7;3;5;4;2;6;1;3;2;5;2;3;'''agg;7;2;1;3;1;2;7;11;0;3;1;4;0;1;0;12;'''agg;6;4;5;4;0;3;1;*14;4;3;18;8;5;5
'''agt;0;−;0;−;0;1;0;−;0;−;0;−;0;3;0;−;'''agt;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;2;'''agt;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''agt;0;1;0;−;0;−;0;−;0;−;0;0;0;−;0;1;'''agt;0;−;0;2;0;−;0;−;0;−;0;−;0;−;0;−;'''agt;0;−;0;−;0;−;0;−;0;−;0;−;0;−;$7;$10;'''agt;0;−;0;−;0;1;0;1;0;−;0;−;0;−;0;−;'''agt;0;−;0;−;0;0;0;−;0;−;0;2;0;0;0;−;'''agt;0;−;0;−;0;−;$17;$8;0;−;0;−;1;1;0;4;'''agt;0;0;0;−;0;−;0;−;0;−;0;−;0;−
'''ata;0;0;0;1;0;5;3;1;0;7;1;2;0;7;8;15;'''ata;13;12;3;3;0;4;0;4;2;4;0;4;4;18;0;12;'''ata;0;4;0;4;0;1;0;5;0;−;0;1;0;4;0;3;'''ata;0;8;§5;14;0;1;0;1;0;5;2;15;5;2;0;2;'''ata;0;4;0;6;0;6;0;0;0;6;0;6;0;5;0;0;'''ata;0;2;1;1;0;4;0;4;7;6;0;0;0;4;2;7;'''ata;0;4;0;6;0;10;5;19;0;3;2;2;0;6;0;0;'''ata;0;3;3;6;6;2;2;2;0;5;0;4;0;2;0;4;'''ata;1;3;0;5;0;3;6;15;1;3;0;3;0;0;0;7;'''ata;0;4;0;5;0;3;0;4;3;5;§5;24;1;3
'''atc;0;−;0;−;0;−;1;0;0;0;0;1;0;−;0;−;'''atc;0;0;0;−;0;−;0;−;0;−;0;2;0;−;0;0;'''atc;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;'''atc;0;−;0;−;0;0;0;−;0;2;0;−;0;−;0;−;'''atc;2;0;0;−;0;−;0;−;0;5;0;−;0;−;0;−;'''atc;0;−;0;−;0;0;0;−;0;−;0;−;0;2;0;−;'''atc;0;−;0;0;0;$5;0;−;0;−;0;−;0;1;0;−;'''atc;0;1;0;−;0;0;0;−;3;2;0;2;0;−;0;−;'''atc;0;−;0;0;0;−;0;1;0;−;0;5;0;4;0;0;'''atc;0;−;0;−;0;−;0;−;0;1;0;4;0;−
'''atg;4;7;13;4;11;12;16;15;8;12;25;30;16;18;18;4;'''atg;24;4;16;2;6;16;7;8;25;4;7;12;20;§73;5;10;'''atg;5;9;11;14;8;3;10;19;8;3;11;3;12;12;10;5;'''atg;9;14;*27;§64;2;3;8;5;10;6;42;§111;22;13;6;7;'''atg;11;8;16;33;3;7;2;1;5;13;14;10;7;6;7;3;'''atg;8;5;8;5;8;10;6;13;18;22;6;2;7;9;14;17;'''atg;4;13;8;9;5;7;20;6;11;3;31;28;8;10;0;1;'''atg;9;5;*27;§90;18;7;15;8;9;12;9;13;7;5;7;7;'''atg;9;29;8;6;14;7;43;29;12;10;7;6;2;2;7;13;'''atg;8;11;24;11;7;4;6;10;6;19;*23;38;31;47
'''att;4;1;10;1;7;4;15;1;6;5;13;6;14;3;17;3;'''att;31;1;19;1;4;4;10;2;20;5;5;7;8;22;2;8;'''att;7;2;7;5;8;1;6;5;6;2;8;1;13;6;7;1;'''att;8;1;*10;16;4;1;6;0;5;8;5;20;12;18;5;2;'''att;5;9;13;29;1;5;2;0;4;7;12;0;4;1;1;1;'''att;6;3;2;1;7;4;6;3;14;8;3;1;4;8;10;16;'''att;3;2;6;4;6;3;12;12;6;1;14;3;5;8;0;0;'''att;5;6;§25;*11;14;5;9;2;7;8;6;10;5;6;7;7;'''att;14;2;6;4;10;0;*9;11;12;0;6;7;5;34;5;7;'''att;8;9;9;2;5;2;5;5;9;5;§10;17;32;36
'''caa;0;2;2;1;1;41;6;3;2;7;7;7;2;17;19;4;'''caa;29;10;15;4;1;41;1;3;11;2;0;6;1;5;1;14;'''caa;2;1;2;2;2;1;2;2;2;1;3;0;2;3;1;2;'''caa;5;*6;§4;12;0;1;0;1;1;9;3;7;10;2;0;2;'''caa;2;3;3;10;1;8;0;0;1;14;0;6;1;2;0;0;'''caa;0;2;1;2;1;5;2;34;10;9;1;0;2;7;3;7;'''caa;0;6;2;2;1;3;1;4;2;2;9;11;2;11;0;0;'''caa;2;3;23;20;10;0;3;6;0;12;3;16;1;4;2;2;'''caa;3;7;0;7;16;28;10;6;3;5;2;1;0;1;2;5;'''caa;4;4;3;6;13;*9;4;11;3;6;20;7;8;13
'''cac;3;1;16;4;7;0;6;5;7;3;14;6;14;4;18;2;'''cac;21;4;13;5;7;1;11;2;12;4;5;3;10;26;2;7;'''cac;6;1;8;1;4;0;6;3;4;1;4;0;8;2;4;0;'''cac;8;7;33;18;0;3;2;3;6;0;10;15;15;2;5;1;'''cac;8;0;14;12;2;2;1;0;10;3;8;0;6;0;0;2;'''cac;4;2;3;2;7;2;5;1;10;7;0;3;7;3;4;19;'''cac;3;4;8;0;7;0;9;13;4;0;16;9;9;0;0;−;'''cac;9;0;15;11;9;3;6;2;7;3;8;1;9;0;6;0;'''cac;8;6;5;3;8;0;17;8;7;2;4;1;2;2;7;4;'''cac;4;7;10;8;5;4;4;4;5;8;24;17;18;7
'''cag;2;2;5;5;4;20;4;4;4;15;8;2;8;31;6;3;'''cag;6;4;4;2;4;15;5;5;11;4;5;7;8;9;1;9;'''cag;3;4;4;7;4;3;3;6;4;3;3;4;6;5;2;5;'''cag;2;44;*5;19;1;1;2;2;5;15;22;22;8;4;3;2;'''cag;6;6;5;22;2;6;2;0;4;9;8;2;1;5;0;0;'''cag;2;4;7;4;5;6;3;13;2;2;0;4;3;13;5;13;'''cag;3;5;8;6;5;3;7;3;6;5;3;6;4;9;0;0;'''cag;4;6;§9;47;4;6;8;1;4;19;7;13;4;5;4;2;'''cag;5;7;3;7;7;2;10;10;4;7;4;1;4;1;4;5;'''cag;13;4;8;5;3;2;7;7;3;7;30;9;6;6
'''cat;0;−;0;−;0;−;0;−;0;−;0;2;0;3;0;−;'''cat;0;0;0;−;0;−;0;−;0;−;0;0;0;0;0;−;'''cat;0;−;0;−;0;−;0;0;0;−;0;−;0;0;0;−;'''cat;0;1;0;−;0;−;0;−;0;−;0;0;0;−;0;−;'''cat;0;−;0;2;0;−;0;−;0;−;0;−;0;0;0;−;'''cat;0;4;0;−;0;0;0;0;0;−;0;−;0;−;0;0;'''cat;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''cat;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;'''cat;0;1;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''cat;0;−;0;1;0;0;0;−;0;0;0;0;0;0
'''cca;2;0;6;1;3;7;41;5;2;2;8;9;6;2;30;10;'''cca;48;5;23;7;1;6;4;1;33;9;3;2;7;43;1;2;'''cca;2;1;4;2;4;0;5;1;3;1;7;0;4;2;3;1;'''cca;4;*4;22;6;1;3;1;2;3;3;6;14;20;6;1;3;'''cca;4;2;2;11;3;6;0;0;3;6;5;2;3;0;0;1;'''cca;0;2;1;2;3;4;1;5;8;2;1;2;2;2;3;8;'''cca;2;3;2;2;1;2;6;4;1;2;5;8;2;3;0;0;'''cca;2;3;29;13;13;9;6;1;3;5;4;5;4;1;2;3;'''cca;6;4;2;2;5;0;15;5;2;1;2;4;0;0;3;4;'''cca;4;9;4;4;0;31;2;2;8;7;36;16;13;17
'''ccc;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''ccc;1;0;0;−;0;−;0;−;0;−;0;−;0;5;0;0;'''ccc;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''ccc;0;0;0;−;0;−;0;−;0;−;0;0;0;−;0;−;'''ccc;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;'''ccc;0;−;0;−;0;0;0;−;0;0;0;−;0;1;0;3;'''ccc;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''ccc;0;−;0;−;0;−;0;−;0;0;0;0;0;−;0;−;'''ccc;0;1;0;−;0;−;0;−;0;−;0;0;0;−;0;−;'''ccc;0;0;0;−;0;0;0;−;0;−;0;0;0;−
'''ccg;1;0;7;5;3;1;2;2;2;1;5;2;3;0;2;1;'''ccg;4;4;3;0;2;1;2;0;7;0;3;0;0;§1;0;1;'''ccg;2;0;2;1;2;2;1;2;2;2;3;1;1;1;2;0;'''ccg;2;4;13;4;0;0;1;1;3;0;10;11;3;1;1;1;'''ccg;2;1;2;0;0;3;1;0;2;0;2;0;1;0;0;0;'''ccg;2;0;2;0;2;0;1;0;0;0;0;1;3;0;4;2;'''ccg;0;0;3;0;2;0;2;1;3;0;3;5;3;0;0;0;'''ccg;3;0;12;8;2;1;0;4;3;1;3;1;2;0;1;0;'''ccg;4;3;3;0;2;0;4;4;2;0;2;0;1;0;2;0;'''ccg;1;3;2;3;1;2;2;1;1;2;19;16;5;3
'''cct;2;0;2;4;7;1;11;4;5;1;11;3;11;1;2;3;'''cct;13;11;2;3;7;0;6;0;7;1;6;0;1;10;4;7;'''cct;6;1;8;1;6;0;6;0;5;0;5;0;9;0;8;1;'''cct;6;1;*10;4;3;0;6;0;5;4;25;29;16;4;4;8;'''cct;7;1;9;6;2;9;1;0;6;1;10;0;4;2;5;1;'''cct;5;0;6;0;5;2;8;0;6;0;0;2;5;3;13;5;'''cct;3;0;8;0;6;0;10;3;7;0;10;3;5;3;0;0;'''cct;5;1;36;17;12;1;11;1;8;2;4;6;10;22;7;0;'''cct;9;4;5;3;8;1;14;4;8;0;7;4;3;2;7;3;'''cct;4;8;7;2;5;1;4;2;9;5;§17;17;11;3
'''cga;0;2;4;3;2;*5;4;1;1;7;4;0;1;10;4;5;'''cga;11;5;4;3;0;14;2;3;6;4;0;3;3;21;1;3;'''cga;0;3;1;3;6;3;1;6;2;2;5;1;1;2;1;3;'''cga;7;*4;*1;13;0;1;0;1;1;4;2;14;6;2;0;3;'''cga;0;5;4;13;0;3;0;0;0;4;2;2;2;2;0;0;'''cga;1;3;1;1;1;3;1;27;3;1;0;0;0;6;2;4;'''cga;0;5;2;2;0;3;0;6;1;4;2;1;0;4;0;0;'''cga;1;4;17;8;5;1;2;4;1;4;0;5;1;3;0;4;'''cga;3;0;0;3;2;2;9;9;2;2;0;4;0;2;0;11;'''cga;0;6;0;6;0;4;0;6;3;2;25;7;3;3
'''cgc;0;−;0;−;0;0;0;−;0;−;0;0;0;$2;0;−;'''cgc;0;−;0;−;0;−;0;−;0;−;2;0;0;−;0;−;'''cgc;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''cgc;0;$2;0;−;0;−;0;−;0;−;0;1;0;−;0;−;'''cgc;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''cgc;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''cgc;0;1;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''cgc;0;−;0;0;0;−;0;0;0;−;0;0;0;−;0;−;'''cgc;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''cgc;0;0;0;0;0;−;0;0;0;−;0;2;0;−
'''cgg;0;0;0;−;2;4;1;2;1;19;2;3;3;12;0;−;'''cgg;13;10;0;0;1;2;0;2;0;0;1;2;0;1;0;2;'''cgg;0;2;2;1;0;−;0;4;0;−;0;−;2;1;1;1;'''cgg;0;23;0;1;0;−;0;1;2;2;3;6;1;3;0;3;'''cgg;2;1;0;2;0;0;0;0;2;1;1;2;0;2;0;1;'''cgg;0;1;0;1;0;2;2;2;1;1;0;0;1;1;3;10;'''cgg;0;5;1;2;0;2;0;5;1;2;3;4;2;1;0;−;'''cgg;2;1;4;5;1;4;2;2;4;2;2;2;0;2;1;1;'''cgg;4;2;1;1;0;2;0;0;2;0;0;2;0;−;1;5;'''cgg;0;1;0;3;1;1;0;11;0;5;2;5;3;2
'''cgt;2;1;9;0;5;2;4;6;3;5;12;3;7;5;17;4;'''cgt;28;3;14;3;1;4;3;2;17;3;4;1;4;4;2;4;'''cgt;4;2;4;5;9;0;5;4;8;0;11;0;6;3;3;2;'''cgt;5;3;37;11;1;4;4;3;3;3;8;22;11;1;2;2;'''cgt;5;1;4;9;2;1;3;0;3;2;0;4;2;4;0;1;'''cgt;1;4;2;3;3;2;3;2;5;6;1;1;4;2;4;7;'''cgt;0;1;4;2;2;3;12;3;4;2;17;6;4;2;0;−;'''cgt;3;3;*19;29;4;7;5;2;4;2;5;1;3;2;4;4;'''cgt;11;3;4;1;0;3;20;8;5;1;3;2;2;3;3;4;'''cgt;10;3;13;2;3;2;2;4;1;9;20;12;25;9
'''cta;0;2;1;1;0;4;6;4;0;3;6;3;0;4;3;1;'''cta;6;1;2;0;0;3;0;3;2;3;0;3;2;17;0;3;'''cta;0;2;1;2;1;0;0;2;1;0;1;0;0;4;0;2;'''cta;0;32;5;11;0;−;0;1;0;4;4;19;7;2;0;4;'''cta;0;2;0;10;1;3;0;0;0;4;0;5;1;2;0;0;'''cta;0;1;0;1;0;3;0;3;6;3;0;−;0;3;2;4;'''cta;0;2;0;3;0;2;1;5;0;4;5;4;0;2;0;0;'''cta;0;2;26;13;0;−;1;4;0;2;0;3;0;0;0;1;'''cta;3;5;0;3;0;3;2;5;2;2;0;2;0;0;0;4;'''cta;0;5;0;3;1;3;0;3;4;6;15;9;4;4
'''ctc;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;'''ctc;0;−;0;−;0;−;0;−;0;−;0;−;0;1;0;0;'''ctc;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''ctc;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''ctc;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''ctc;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''ctc;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''ctc;0;−;0;−;0;0;0;0;0;0;0;0;0;−;0;0;'''ctc;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''ctc;0;−;0;−;0;−;0;−;0;−;1;0;0;−
'''ctg;2;1;8;1;2;4;2;0;3;3;7;0;3;2;2;4;'''ctg;3;4;3;1;4;2;5;4;5;6;3;8;5;19;2;3;'''ctg;4;1;2;1;7;0;6;3;8;0;7;0;1;1;2;3;'''ctg;2;2;6;2;2;4;2;4;1;3;13;§7;6;0;1;3;'''ctg;7;1;4;5;0;7;1;0;2;3;5;5;1;4;1;2;'''ctg;3;1;4;2;6;3;2;2;2;1;0;5;3;5;5;12;'''ctg;0;1;10;5;5;3;8;7;8;2;8;1;6;5;0;0;'''ctg;1;4;§15;§11;5;1;3;1;3;7;2;6;2;2;3;9;'''ctg;7;3;2;2;5;3;2;2;3;1;2;1;3;3;1;3;'''ctg;18;18;14;6;3;3;1;4;4;2;17;14;10;2
'''ctt;2;1;3;1;2;4;9;2;4;1;7;6;6;4;21;4;'''ctt;29;2;14;5;3;0;3;1;22;3;4;3;6;13;0;1;'''ctt;3;1;3;2;3;0;3;1;4;0;4;0;5;1;4;1;'''ctt;5;0;31;17;1;2;0;2;4;4;11;21;15;0;2;2;'''ctt;5;3;4;17;1;2;2;0;2;6;5;2;2;2;0;0;'''ctt;1;1;3;1;2;2;4;1;3;5;0;2;4;5;3;4;'''ctt;3;2;2;2;3;0;5;8;2;2;11;3;4;3;0;0;'''ctt;4;4;*26;*6;13;35;5;0;6;9;5;5;0;0;4;1;'''ctt;11;3;4;2;6;2;5;12;5;2;3;2;0;1;3;4;'''ctt;2;12;3;7;3;2;5;0;5;4;20;17;19;9
'''gaa;4;6;12;9;3;5;27;8;11;*7;4;10;5;14;12;38;'''gaa;29;*10;*9;23;7;5;1;3;7;*6;10;4;5;9;5;1;'''gaa;14;2;5;5;2;6;2;8;5;2;4;6;18;7;15;3;'''gaa;10;5;3;*8;0;1;1;3;3;4;4;16;9;14;0;3;'''gaa;16;3;2;9;2;3;0;0;2;3;3;12;3;8;5;1;'''gaa;5;1;2;4;8;6;2;2;22;23;13;0;3;3;5;4;'''gaa;1;5;2;11;0;2;7;8;12;3;3;12;13;8;0;0;'''gaa;4;8;3;4;3;17;6;6;6;11;9;8;6;7;2;2;'''gaa;4;10;2;6;3;12;2;*7;47;*10;8;2;5;0;10;3;'''gaa;8;4;6;5;1;3;30;*10;1;8;7;*6;0;16
'''gac;6;1;18;1;5;5;21;7;7;37;21;4;9;32;27;6;'''gac;31;2;20;6;9;3;10;4;32;8;8;5;14;34;4;9;'''gac;6;3;6;6;11;2;12;8;5;0;14;2;5;4;9;3;'''gac;7;1;*9;48;1;3;7;2;7;7;15;14;25;7;4;5;'''gac;10;2;6;13;3;15;2;0;6;8;12;11;1;11;2;0;'''gac;5;2;3;1;12;3;4;3;16;13;4;4;5;7;13;13;'''gac;2;5;17;5;9;3;6;3;11;2;20;10;8;6;0;0;'''gac;6;3;*8;33;29;4;8;2;7;5;7;9;12;2;9;9;'''gac;20;3;6;4;12;6;*10;19;14;*15;5;2;3;3;4;10;'''gac;6;12;18;5;6;6;5;43;11;11;46;12;30;11
'''gag;1;3;12;2;3;33;9;3;21;*17;16;2;3;*15;21;8;'''gag;34;2;19;4;6;15;6;13;31;8;6;8;22;*17;2;2;'''gag;4;0;4;*6;10;4;7;37;6;3;11;2;3;47;5;3;'''gag;3;40;28;24;4;1;5;1;2;6;20;29;17;6;3;0;'''gag;6;1;6;17;2;5;1;0;2;3;10;2;5;1;3;2;'''gag;5;0;4;3;8;5;4;14;8;2;0;0;7;9;13;13;'''gag;3;*15;14;4;6;1;13;1;7;3;14;10;7;2;0;0;'''gag;3;0;8;2;13;7;7;7;5;5;6;6;5;2;9;4;'''gag;17;8;3;6;8;1;19;9;5;7;3;3;1;1;0;18;'''gag;8;4;14;6;3;6;8;*5;12;13;32;18;16;13
'''gat;0;−;0;−;0;0;0;−;1;$5;0;−;0;5;0;−;'''gat;0;−;0;−;0;1;0;−;0;−;0;0;0;5;0;−;'''gat;0;0;0;0;0;−;0;−;0;−;0;−;0;−;0;−;'''gat;0;0;0;−;0;−;0;−;0;−;0;0;0;−;0;1;'''gat;0;−;0;−;0;0;0;−;0;0;0;0;0;−;0;−;'''gat;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;'''gat;0;1;0;0;0;−;0;−;0;−;0;0;0;1;0;−;'''gat;0;0;0;1;0;−;0;0;0;0;0;0;1;0;0;−;'''gat;0;1;0;0;0;−;0;−;1;$5;0;5;0;−;0;0;'''gat;0;−;0;0;0;0;0;$5;0;2;0;−;0;0
'''gca;0;5;1;1;2;6;7;2;0;41;7;5;4;30;13;0;'''gca;7;3;7;1;3;7;1;13;6;4;1;4;*25;*15;3;11;'''gca;2;6;1;11;0;1;2;*7;0;−;1;0;2;8;0;9;'''gca;1;8;36;16;0;4;3;3;1;5;4;19;12;4;1;3;'''gca;1;6;6;46;1;18;0;0;0;10;3;5;0;5;2;3;'''gca;0;0;0;4;3;7;1;6;8;7;0;4;0;10;6;10;'''gca;0;11;0;8;2;4;5;5;1;5;9;0;0;9;0;0;'''gca;0;8;21;9;13;7;7;1;2;6;1;8;3;5;1;6;'''gca;8;4;1;6;3;3;10;6;2;11;0;38;2;4;3;36;'''gca;2;8;3;4;0;3;0;35;16;20;29;17;8;6
'''gcc;0;−;0;−;0;−;0;−;0;−;0;−;0;1;0;−;'''gcc;0;−;0;−;0;−;0;0;0;−;0;1;3;$6;0;0;'''gcc;0;3;0;−;0;−;0;1;0;−;0;−;0;−;0;−;'''gcc;0;0;0;−;0;−;0;−;0;1;0;−;0;−;0;5;'''gcc;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;'''gcc;0;−;0;−;0;3;0;−;0;−;0;−;0;0;0;−;'''gcc;0;2;0;−;0;−;0;−;0;−;0;0;0;0;0;−;'''gcc;0;0;0;−;0;−;0;−;0;0;0;0;0;1;0;−;'''gcc;4;6;0;−;0;−;0;−;0;−;1;$6;0;−;0;0;'''gcc;0;−;0;−;0;−;0;1;0;−;0;−;0;−
'''gcg;0;2;4;1;1;3;4;2;1;18;9;1;2;13;2;4;'''gcg;2;3;0;3;0;3;1;4;7;0;1;2;*13;*9;0;3;'''gcg;0;4;1;4;2;0;1;15;3;1;2;2;1;6;0;3;'''gcg;1;5;§1;14;0;1;0;3;0;4;6;19;5;2;1;4;'''gcg;0;3;0;14;1;1;1;0;1;3;2;3;2;2;0;2;'''gcg;0;2;0;2;3;6;1;3;0;2;0;1;1;3;3;7;'''gcg;1;5;0;3;1;1;4;7;1;2;8;4;1;3;0;0;'''gcg;1;3;18;5;2;2;6;1;1;2;0;4;0;3;1;1;'''gcg;9;1;1;3;2;1;4;2;1;5;1;16;0;2;1;4;'''gcg;0;3;0;5;1;1;1;19;3;1;15;20;11;10
'''gct;6;5;13;3;3;13;13;2;2;17;16;2;12;18;22;6;'''gct;33;1;16;5;3;10;5;16;23;7;2;12;19;*4;1;9;'''gct;4;23;7;15;10;1;7;15;8;0;14;3;11;15;4;9;'''gct;4;13;31;21;9;6;13;10;3;19;24;30;21;2;1;44;'''gct;10;15;14;39;3;1;1;0;4;17;9;5;4;8;4;2;'''gct;3;4;3;7;4;18;2;12;15;9;7;1;2;16;32;*21;'''gct;7;10;7;13;5;7;11;6;4;10;16;3;4;15;0;0;'''gct;3;15;*17;43;18;1;10;8;3;18;5;25;5;30;2;7;'''gct;14;12;3;11;10;7;21;10;5;17;4;*14;8;9;4;15;'''gct;7;12;7;4;2;9;5;13;9;1;*4;16;34;31
'''gga;5;2;7;0;3;3;11;1;25;*11;6;2;6;*3;33;8;'''gga;*5;4;28;5;7;3;5;0;36;10;6;2;22;§11;10;13;'''gga;2;3;2;1;4;1;10;23;3;1;5;1;2;1;5;1;'''gga;2;45;§12;20;2;1;3;3;1;3;18;20;16;1;1;2;'''gga;5;3;3;*3;0;4;0;0;2;2;4;6;6;3;2;1;'''gga;4;1;5;1;6;1;2;6;9;5;5;5;4;1;6;8;'''gga;1;*3;12;1;3;5;6;5;5;1;5;4;6;1;0;0;'''gga;2;1;13;3;10;6;5;3;3;4;2;4;6;2;5;6;'''gga;7;2;2;3;6;2;19;13;2;7;2;2;4;2;5;*3;'''gga;5;10;7;4;2;3;19;*11;7;11;*12;26;8;2
'''ggc;5;1;14;0;8;1;16;8;13;*1;19;8;8;*3;16;4;'''ggc;25;13;10;3;8;2;9;4;24;9;9;5;12;6;5;5;'''ggc;6;4;8;1;12;1;10;8;13;1;14;1;9;0;10;3;'''ggc;7;2;10;1;7;0;5;1;5;7;17;12;26;2;6;3;'''ggc;9;4;7;25;2;4;3;0;6;8;19;4;7;8;4;0;'''ggc;6;1;8;2;9;5;7;1;19;3;4;5;5;7;17;22;'''ggc;3;26;18;2;7;4;8;4;11;5;19;8;10;9;0;−;'''ggc;6;6;29;24;21;4;13;2;8;5;6;6;7;3;11;10;'''ggc;18;5;7;4;16;2;26;15;9;9;7;5;7;4;5;17;'''ggc;5;8;15;2;9;4;6;36;11;5;*18;14;30;2
'''ggg;1;0;0;−;2;4;4;0;*8;*4;8;0;29;*3;0;4;'''ggg;11;13;2;0;2;6;2;4;0;1;1;3;7;*1;1;0;'''ggg;1;4;3;5;0;−;4;*5;0;−;0;0;3;4;2;2;'''ggg;1;4;1;2;1;2;2;1;4;4;4;13;6;2;1;1;'''ggg;2;2;2;*5;1;0;0;0;3;4;6;1;2;2;1;1;'''ggg;1;1;0;1;2;4;1;2;1;1;0;0;1;8;4;4;'''ggg;2;*5;5;10;2;0;2;6;3;1;4;4;3;5;0;−;'''ggg;3;4;4;1;6;0;3;7;2;10;2;13;1;3;1;0;'''ggg;4;1;0;3;3;2;1;2;2;3;1;18;0;3;2;*5;'''ggg;1;4;1;2;1;5;*8;*4;3;2;*4;34;9;1
'''ggt;0;−;0;−;0;−;0;−;1;$8;0;−;0;$8;0;−;'''ggt;0;−;0;−;0;−;0;0;0;−;0;−;0;1;0;−;'''ggt;0;−;0;−;0;−;0;$8;0;−;0;−;0;−;0;−;'''ggt;0;1;0;−;0;−;0;−;0;−;0;−;0;−;0;3;'''ggt;0;−;0;3;0;−;0;−;0;−;0;−;0;−;0;−;'''ggt;0;−;0;−;0;1;0;−;0;0;0;−;0;−;0;1;'''ggt;0;4;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''ggt;0;−;0;0;0;−;0;0;0;−;0;−;0;−;0;−;'''ggt;0;−;0;−;0;−;0;−;0;−;0;6;0;0;0;8;'''ggt;0;−;0;−;0;−;1;$8;0;−;0;−;0;−
'''gta;0;1;2;0;0;6;4;2;0;17;2;2;2;18;2;3;'''gta;3;4;1;3;0;4;1;3;2;4;1;4;29;*20;0;4;'''gta;1;1;0;6;1;0;0;15;1;0;1;0;0;5;0;5;'''gta;0;5;4;7;0;0;0;2;0;7;0;8;5;3;1;2;'''gta;1;3;11;38;0;6;0;0;1;5;1;3;0;0;0;1;'''gta;0;2;0;1;2;0;0;5;2;4;0;0;0;5;2;12;'''gta;0;7;3;4;1;1;2;6;0;3;3;0;2;4;0;0;'''gta;2;4;7;18;5;2;1;0;2;4;0;9;1;1;0;4;'''gta;2;1;1;3;1;2;5;5;2;8;1;3;0;1;0;25;'''gta;1;2;2;6;1;2;0;15;1;3;17;18;2;1
'''gtc;0;−;0;−;0;−;1;0;0;0;2;1;0;−;0;−;'''gtc;0;−;0;−;0;−;0;−;0;−;0;2;0;$3;0;−;'''gtc;0;0;0;0;0;−;0;0;0;−;0;−;0;2;0;−;'''gtc;0;−;0;0;0;0;0;0;0;0;0;−;0;0;0;0;'''gtc;0;−;0;0;0;−;0;−;0;2;0;−;0;−;0;0;'''gtc;0;−;0;−;0;0;0;−;0;2;0;0;0;0;0;0;'''gtc;0;−;0;−;0;−;0;−;0;−;$2;3;0;1;0;−;'''gtc;0;0;0;0;0;−;0;−;0;0;0;0;0;−;0;−;'''gtc;0;2;0;0;0;−;0;−;0;0;0;2;0;1;0;−;'''gtc;0;−;0;−;0;−;0;2;0;0;0;−;$2;0
'''gtg;2;0;21;7;7;1;6;1;8;23;8;2;12;26;3;2;'''gtg;7;7;4;1;5;2;3;5;8;4;4;6;37;*12;0;5;'''gtg;3;2;4;10;5;1;5;*3;4;1;8;2;9;5;2;1;'''gtg;6;2;7;10;1;1;2;4;5;5;9;18;11;1;3;2;'''gtg;7;5;9;25;1;2;1;0;4;7;6;2;3;3;0;2;'''gtg;4;0;3;1;4;7;3;3;2;4;2;1;4;8;5;4;'''gtg;2;6;10;3;3;1;7;1;5;1;7;3;6;5;0;0;'''gtg;6;5;§8;24;6;4;2;8;7;10;4;9;2;4;3;3;'''gtg;8;2;2;5;6;3;0;−;7;4;3;35;0;0;3;12;'''gtg;7;8;16;12;2;3;3;18;6;4;25;27;13;2
'''gtt;2;2;24;6;8;1;12;2;5;8;11;4;7;12;18;6;'''gtt;30;2;15;3;2;3;4;8;19;3;3;3;6;15;1;14;'''gtt;4;1;5;5;4;1;4;7;5;1;5;1;7;4;3;3;'''gtt;4;3;9;11;0;1;2;4;2;6;8;12;15;6;1;10;'''gtt;4;5;7;33;0;2;1;0;3;6;6;2;5;2;0;2;'''gtt;3;1;2;1;2;5;3;4;11;5;1;2;4;6;7;15;'''gtt;3;3;4;7;3;2;6;1;2;4;11;6;4;4;0;0;'''gtt;5;3;*27;*7;13;3;10;2;4;5;6;4;3;4;5;1;'''gtt;9;6;2;3;7;0;17;2;4;5;4;13;1;7;3;7;'''gtt;3;6;8;10;1;4;1;6;8;6;36;18;11;10
'''taa;0;−;0;0;0;0;0;0;0;$3;0;−;0;3;0;−;'''taa;0;−;0;−;0;2;0;−;0;−;0;0;0;0;0;0;'''taa;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''taa;1;$3;0;−;0;−;0;−;1;0;0;0;0;−;0;−;'''taa;0;−;0;1;0;0;0;−;0;1;0;−;0;−;0;−;'''taa;0;−;0;−;0;0;0;1;2;$3;0;0;0;2;0;2;'''taa;0;−;0;−;0;0;0;−;0;−;0;−;0;2;0;−;'''taa;0;0;1;0;0;0;0;−;0;0;0;1;0;−;0;−;'''taa;0;0;0;0;0;1;0;0;0;0;0;−;0;−;0;1;'''taa;0;−;0;−;0;2;0;$3;0;0;0;1;0;−
'''tac;0;5;1;20;1;9;*3;32;0;13;3;13;1;37;13;5;'''tac;20;7;7;11;0;8;0;10;22;1;10;24;7;28;0;4;'''tac;4;10;0;10;0;8;3;10;0;9;0;8;4;9;0;12;'''tac;1;8;4;12;4;7;3;12;1;21;3;46;1;19;0;6;'''tac;0;12;0;18;0;7;1;1;0;30;2;12;0;7;2;3;'''tac;0;4;0;7;0;10;0;8;2;10;2;4;0;18;2;25;'''tac;0;15;0;11;1;6;0;17;0;9;3;16;1;22;0;0;'''tac;2;12;§3;*35;2;15;1;6;1;27;2;28;0;1;0;8;'''tac;0;13;0;14;1;9;7;16;3;13;0;8;3;9;0;14;'''tac;2;10;1;13;0;9;1;16;0;18;*3;47;3;17
'''tag;0;−;0;−;0;$4;0;−;0;$4;0;−;0;$4;0;−;'''tag;0;−;0;−;0;2;0;−;0;−;0;2;0;3;0;1;'''tag;0;0;0;0;0;−;0;−;0;−;0;−;0;−;0;−;'''tag;0;$4;0;−;0;−;0;−;0;2;0;3;0;−;0;−;'''tag;0;−;0;−;1;1;0;−;0;1;0;−;0;−;0;−;'''tag;0;−;0;−;0;−;0;4;0;−;0;−;0;4;0;−;'''tag;0;2;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''tag;0;−;0;0;0;−;0;1;0;1;0;3;0;−;0;0;'''tag;0;1;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''tag;0;−;0;−;0;−;0;$4;0;−;0;0;0;3
'''tat;0;−;0;−;0;−;0;−;0;−;0;0;0;$4;0;−;'''tat;0;1;0;−;0;−;0;−;0;−;0;0;0;0;0;0;'''tat;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;'''tat;0;−;0;−;0;−;0;−;0;3;0;−;0;−;0;−;'''tat;0;0;0;0;0;1;0;−;0;0;0;−;0;0;0;−;'''tat;0;−;0;−;0;−;0;−;0;2;0;−;0;−;0;−;'''tat;0;1;0;−;0;−;0;2;0;−;0;1;0;3;0;−;'''tat;0;−;0;−;0;−;0;−;0;1;0;4;0;−;0;−;'''tat;0;0;0;1;0;−;0;−;0;−;0;−;0;−;0;0;'''tat;0;3;0;0;0;−;0;0;0;3;0;−;0;−
'''tca;0;0;1;0;0;5;6;5;0;4;5;4;0;6;3;4;'''tca;7;6;2;6;0;4;0;2;4;2;1;3;3;*5;0;14;'''tca;1;1;2;2;0;1;1;4;0;1;0;1;0;3;0;2;'''tca;1;12;§7;18;0;2;1;2;0;4;3;14;6;4;0;2;'''tca;0;3;0;6;0;5;0;0;4;15;1;4;2;1;0;2;'''tca;0;1;0;1;1;1;0;3;4;3;1;3;0;5;0;5;'''tca;0;3;0;3;1;1;1;8;0;2;10;6;0;8;0;0;'''tca;0;4;10;9;4;4;2;2;0;7;0;8;0;3;0;2;'''tca;7;5;1;4;0;4;6;8;0;4;0;6;0;3;0;5;'''tca;0;8;0;7;0;4;0;5;5;2;22;18;6;4
'''tcc;0;−;0;−;0;−;1;1;0;0;1;2;4;$3;0;−;'''tcc;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;'''tcc;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''tcc;0;0;0;−;0;−;0;−;0;1;$5;$3;0;−;0;−;'''tcc;0;−;0;−;0;−;0;−;0;1;0;−;0;−;0;−;'''tcc;0;−;0;−;0;0;0;−;1;1;0;0;1;2;0;3;'''tcc;0;2;0;−;0;−;0;−;0;−;3;0;0;0;0;−;'''tcc;0;−;0;−;0;0;0;−;0;1;1;2;0;−;0;−;'''tcc;0;2;0;0;0;−;0;−;0;−;0;0;0;−;0;−;'''tcc;5;$3;0;−;0;−;0;−;0;0;1;1;$5;$3
'''tcg;0;1;7;0;0;3;3;3;0;3;4;0;0;6;4;3;'''tcg;3;5;3;2;1;6;0;2;10;4;0;3;0;§3;1;8;'''tcg;1;2;0;3;3;0;0;5;2;0;4;0;0;3;0;2;'''tcg;0;4;23;5;0;0;1;0;0;4;1;12;4;1;0;2;'''tcg;0;3;1;2;0;2;0;0;0;3;0;2;0;1;0;0;'''tcg;0;1;0;2;0;2;0;3;1;0;0;1;0;4;1;6;'''tcg;0;2;1;3;0;2;1;4;1;2;3;5;0;2;0;0;'''tcg;0;2;18;16;1;3;5;1;1;4;0;3;0;2;0;3;'''tcg;4;5;0;2;0;2;1;4;0;3;0;5;0;0;1;2;'''tcg;1;1;0;4;0;2;0;3;2;0;13;9;3;2
'''tct;4;0;4;1;6;3;26;10;3;6;8;2;8;4;14;2;'''tct;16;3;11;3;5;4;5;0;14;4;5;3;12;13;2;21;'''tct;6;1;8;4;5;2;7;2;5;2;6;2;8;3;5;1;'''tct;5;2;38;13;1;0;4;4;6;4;12;17;10;4;2;4;'''tct;5;3;9;19;0;2;0;0;5;3;6;5;6;1;2;2;'''tct;4;1;1;5;5;4;5;2;7;4;0;3;3;6;0;−;'''tct;1;0;7;2;2;3;6;3;5;1;7;4;6;3;0;0;'''tct;6;2;14;7;8;5;10;2;3;7;6;5;2;8;4;3;'''tct;8;2;6;2;7;2;0;−;6;3;6;8;2;0;4;9;'''tct;5;8;5;5;3;3;3;8;4;8;23;16;8;4
'''tga;0;0;0;−;0;1;0;−;0;$4;0;−;0;$4;0;−;'''tga;1;1;0;1;0;0;0;1;0;0;0;1;0;2;0;3;'''tga;0;0;0;0;0;0;0;0;0;0;0;0;0;3;0;1;'''tga;0;$4;0;0;0;−;0;0;0;2;0;1;0;−;3;3;'''tga;0;1;0;$4;0;3;0;−;0;1;0;−;3;3;0;−;'''tga;0;−;0;−;0;0;0;0;0;0;0;0;0;2;0;4;'''tga;0;3;0;0;0;0;0;0;0;0;0;−;0;2;0;−;'''tga;0;0;0;0;0;0;0;0;0;2;0;1;0;0;0;1;'''tga;0;0;0;2;0;1;0;−;0;−;0;0;0;0;0;$4;'''tga;0;0;0;0;0;0;0;$4;0;0;0;0;0;−
'''tgc;8;3;4;0;13;11;4;13;5;18;6;8;25;14;14;1;'''tgc;16;4;11;1;9;11;24;16;12;2;9;22;5;9;4;13;'''tgc;18;15;4;19;3;3;9;12;4;2;5;2;10;14;14;19;'''tgc;13;18;*21;34;5;4;6;4;5;29;8;18;13;0;5;17;'''tgc;6;22;5;22;3;13;0;0;8;19;31;14;19;9;2;2;'''tgc;17;9;11;8;32;27;15;9;7;2;0;4;9;13;18;18;'''tgc;5;*12;9;15;10;10;8;33;6;3;8;8;12;17;0;−;'''tgc;13;14;38;29;8;5;2;4;9;24;9;23;26;13;13;11;'''tgc;6;6;10;10;2;5;20;10;10;12;29;18;5;3;2;19;'''tgc;7;7;5;9;6;18;2;19;5;5;§32;§22;10;14
'''tgg;3;3;5;0;3;6;11;4;13;*3;12;5;5;*5;12;0;'''tgg;19;2;9;2;0;5;2;3;14;3;1;9;10;19;1;8;'''tgg;1;6;4;3;6;1;3;11;7;1;6;1;3;3;2;4;'''tgg;1;21;§6;26;0;2;3;2;2;6;10;18;15;2;1;4;'''tgg;2;4;6;16;2;12;0;0;3;5;3;5;1;6;2;2;'''tgg;2;1;2;3;2;5;2;8;7;6;1;2;0;9;5;8;'''tgg;2;44;3;6;0;5;7;4;2;3;11;6;4;5;0;−;'''tgg;3;4;1;7;12;1;8;0;1;8;3;4;1;6;1;4;'''tgg;10;2;1;6;3;4;5;12;3;3;3;3;0;2;2;10;'''tgg;5;6;7;9;2;3;9;*5;9;0;21;11;20;6
'''tgt;0;−;0;−;0;−;0;−;0;1;0;−;$1;$4;0;−;'''tgt;0;1;0;−;0;−;0;−;0;−;0;−;0;0;0;4;'''tgt;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''tgt;0;0;0;−;0;−;0;−;0;0;0;−;0;−;0;−;'''tgt;0;−;0;0;0;4;0;−;0;1;0;3;0;−;0;−;'''tgt;0;−;0;0;0;0;0;−;0;0;0;−;0;0;0;−;'''tgt;0;$4;0;−;0;−;0;0;0;−;0;0;0;3;0;−;'''tgt;0;1;0;−;0;0;0;−;0;−;0;0;0;−;0;−;'''tgt;0;−;0;0;0;−;0;−;0;0;0;−;0;0;0;4;'''tgt;0;−;0;−;0;0;1;4;0;0;0;1;0;0
'''tta;0;1;1;4;1;3;3;2;1;11;2;1;0;9;2;3;'''tta;4;2;1;2;0;3;0;3;0;4;0;10;1;11;0;12;'''tta;0;3;0;4;0;3;0;7;0;2;1;3;0;3;0;2;'''tta;0;18;4;7;0;10;0;2;1;7;1;14;4;4;0;3;'''tta;0;3;1;13;0;10;0;0;1;14;0;1;0;2;0;0;'''tta;0;1;0;2;2;4;0;3;3;4;1;2;0;7;3;6;'''tta;0;4;1;4;0;2;0;11;0;2;1;2;0;9;0;0;'''tta;0;6;2;2;1;5;1;0;0;7;2;8;0;2;0;3;'''tta;0;3;0;8;0;5;5;8;0;3;0;2;1;2;0;5;'''tta;1;3;0;6;29;12;0;5;2;6;11;34;2;2
'''ttc;4;0;8;0;8;2;16;4;4;8;13;4;12;17;16;5;'''ttc;18;5;10;4;4;5;4;3;19;4;4;3;10;24;2;19;'''ttc;5;2;7;5;7;0;5;6;5;2;8;0;8;3;5;2;'''ttc;4;7;23;11;4;1;5;4;5;7;12;23;17;4;4;1;'''ttc;5;4;13;18;1;5;1;0;5;4;8;3;3;6;2;3;'''ttc;3;1;6;1;4;2;6;4;20;5;2;3;4;12;6;17;'''ttc;2;3;6;7;4;1;9;13;4;5;13;6;9;4;0;0;'''ttc;9;2;34;22;15;2;11;2;5;12;5;10;4;3;5;4;'''ttc;16;4;5;4;6;6;0;−;11;9;6;3;6;3;3;7;'''ttc;9;9;10;12;1;4;4;7;11;11;40;17;17;7
'''ttg;1;0;0;3;2;6;6;5;0;7;9;6;0;13;1;9;'''ttg;2;11;0;6;0;4;0;3;0;6;0;6;1;29;1;5;'''ttg;0;5;0;5;0;3;1;6;0;3;0;3;0;5;0;5;'''ttg;0;7;1;5;0;1;0;2;0;8;0;14;10;7;0;4;'''ttg;0;6;3;13;0;3;0;0;1;7;1;2;0;7;0;1;'''ttg;0;2;0;2;0;3;0;5;5;8;0;2;0;5;0;9;'''ttg;0;6;0;2;0;4;0;6;0;3;14;4;0;8;0;0;'''ttg;1;5;18;23;0;2;3;2;0;6;0;6;0;−;0;3;'''ttg;4;4;0;6;0;2;6;11;1;4;0;9;0;3;0;9;'''ttg;0;11;0;9;0;3;0;6;4;9;6;15;12;7
'''ttt;0;−;0;−;0;−;0;−;0;−;0;−;0;5;0;−;'''ttt;0;−;0;−;0;−;0;−;0;0;0;−;0;2;0;1;'''ttt;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;'''ttt;0;0;0;−;0;−;0;−;0;−;0;5;0;−;0;−;'''ttt;0;−;0;0;0;−;0;−;0;−;0;−;0;0;0;−;'''ttt;0;−;0;−;0;−;0;−;0;0;0;−;0;0;0;0;'''ttt;0;0;0;−;0;0;0;−;0;−;0;−;0;0;0;−;'''ttt;0;−;0;1;1;4;0;1;0;−;0;−;0;0;0;−;'''ttt;0;−;0;−;0;−;0;1;0;−;0;0;0;1;0;0;'''ttt;0;0;0;0;0;−;0;−;0;1;0;1;0;0
E79-tc;double;acs;double;aga;double;aml;double;ath;double;bacu;double;bdi;double;bta;double;cbr;E79;double;cbre;double;cel;double;cfa;double;cge;double;cjap;double;cjc;double;cmk;double;cpic;E79;double;cpo;double;csi;double;dme;double;dno;double;dsi;double;dya;double;ecb;double;eeu;E79;double;fca;double;gac;double;gfr;double;gga;double;ggo;double;gmo;double;gmx;double;hgl;E79;double;hsa-18;double;lav;double;lcm;double;lma;double;mcc;double;mdo;double;meu;double;mgp;E79;double;mlu;double;mmr;double;mmu;double;mpu;double;mtr;double;mun;double;nle;double;oaa;E79;double;oas;double;ocu;double;oga;double;oni;double;opr;double;osa;double;pan;double;pfa;E79;double;pha;double;pma;double;pop;double;ppp;double;ppy;double;ptr;double;rno;double;san;E79;double;sbi;double;sbq;double;shr;double;spu;double;ssc;double;str;double;tgu;double;tma;E79;double;tng;double;tru;double;tsy;double;ttr;double;vvi;double;xtr;double;zma
'''zéros;;17;;20;;12;;13;;10;;12;;5;;20;'''zéros;;12;;17;;14;;15;;17;;8;;3;;7;'''zéros;;14;;14;;20;;13;;22;;18;;14;;18;'''zéros;;5;;16;;18;;17;;9;;9;;16;;12;'''zéros;;16;;8;;12;;19;;7;;17;;15;;19;'''zéros;;18;;18;;9;;14;;7;;17;;8;;10;'''zéros;;9;;14;;14;;14;;18;;12;;8;;30;'''zéros;;11;;9;;12;;11;;7;;4;;15;;16;'''zéros;;7;;11;;17;;18;;14;;8;;11;;7;'''zéros;;12;;13;;12;;8;;7;;7;;11
'''db,diff;91;124;288;145;171;435;404;268;211;525;377;271;306;614;527;248;'''db,diff;763;280;411;201;142;382;172;258;598;223;153;333;413;830;79;468;'''db,diff;152;243;162;291;192;104;187;464;164;97;227;109;207;302;175;211;'''db,diff;164;594;632;742;63;138;113;166;129;371;435;938;498;248;83;282;'''db,diff;177;268;248;816;59;313;34;49;132;392;252;231;141;212;54;103;'''db,diff;114;140;104;152;188;289;125;374;328;316;65;147;126;375;278;546;'''db,diff;77;414;218;284;123;199;274;402;159;188;420;319;180;360;0;35;'''db,diff;154;258;742;820;377;277;250;186;172;435;164;449;161;250;147;223;'''db,diff;330;300;115;269;223;226;523;427;253;308;152;398;83;200;119;530;'''db,diff;210;387;273;342;134;279;170;522;232;346;848;820;572;465
'''total.diff;;215;;433;;606;;672;;736;;648;;920;;775;'''total.diff;;1043;;612;;524;;430;;821;;486;;1243;;547;'''total.diff;;395;;453;;296;;651;;261;;336;;509;;386;'''total.diff;;758;;1374;;201;;279;;500;;1373;;746;;365;'''total.diff;;445;;1064;;372;;83;;524;;483;;353;;157;'''total.diff;;254;;256;;477;;499;;644;;212;;501;;824;'''total.diff;;491;;502;;322;;676;;347;;739;;540;;35;'''total.diff;;412;;1562;;654;;436;;607;;613;;411;;370;'''total.diff;;630;;384;;449;;950;;561;;550;;283;;649;'''total.diff;;597;;615;;413;;692;;578;;1668;;1037
'''corel;;0.28;;0.14;;-0.02;;0.21;;0.11;;0.42;;0.21;;0.12;'''corel;;0.12;;0.22;;0.11;;0.44;;0.65;;0.55;;0.42;;0.34;'''corel;;0.36;;0.28;;-0.14;;0.28;;-0.26;;0.00;;0.20;;0.33;'''corel;;0.06;;0.31;;0.22;;0.46;;0.37;;0.72;;0.15;;0.07;'''corel;;0.20;;0.75;;0.42;;0.17;;0.32;;0.35;;0.23;;0.28;'''corel;;0.42;;0.30;;0.67;;0.06;;0.69;;0.10;;0.44;;0.61;'''corel;;0.23;;0.23;;0.18;;0.14;;-0.10;;0.60;;0.34;;−;'''corel;;0.34;;0.42;;0.19;;0.24;;0.52;;0.54;;0.44;;0.46;'''corel;;0.24;;0.24;;0.34;;0.62;;0.42;;0.14;;0.39;;0.15;'''corel;;0.53;;0.33;;0.28;;0.13;;0.51;;0.34;;0.60
'''db,dif;91;77;288;101;171;383;404;217;211;471;377;219;306;555;527;204;'''db,dif;763;228;411;154;142;332;172;209;598;176;153;277;413;769;79;411;'''db,dif;152;193;162;241;192;60;187;413;164;55;227;63;207;252;175;165;'''db,dif;164;535;632;694;63;92;113;119;129;316;435;883;498;200;83;230;'''db,dif;177;220;248;760;59;261;34;4;132;335;252;184;141;163;54;58;'''db,dif;114;94;104;106;188;234;125;324;328;259;65;100;126;319;278;492;'''db,dif;77;359;218;234;123;149;274;352;159;142;420;267;180;304;0;1;'''db,dif;154;205;742;765;377;225;250;133;172;378;164;389;161;201;147;175;'''db,dif;330;243;115;216;223;179;523;381;253;258;152;342;83;147;119;473;'''db,dif;210;335;273;291;134;227;170;466;232;289;848;763;572;412
'''total.dif;;168;;389;;554;;621;;682;;596;;861;;731;'''total.dif;;991;;565;;474;;381;;774;;430;;1182;;490;'''total.dif;;345;;403;;252;;600;;219;;290;;459;;340;'''total.dif;;699;;1326;;155;;232;;445;;1318;;698;;313;'''total.dif;;397;;1008;;320;;38;;467;;436;;304;;112;'''total.dif;;208;;210;;422;;449;;587;;165;;445;;770;'''total.dif;;436;;452;;272;;626;;301;;687;;484;;1;'''total.dif;;359;;1507;;602;;383;;550;;553;;362;;322;'''total.dif;;573;;331;;402;;904;;511;;494;;230;;592;'''total.dif;;545;;564;;361;;636;;521;;1611;;984
'''indice;;1.18;;2.85;;0.45;;1.86;;0.45;;1.72;;0.55;;2.58;'''indice;;3.35;;2.67;;0.43;;0.82;;3.40;;0.55;;0.54;;0.19;'''indice;;0.79;;0.67;;3.20;;0.45;;2.98;;3.60;;0.82;;1.06;'''indice;;0.31;;0.91;;0.68;;0.95;;0.41;;0.49;;2.49;;0.36;'''indice;;0.80;;0.33;;0.23;;8.50;;0.39;;1.37;;0.87;;0.93;'''indice;;1.21;;0.98;;0.80;;0.39;;1.27;;0.65;;0.39;;0.57;'''indice;;0.21;;0.93;;0.83;;0.78;;1.12;;1.57;;0.59;;0.00;'''indice;;0.75;;0.97;;1.68;;1.88;;0.46;;0.42;;0.80;;0.84;'''indice;;1.36;;0.53;;1.25;;1.37;;0.98;;0.44;;0.56;;0.25;'''indice;;0.63;;0.94;;0.59;;0.36;;0.80;;1.11;;1.39

C42-Genomes. Correlations et indices des doublons[modifier | modifier le wikicode]

C42;;;ani;;aor;;bfu;;cal;;cgr;;cjd;;cneg;;cot;;dha;;ecu;;ede;;fgr;;fgr5;;fve;;fvr;;kaf;;kpa;;kla;;kna;;lkl;;lth;;mfa;;mgr;;mth;;ncr;;ncs;;opa;;pch;;pic;;sas;;sce;;spo;;sre;;tbl;;tdl;;tpf;;ttt;;uma;;vda;;vma;;yli;;zro;
;;;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif
Phe;AAA;ttt;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;1;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Val;AAC;gtt;6;1;8;1;0;7;3;2;9;0;7;1;1;5;2;1;8;1;0;0;0;1;11;7;10;5;5;1;11;1;11;1;3;1;6;0;6;0;13;0;9;1;10;1;0;5;4;2;18;0;10;2;2;0;4;4;4;2;5;1;12;1;7;1;0;3;15;2;10;1;9;0;3;2;1;2;2;8;0;6;21;2;10;1
Leu;AAG;ctt;0;5;0;−;1;4;0;1;0;−;3;0;2;3;0;0;0;1;0;0;0;0;11;1;5;0;2;3;7;4;0;1;0;1;0;−;0;0;0;−;0;−;2;1;1;5;0;6;2;14;0;1;0;0;5;0;2;0;0;−;0;−;3;1;0;3;0;−;0;−;0;−;1;3;1;2;6;1;3;1;9;11;0;−
Ile;AAT;att;2;4;5;4;0;7;0;5;8;0;5;0;1;4;3;0;8;0;0;0;0;1;8;4;6;4;9;1;4;6;12;0;4;0;6;0;6;0;10;1;9;0;10;1;0;7;0;7;0;16;11;0;3;0;7;2;6;0;8;0;12;0;6;1;0;3;13;3;7;0;9;0;0;5;2;1;8;0;0;6;14;11;9;1
Cys;ACA;tgt;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Gly;ACC;ggt;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−
Arg;ACG;cgt;6;2;10;1;1;4;0;1;3;0;3;2;0;2;0;1;3;1;0;0;0;1;8;1;8;1;2;10;8;1;2;1;0;1;2;0;1;1;4;0;2;1;1;2;0;5;0;6;19;1;3;1;0;1;9;0;2;0;3;0;4;1;7;0;0;3;3;0;3;0;2;0;0;5;0;3;4;4;0;5;0;0;3;1
Ser;ACT;agt;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Ser;AGA;tct;4;0;4;2;6;0;3;0;8;0;6;0;1;4;0;1;5;0;0;0;0;0;5;5;5;5;3;3;6;3;8;2;3;0;5;0;6;0;4;6;8;0;7;2;0;3;1;3;12;1;10;1;1;0;3;3;5;0;6;0;9;1;6;0;0;1;13;2;6;0;7;0;2;0;0;2;3;2;2;2;17;3;11;0
Ala;AGC;gct;7;0;8;1;7;0;5;0;9;0;5;0;0;7;2;0;6;0;0;0;0;1;5;8;4;8;10;2;1;12;11;0;4;0;6;0;4;2;11;1;9;0;10;1;0;8;0;6;6;12;10;1;2;0;7;0;6;0;6;0;10;0;5;0;0;2;16;2;7;0;7;1;0;6;1;3;2;8;0;6;28;1;11;0
Pro;AGG;cct;1;4;3;5;0;3;0;0;0;0;0;−;0;5;0;0;0;0;0;0;0;−;4;5;4;5;0;3;1;8;0;0;1;0;0;0;0;0;0;0;1;0;1;0;1;3;0;5;8;3;0;0;0;−;0;−;0;0;0;0;1;0;5;0;0;2;0;0;0;0;0;0;0;3;0;3;4;3;0;0;15;5;1;1
Thr;AGT;act;4;1;8;1;2;3;2;1;8;0;5;0;0;4;3;0;6;1;0;0;0;1;7;3;7;3;0;6;4;6;8;2;3;1;5;0;6;0;9;2;7;1;9;0;1;4;1;4;9;2;10;0;2;0;6;5;6;0;5;1;10;0;5;1;0;3;11;3;7;1;6;2;0;3;3;0;6;1;0;3;21;0;9;0
Tyr;ATA;tat;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−
Asp;ATC;gat;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
His;ATG;cat;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Asn;ATT;aat;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Leu;CAA;ttg;0;1;0;−;0;4;1;4;3;4;6;0;0;2;0;0;3;0;0;0;0;0;0;2;0;2;0;3;0;3;0;1;0;2;4;2;2;2;4;6;1;6;12;1;0;1;0;1;0;4;0;8;2;0;0;−;7;0;4;2;5;4;3;0;0;−;3;5;3;4;1;0;0;0;0;−;0;1;0;2;0;2;0;9
Val;CAC;gtg;0;1;0;2;0;1;0;0;0;0;2;0;0;1;0;0;0;0;0;0;0;0;0;2;0;2;1;1;0;2;0;0;0;0;0;1;0;1;2;0;2;0;2;1;0;1;0;2;0;3;1;0;0;0;2;0;0;0;1;2;1;0;0;0;0;0;0;0;1;0;0;0;0;2;0;0;0;1;0;1;3;4;3;0
Leu;CAG;ctg;0;2;0;3;0;0;0;0;0;−;0;0;0;0;0;0;0;0;0;0;0;0;2;2;2;2;1;0;1;3;0;−;0;1;0;−;0;−;0;−;0;2;1;0;0;3;0;3;0;5;0;−;0;0;0;2;0;0;0;0;0;−;0;0;0;1;0;−;0;−;0;−;0;3;0;1;0;3;0;3;6;6;0;−
Met;CAT;atg;2;4;0;7;3;4;2;1;5;1;3;3;1;5;0;3;1;8;0;1;0;1;0;5;0;4;8;6;2;5;5;3;1;2;3;2;2;1;8;1;4;3;5;4;2;5;1;6;9;7;7;1;2;1;1;9;1;4;4;5;8;1;3;3;0;3;5;5;5;1;4;3;0;4;0;3;4;4;3;4;11;6;7;1
Trp;CCA;tgg;2;0;3;0;4;1;0;1;0;4;3;0;0;2;0;0;3;0;0;0;0;−;0;3;0;3;0;3;0;4;4;1;1;1;1;2;0;3;1;3;2;2;5;0;3;0;1;2;5;1;0;6;0;1;0;−;3;0;3;1;5;0;2;0;0;1;1;5;3;0;1;2;1;2;0;1;0;2;0;2;5;7;2;3
Gly;CCC;ggg;0;0;0;0;0;1;0;0;0;0;0;0;0;1;0;−;0;0;0;0;0;1;0;0;0;0;1;6;0;0;0;0;0;0;0;0;1;0;1;0;0;1;1;0;0;2;0;1;0;5;1;0;0;−;0;0;0;0;0;1;0;1;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;2;0;1;0;−;0;1
Arg;CCG;cgg;0;1;0;2;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;−;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;1;0;1;1;1;0;1;0;0;1;0;0;0;1;0;0;0;0;0;0;−;0;0;0;0;0;0;1;1;0;−;0;1;0;1;0;−;0;0
Arg;CCT;agg;0;1;0;1;0;0;0;0;0;0;0;−;0;2;0;0;0;0;0;0;0;0;0;2;0;2;2;3;0;1;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;2;0;1;1;3;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;2;0;0;1;0
Ser;CGA;tcg;0;1;0;2;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;0;2;0;2;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;2;1;1;1;2;0;0;0;0;0;1;0;1;0;2;0;0;0;0;0;1;0;1;0;0;0;0;0;2;0;2;1;2;0;2;1;2;0;1
Ala;CGC;gcg;2;0;1;2;0;1;0;−;0;−;0;−;0;1;0;−;0;0;0;0;0;0;0;1;0;2;3;1;1;1;0;−;0;−;0;−;0;0;0;−;0;1;1;0;0;1;0;2;0;4;0;−;0;−;0;1;0;−;0;1;0;−;0;0;0;0;0;−;0;−;0;−;0;2;0;0;2;1;0;1;1;0;0;−
Pro;CGG;ccg;0;1;0;−;0;0;0;−;0;−;0;−;0;0;0;−;0;−;0;0;0;0;0;1;0;1;0;1;0;1;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;1;0;2;0;3;0;−;0;−;0;0;0;−;0;−;0;−;0;0;0;0;0;−;0;−;0;−;0;2;0;0;0;1;0;0;0;1;0;−
Thr;CGT;acg;0;1;0;1;0;−;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;1;1;2;1;0;1;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;1;0;2;0;2;0;1;0;0;0;1;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;2;0;1;0;1;0;1
Stp;CTA;tag;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Glu;CTC;gag;5;2;8;2;0;8;0;0;2;0;8;0;0;9;0;0;0;0;0;0;0;1;12;6;8;4;1;10;4;11;1;0;3;0;1;0;2;0;1;1;8;2;6;1;0;8;0;7;12;11;0;0;1;1;9;0;1;0;7;0;1;0;5;0;0;3;0;0;2;1;0;0;1;5;0;4;10;1;0;8;11;15;3;0
Gln;CTG;cag;1;3;3;3;0;1;0;0;1;0;0;1;2;0;0;0;0;0;0;0;0;0;6;0;6;0;0;5;6;1;0;0;0;1;0;0;0;1;0;0;4;0;3;0;0;5;0;4;1;9;0;0;0;0;4;0;0;1;1;2;0;0;1;0;0;1;0;0;1;0;0;0;0;3;0;2;3;2;0;3;0;14;1;1
Lys;CTT;aag;7;0;8;2;1;8;0;1;11;0;7;0;5;1;0;2;6;3;0;0;0;−;12;3;8;3;2;8;10;4;11;0;3;1;7;1;6;0;13;0;13;1;8;1;2;6;0;8;20;3;13;0;2;0;8;0;6;2;8;0;13;0;6;2;0;4;13;1;7;2;7;1;0;5;0;4;11;0;2;6;10;23;13;0
Phe;GAA;ttc;2;2;1;5;2;4;1;3;5;0;4;3;0;4;0;1;5;3;0;0;0;0;3;7;2;6;0;14;1;8;2;6;4;0;4;0;1;4;4;3;0;6;9;0;2;4;1;3;8;3;3;6;2;0;3;1;4;1;3;3;5;4;3;1;0;3;5;6;2;3;6;2;0;4;1;1;2;4;1;2;6;10;4;3
Val;GAC;gtc;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Leu;GAG;ctc;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;0;1;0;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;0;0;0;0;−;0;−;4;1;0;0;0;0;0;−;0;−;0;−;0;−;0;−;0;0
Ile;GAT;atc;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;0;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0
Cys;GCA;tgc;1;1;0;3;0;4;0;1;2;0;1;1;0;2;0;−;3;0;0;0;0;0;2;2;2;2;0;3;1;3;4;0;1;0;2;0;1;2;3;1;2;1;2;1;0;2;1;1;5;1;3;0;0;0;0;2;2;0;1;1;3;0;1;1;0;1;0;−;2;0;3;0;1;1;0;1;1;3;1;1;7;0;3;0
Gly;GCC;ggc;10;0;14;0;0;7;4;0;11;0;10;0;4;4;1;0;10;0;0;0;0;1;2;11;2;12;0;10;11;2;16;0;3;1;6;0;7;1;14;0;13;1;15;0;0;13;9;1;24;1;12;0;3;0;10;0;9;0;10;0;15;0;7;0;1;4;22;0;10;0;12;0;7;2;0;5;12;0;0;8;29;0;15;1
Arg;GCG;cgc;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Ser;GCT;agc;0;3;1;4;0;4;0;1;1;1;2;0;0;1;0;0;1;1;0;0;0;0;1;6;1;6;3;0;1;5;2;1;0;1;0;1;2;0;0;3;0;2;3;2;0;2;0;4;0;5;1;2;1;0;1;2;0;1;1;2;2;1;2;0;0;−;0;5;2;0;0;2;0;2;1;0;2;2;0;2;0;5;0;4
Ser;GGA;tcc;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−
Ala;GGC;gcc;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Pro;GGG;ccc;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Thr;GGT;acc;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Tyr;GTA;tac;1;4;2;10;1;4;0;3;5;0;2;3;0;3;1;1;3;2;0;0;0;0;4;3;3;2;0;5;1;6;6;2;0;3;4;0;1;3;0;6;1;4;8;1;0;4;2;3;4;5;7;1;0;1;2;2;1;3;2;2;6;1;1;2;0;1;2;6;3;3;4;1;0;3;2;0;0;5;2;2;4;9;6;0
Asp;GTC;gac;2;5;5;7;3;5;5;0;8;0;5;2;0;1;4;0;8;1;0;0;0;1;13;0;9;0;0;6;13;0;12;0;5;0;7;0;6;1;12;0;9;0;13;0;5;4;0;9;10;7;13;0;2;0;7;1;7;0;9;1;14;1;7;0;0;2;16;2;8;0;10;1;0;5;2;2;4;5;1;4;3;24;10;3
His;GTG;cac;3;1;1;6;0;3;0;2;4;1;4;1;0;3;0;0;4;1;0;0;0;1;2;4;2;4;0;6;1;4;5;0;2;0;3;0;3;0;5;0;2;2;7;0;3;0;0;3;3;5;7;0;1;0;6;4;3;0;3;2;6;0;3;0;0;1;6;0;3;0;4;0;0;2;0;0;5;0;0;5;7;4;4;1
Asn;GTT;aac;0;5;4;3;1;4;0;2;6;2;5;1;0;3;2;0;7;1;0;1;0;0;3;5;4;4;4;7;3;4;9;0;3;0;5;0;5;0;8;0;6;0;8;3;0;5;4;1;9;2;8;1;1;0;4;1;5;1;6;1;9;0;4;1;0;3;10;0;5;1;7;1;0;2;1;2;0;5;0;4;7;8;7;1
Leu;TAA;tta;0;0;0;2;0;1;3;1;2;0;0;0;0;0;2;0;8;1;0;0;0;0;0;1;0;0;0;0;0;1;11;2;0;0;1;1;2;0;2;0;1;0;2;1;0;0;0;0;0;0;5;1;0;0;0;1;2;0;1;1;6;0;0;1;0;−;10;1;2;0;8;0;0;6;0;−;0;0;0;−;0;0;3;0
Val;TAC;gta;0;0;0;1;0;1;0;0;0;1;0;1;0;−;0;0;0;1;0;0;0;0;0;1;0;1;0;2;0;1;0;1;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;1;0;1;0;1;0;−;0;0;0;1;1;1;1;0;1;0;0;0;0;1;0;0;1;0;0;0;0;0;0;0;0;0;1;0;0;1
Leu;TAG;cta;0;1;0;0;0;0;0;−;3;0;1;1;0;−;0;−;0;0;0;0;0;0;0;1;0;1;0;1;0;1;0;1;0;0;0;1;1;1;0;2;0;2;0;−;0;0;0;0;0;1;0;2;0;0;0;−;0;−;1;2;1;1;0;0;0;0;0;1;0;3;0;1;0;0;0;1;0;0;0;2;0;1;0;4
Ile;TAT;ata;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0;0;0;1;0;0;0;0;0;2;0;2;0;1;0;0;0;1;0;0;0;0;0;1;0;0;0;0;1;2;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0;1;0;0;1;0;0;0;0;0;0;−;0;0;0;0;0;0
SeC;TCA;tga;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;0;0;−;0;0;0;0;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;0;0;−;0;0;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;1;0;0;0;−;0;−;0;−
Gly;TCC;gga;0;2;2;1;3;3;1;0;1;0;2;1;1;1;0;0;2;2;0;0;0;0;0;5;0;4;4;4;3;1;1;2;0;2;0;1;0;0;1;0;2;0;4;1;0;2;1;2;2;1;2;0;0;1;1;3;1;1;1;0;2;0;0;2;0;1;1;1;1;0;0;1;0;1;0;1;0;2;2;0;1;9;4;0
Arg;TCG;cga;0;1;1;0;1;2;0;−;0;−;0;−;4;0;0;−;0;−;0;0;0;1;2;6;2;6;4;3;1;5;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;1;0;0;0;1;0;−;0;−;0;1;0;−;0;−;0;−;0;0;0;0;0;−;0;−;0;−;0;0;0;2;0;1;1;0;14;10;0;−
Arg;TCT;aga;1;0;0;1;0;4;4;0;8;0;5;1;0;0;1;0;7;2;0;0;0;−;0;2;0;2;0;1;0;1;9;1;2;1;5;1;4;1;10;1;6;2;9;0;0;0;0;0;1;3;9;0;2;0;0;−;5;1;5;1;10;0;0;1;0;0;10;2;5;1;6;1;0;0;0;0;0;2;0;0;3;0;7;0
Ser;TGA;tca;0;0;0;0;1;2;1;1;1;0;0;2;0;0;0;1;1;2;0;0;0;0;0;1;0;1;0;1;0;1;3;0;1;0;1;0;0;0;1;0;1;0;3;0;0;1;0;2;0;2;2;1;0;0;0;0;1;0;0;2;2;0;0;1;0;0;3;0;1;0;1;0;0;0;0;0;0;2;0;0;0;1;0;2
Ala;TGC;gca;0;1;1;1;0;4;0;1;4;0;1;1;0;0;1;0;3;1;0;0;0;0;0;3;0;2;3;5;1;1;3;1;1;0;2;0;0;0;3;0;0;2;6;1;0;2;0;1;0;2;3;1;1;0;0;1;2;0;1;4;4;0;1;0;0;0;3;1;3;0;2;0;0;1;0;0;0;1;0;1;3;0;6;2
Pro;TGG;cca;0;1;0;2;0;7;0;3;5;1;6;0;0;0;0;2;2;4;0;0;0;0;0;2;0;2;1;2;0;2;1;8;3;0;1;5;2;3;5;4;1;6;2;5;0;1;0;1;1;2;2;7;1;1;0;−;2;3;3;4;3;6;0;1;0;0;0;12;4;1;0;6;0;1;0;0;0;2;0;1;2;0;9;0
Thr;TGT;aca;0;1;0;1;0;2;1;0;2;0;1;1;0;0;1;0;0;2;0;0;0;0;1;2;1;2;0;2;1;2;2;0;0;0;1;0;0;1;1;0;0;1;3;0;0;1;0;1;0;2;1;1;0;0;0;2;1;0;0;2;2;1;0;1;0;0;1;1;1;0;0;1;0;0;0;0;0;2;0;2;0;2;1;0
Stp;TTA;taa;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Glu;TTC;gaa;0;2;1;4;0;5;1;4;8;0;3;1;0;2;0;1;7;1;0;0;0;0;1;3;1;2;1;4;0;4;14;0;3;1;7;0;4;1;12;0;4;1;6;1;1;1;0;1;3;1;11;1;1;0;0;2;7;0;2;1;12;1;3;0;0;1;11;4;7;0;8;2;0;1;0;1;0;1;0;2;3;2;8;1
Gln;TTG;caa;0;1;1;2;2;3;0;4;5;0;5;0;0;1;0;2;5;1;0;0;0;0;0;4;0;4;0;3;0;3;7;1;2;0;3;2;3;0;8;1;2;2;6;1;0;1;0;1;0;2;8;0;1;0;0;2;3;1;3;0;6;2;2;1;0;2;7;2;4;1;5;1;0;1;0;1;0;1;0;1;0;2;9;0
Lys;TTT;aaa;0;1;0;2;0;2;3;1;2;0;2;2;0;0;3;0;5;2;0;0;0;0;0;2;0;1;0;5;0;1;1;6;0;2;2;1;1;2;1;3;2;1;2;3;1;0;1;1;0;1;2;5;0;1;0;0;0;2;1;2;5;1;1;1;0;0;6;2;2;2;4;1;0;1;0;0;0;1;0;−;0;3;5;1
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
corrélation;;;-0.16;;-0.04;;-0.15;;-0.18;;-0.15;;-0.07;;0.03;;-0.24;;0.09;;−;;−;;0.19;;0.17;;-0.03;;0.02;;-0.15;;-0.18;;-0.10;;-0.11;;-0.09;;-0.19;;-0.05;;0.02;;-0.12;;-0.03;;-0.27;;-0.19;;-0.03;;-0.12;;-0.14;;0.00;;0.05;;0.33;;-0.01;;0.08;;0.03;;-0.04;;-0.04;;-0.10;;0.00;;0.08;;-0.23;
total;;;69;67;103;98;39;130;40;44;150;16;122;29;22;83;26;16;130;44;0;2;0;12;126;136;103;124;72;166;104;136;181;45;56;23;100;21;85;32;171;45;132;55;208;38;22;123;28;118;194;160;175;54;33;8;100;55;104;25;116;51;205;29;100;23;1;53;210;78;127;25;135;30;17;94;15;51;92;90;18;103;263;204;185;45
idble;;;1.03;;1.05;;0.30;;0.91;;9.38;;4.21;;0.27;;1.63;;2.95;;0.00;;0.00;;0.93;;0.83;;0.43;;0.76;;4.02;;2.43;;4.76;;2.66;;3.80;;2.40;;5.47;;0.18;;0.24;;1.21;;3.24;;4.13;;1.82;;4.16;;2.27;;7.07;;4.35;;0.02;;2.69;;5.08;;4.50;;0.18;;0.29;;1.02;;0.17;;1.29;;4.11;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;ani;;aor;;bfu;;cal;;cgr;;cjd;;cneg;;cot;;dha;;ecu;;ede;;fgr;;fgr5;;fve;;fvr;;kaf;;kapa;;kla;;kna;;lkl;;lth;;mfa;;mgr;;mth;;ncr;;ncs;;opa;;pch;;pic;;sas;;sce;;spo;;sre;;tbl;;tdl;;tpf;;ttt;;uma;;vda;;vma;;yli;;zro;
;;;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif

B42-Genomes. Correlations et indices des doublons[modifier | modifier le wikicode]

B42;;;cbl;;spl;;pdi;;ppoy;;sbn;;eal;;eco;;sbz;;eno;;kpn;;bcef;;bcoh;;blr;;dzc;;eclx;;gmc;;ksa;;mme;;mvs;;pge;;pha;;pse;;sfr;;vag;;vau;;vha;;vvm;;yrb;;bae;;saci;;sep;;hmr;;bbd;;lpl;;sty;;sma;;sho;;ksk;;ype;;pdix;;hmo;;vpf;
;;;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif;double;dif
Phe;AAA;ttt;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−
Val;AAC;gtt;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Leu;AAG;ctt;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Ile;AAT;att;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Cys;ACA;tgt;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Gly;ACC;ggt;0;−;0;1;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Arg;ACG;cgt;0;0;5;1;0;2;3;0;5;0;2;0;3;0;3;0;3;0;3;0;1;1;2;0;3;1;2;0;2;1;1;2;3;0;2;0;3;1;3;0;3;0;1;1;2;1;5;0;2;2;6;0;4;1;2;0;1;0;0;0;0;1;0;−;0;0;1;0;2;1;0;0;0;0;1;0;0;1;0;0;2;0;6;0
Ser;ACT;agt;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Ser;AGA;tct;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−
Ala;AGC;gct;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Pro;AGG;cct;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Thr;AGT;act;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−
Tyr;ATA;tat;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Asp;ATC;gat;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;1;0;−;0;−;0;−;0;−;0;−
His;ATG;cat;0;−;0;1;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Asn;ATT;aat;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Leu;CAA;ttg;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;1;0;0;0;1;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1
Val;CAC;gtg;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;1;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;0;0;−;0;−;0;−;0;3;1;0;1;0;0;−;0;−;0;0;0;−
Leu;CAG;ctg;0;−;0;−;1;0;1;1;0;1;2;1;1;2;2;1;1;2;2;1;0;−;0;0;0;0;6;1;1;2;0;0;0;3;0;−;0;−;3;0;0;−;2;0;0;0;0;−;0;−;0;−;0;−;2;1;0;−;0;1;0;−;0;0;0;−;0;0;2;1;0;0;0;0;0;0;0;1;0;−;1;2;0;−
Met;CAT;atg;2;4;8;4;1;2;1;5;4;5;4;4;3;4;3;2;3;2;4;2;2;5;3;2;3;4;2;3;4;3;2;3;3;2;3;7;8;2;4;2;4;2;1;2;4;4;4;2;4;3;5;4;6;3;4;2;3;2;4;1;1;2;0;2;0;2;1;3;3;2;3;2;3;4;2;2;3;2;5;4;4;3;7;3
Trp;CCA;tgg;0;0;1;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;1;0;1;0;1;0;1;0;0;0;0;1;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0
Gly;CCC;ggg;0;0;0;−;0;0;0;−;0;−;0;0;0;0;0;0;0;1;0;0;0;−;0;0;0;−;0;0;0;0;0;0;0;0;0;−;0;−;0;0;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;0;0;−;0;0;0;−;0;0;0;0;0;0;0;0;0;1;0;0;0;−;0;0;0;−
Arg;CCG;cgg;0;−;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;−;0;0;0;0;0;0;0;0;0;0;0;0;0;−;0;1;0;0
Arg;CCT;agg;0;0;0;0;0;0;0;−;0;0;0;0;0;0;0;1;0;0;0;0;0;−;0;0;0;−;0;0;0;0;0;−;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;−;0;0;0;0;0;0;0;1;0;1;0;1;0;0;0;0;0;−;0;0;0;0
Ser;CGA;tcg;0;−;0;−;0;0;0;0;0;−;0;0;0;0;0;0;0;−;0;0;0;−;0;0;0;−;0;0;0;−;0;0;0;0;0;−;0;−;0;0;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;1;0;−;0;0;0;−;0;0;0;1;0;3;0;1;0;0;0;−;0;−;0;0;0;−
Ala;CGC;gcg;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;1;1;0;−;0;0;0;−;0;0;0;−;0;0;0;0;0;0;0;−;0;−;0;0;0;−
Pro;CGG;ccg;0;−;0;−;0;0;0;−;0;−;0;0;0;0;0;0;0;−;0;0;0;−;0;0;0;−;0;0;0;−;0;0;0;0;0;−;0;−;0;0;0;−;1;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;0;0;0;0;0;0;0;0;0;0;−;0;−;0;1;0;−
Thr;CGT;acg;0;−;0;−;0;0;0;0;0;−;0;0;0;1;0;0;0;0;0;0;0;−;0;0;0;−;0;0;0;0;0;0;0;0;0;−;0;−;0;0;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;0;0;0;0;−;0;0;0;0;0;0;0;0;0;1;0;−;0;−;0;0;0;−
Stp;CTA;tag;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;1;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Glu;CTC;gag;0;0;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;0;0;−;0;0;0;−;2;0;1;1;2;0;0;−;0;−;0;−;0;−
Gln;CTG;cag;0;0;0;−;1;0;0;−;0;−;1;0;1;0;1;0;0;1;1;0;0;−;0;−;0;−;1;0;0;1;0;−;0;1;0;−;0;−;2;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;0;0;−;0;0;0;−;0;0;0;0;0;1;0;1;0;1;0;0;0;−;0;−;0;−
Lys;CTT;aag;0;1;0;−;0;1;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;0;0;−;0;0;0;−;0;0;0;−;2;0;2;0;3;0;0;0;0;−;0;−;0;−
Phe;GAA;ttc;2;0;3;0;0;1;2;0;2;0;1;0;1;0;1;0;1;0;1;0;1;1;0;2;1;1;1;0;1;0;1;0;1;0;1;0;3;0;0;1;1;1;1;0;1;0;2;1;1;1;2;1;2;1;1;0;1;1;0;0;0;1;0;0;0;0;1;0;1;0;0;0;0;0;0;0;1;0;2;0;1;1;2;1
Val;GAC;gtc;0;−;1;0;0;0;0;0;1;0;0;1;0;1;0;1;0;1;0;2;0;−;0;0;0;1;0;1;0;1;0;0;0;1;0;0;0;1;0;2;0;1;0;0;1;0;0;1;0;1;0;1;0;1;2;0;0;0;1;1;0;−;0;0;0;−;0;−;0;1;0;2;1;1;1;2;0;1;0;−;3;0;0;1
Leu;GAG;ctc;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;1;0;1;0;0;0;0;0;0;1;0;0;0;0;0;0;0;−;0;0;1;0;0;1;1;0;0;0;0;−;1;0;1;0
Ile;GAT;atc;0;1;2;0;6;0;1;1;2;0;2;0;2;0;2;0;2;0;2;0;3;0;1;1;2;1;2;0;2;0;1;2;2;0;2;0;10;0;2;0;1;0;7;0;2;1;6;0;2;0;4;0;7;0;2;0;1;1;0;1;1;0;1;0;0;0;2;0;2;0;0;0;0;0;0;0;2;0;0;0;3;0;2;0
Cys;GCA;tgc;0;1;3;0;0;1;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;1;0;0;1;0;2;0;0;0;1;0;0;0;0;1;3;0;0;1;2;2;1;1;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;1;0;1;0;3;0;0;1;0;0;2;2;1
Gly;GCC;ggc;2;0;7;0;2;0;3;1;5;0;2;0;3;0;3;0;3;0;3;0;2;1;3;0;4;0;3;0;3;0;2;2;3;0;3;0;4;0;3;0;4;1;1;0;3;1;8;0;5;1;9;0;7;0;3;0;1;0;0;1;1;0;0;0;0;0;1;0;2;0;1;1;2;0;2;1;1;0;1;0;2;4;10;0
Arg;GCG;cgc;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Ser;GCT;agc;1;0;2;0;0;0;1;1;1;0;0;0;0;0;0;0;0;0;0;0;1;0;0;1;1;0;0;0;0;0;0;1;0;0;0;0;1;0;0;0;1;0;0;0;1;0;1;0;1;0;1;0;1;0;0;0;1;0;0;1;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;1;0;1;0;1;0
Ser;GGA;tcc;0;0;0;0;1;0;2;0;0;0;1;0;1;0;1;0;1;0;1;0;0;0;0;0;0;1;1;0;1;0;0;0;0;1;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0
Ala;GGC;gcc;0;−;1;0;0;0;0;0;1;0;1;0;1;0;1;0;1;0;1;0;0;−;0;0;0;0;5;0;0;1;0;0;1;0;0;0;0;0;1;0;0;0;1;1;0;1;0;0;0;0;0;0;0;−;1;0;0;0;0;0;0;−;0;0;0;0;0;−;1;0;1;0;1;0;2;1;1;0;0;−;4;0;0;0
Pro;GGG;ccc;0;−;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;−;0;−;0;0;0;0;0;0;0;−;0;0;0;0;0;−;0;0;0;0;0;0;0;0;0;−;0;0;0;−;0;0;0;1;0;−;1;0;0;−;0;0;0;0;0;−;0;0;2;0;2;0;0;0;0;0;0;−;1;1;0;−
Thr;GGT;acc;0;0;0;0;0;0;0;0;0;1;0;1;0;1;0;1;1;0;1;0;0;0;0;0;0;1;0;1;1;0;0;0;1;0;0;0;0;0;1;0;0;0;0;1;0;0;0;1;0;1;0;1;0;1;0;1;0;0;0;0;0;−;0;0;0;0;0;0;0;1;0;1;0;1;1;0;0;1;0;−;1;1;0;1
Tyr;GTA;tac;1;0;5;0;2;0;3;0;3;0;1;1;1;1;1;1;1;1;2;0;2;0;0;1;3;0;1;0;0;2;1;0;1;1;1;0;4;0;1;1;2;0;1;0;3;0;2;0;4;0;4;0;3;0;2;0;1;0;0;0;1;0;0;0;0;0;1;0;0;1;0;0;0;0;0;0;1;0;2;0;2;1;5;1
Asp;GTC;gac;2;1;5;0;1;1;4;0;3;0;2;0;2;0;2;0;2;0;2;0;5;0;0;3;4;1;2;0;2;0;1;2;2;0;5;1;4;0;2;0;10;0;5;1;2;1;5;0;4;0;5;0;6;0;1;1;3;0;1;0;0;2;0;0;1;1;2;0;2;0;1;0;1;0;1;0;1;1;2;1;2;1;6;0
His;GTG;cac;1;0;1;0;1;0;1;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;1;0;0;0;0;1;0;0;0;0;0;1;2;0;0;0;1;1;0;1;0;0;1;1;0;1;0;1;0;0;0;1;0;0;1;0;1;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;1;0;0;1;1;0
Asn;GTT;aac;1;1;6;0;1;1;5;0;4;0;3;0;3;0;3;0;3;0;3;0;3;1;2;1;3;1;2;0;3;1;1;2;3;0;1;0;5;0;3;0;3;0;2;0;2;2;4;0;3;0;2;2;4;0;2;0;2;1;1;0;1;1;0;0;0;0;2;2;3;1;1;0;1;0;0;1;2;0;2;1;3;0;2;2
Leu;TAA;tta;1;0;3;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;1;0;0;1;0;1;0;0;0;0;1;0;0;0;1;0;3;1;0;0;2;0;0;0;1;1;1;1;1;0;2;0;0;1;0;0;0;1;0;0;1;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;3;1;0;0;1;1
Val;TAC;gta;4;0;10;0;2;0;4;1;3;0;1;2;4;0;3;0;2;1;4;0;4;0;1;2;4;0;7;0;2;1;2;1;3;0;5;0;6;0;3;0;5;1;3;1;4;1;1;0;1;0;3;0;0;0;2;0;2;0;0;0;1;1;0;0;1;0;2;0;1;1;0;0;0;0;0;0;2;0;2;3;1;0;3;0
Leu;TAG;cta;1;0;4;0;0;0;1;0;0;1;0;0;0;0;0;0;0;0;0;0;1;0;0;1;3;0;0;0;0;0;0;1;0;0;1;0;4;0;0;0;2;1;0;0;0;1;1;1;1;2;3;1;4;2;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;8;2
Ile;TAT;ata;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
SeC;TCA;tga;0;0;0;0;0;−;0;−;0;0;0;0;0;0;0;0;0;0;0;0;0;−;0;−;0;−;0;−;0;0;0;−;0;0;0;−;0;−;0;0;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;0;0;−;0;0;0;0;0;0;0;−
Gly;TCC;gga;3;0;0;0;1;0;2;1;0;0;1;0;0;0;0;0;0;0;0;0;2;1;1;0;3;0;0;0;0;0;1;1;0;0;0;0;1;2;0;0;0;0;0;0;0;0;1;0;1;0;2;1;1;0;0;0;1;1;0;0;1;3;0;0;0;0;1;1;0;0;0;2;0;1;0;0;0;0;4;0;0;0;1;0
Arg;TCG;cga;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;0;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;1;0;−;0;0;0;0;0;−;0;−;0;−;0;−;2;0;0;−;0;−;0;−;0;−
Arg;TCT;aga;2;0;0;0;0;0;1;0;0;0;0;1;0;0;0;1;0;0;0;0;0;−;0;0;1;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;2;1;0;0;0;0
Ser;TGA;tca;1;0;2;1;0;1;0;0;2;1;0;0;0;0;0;1;0;1;0;0;0;2;0;1;2;0;0;0;1;0;1;0;0;0;0;0;6;1;0;0;2;1;0;0;2;0;3;0;2;0;3;0;2;0;0;1;0;1;0;0;1;1;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;1;2;0;0;0;3;0
Ala;TGC;gca;2;0;2;0;5;1;2;2;2;0;2;0;2;0;2;0;2;0;2;0;3;1;2;1;2;1;2;0;2;0;3;1;2;0;2;0;10;0;2;0;2;0;7;0;2;0;7;0;2;1;5;1;6;2;2;0;1;1;0;1;2;0;1;0;0;0;1;0;2;0;0;0;0;0;0;0;2;0;4;0;1;0;4;0
Pro;TGG;cca;2;0;2;0;0;0;2;1;2;0;0;0;0;0;0;0;1;0;0;0;1;1;0;1;2;1;0;0;1;0;2;0;0;0;1;0;3;0;0;0;2;0;0;0;3;0;2;0;2;0;2;0;2;0;1;0;0;0;0;0;0;1;0;0;0;1;1;0;0;0;0;0;0;0;0;0;1;0;2;0;0;0;2;0
Thr;TGT;aca;1;2;3;0;2;0;2;1;2;0;1;0;0;0;0;0;0;0;0;0;1;1;0;1;5;0;0;0;0;0;1;1;0;0;2;1;3;0;0;0;2;0;0;0;1;0;4;0;2;1;4;0;3;0;1;0;0;2;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;4;0;0;1;4;0
Stp;TTA;taa;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−;0;−
Glu;TTC;gaa;1;1;12;0;0;1;5;0;6;0;2;1;3;0;3;0;3;0;3;0;5;1;2;1;5;0;3;0;3;0;4;0;3;0;2;0;0;−;2;1;5;1;1;3;5;0;2;0;3;0;4;0;0;0;3;0;4;1;1;0;0;2;0;0;1;0;1;0;3;0;0;0;0;0;0;0;2;0;4;0;4;1;5;0
Gln;TTG;caa;1;0;4;0;0;0;3;0;1;1;1;0;1;0;1;0;1;0;1;0;3;1;0;2;2;1;0;0;1;0;1;2;1;0;2;0;3;0;0;0;3;0;0;0;2;0;0;0;0;1;0;1;4;0;1;0;1;2;0;2;0;1;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;2;0;3;0;4;1
Lys;TTT;aaa;3;0;11;0;0;1;4;1;6;3;3;0;5;0;4;0;4;0;5;0;4;1;2;1;5;0;2;0;4;0;2;1;4;0;3;0;6;0;4;0;6;1;1;0;5;0;1;0;1;0;3;0;0;0;4;0;2;0;0;−;1;1;0;0;1;0;1;0;2;1;0;0;0;0;0;0;2;1;4;0;4;0;3;0
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
corrélation;;;0.08;;0.19;;0.00;;0.03;;0.31;;0.42;;0.15;;0.04;;0.07;;0.19;;0.12;;0.18;;-0.08;;0.16;;0.26;;0.36;;-0.01;;0.31;;0.05;;0.18;;0.32;;0.14;;0.33;;-0.16;;0.19;;0.09;;0.29;;0.17;;0.21;;0.14;;0.11;;-0.05;;0.11;;0.22;;0.33;;0.04;;0.43;;0.20;;0.20;;0.35;;0.18;;0.25;
total;;;34;12;103;8;27;14;54;19;59;13;33;12;37;10;36;9;35;10;41;5;45;19;20;24;60;20;42;6;34;14;30;23;33;9;39;9;91;10;37;7;62;11;37;10;47;15;64;9;44;16;74;15;66;14;36;8;27;16;10;17;13;19;2;3;4;4;20;9;28;13;14;19;15;14;19;13;22;10;51;12;44;23;84;15
indice doublons;;;2.83;;12.88;;1.93;;2.84;;4.54;;2.75;;3.70;;4.00;;3.50;;8.20;;2.37;;0.83;;3.00;;7.00;;2.43;;1.30;;3.67;;4.33;;9.10;;5.29;;5.64;;3.70;;3.13;;7.11;;2.75;;4.93;;4.71;;4.50;;1.69;;0.59;;0.68;;0.67;;1.00;;2.22;;2.15;;0.74;;1.07;;1.46;;2.20;;4.25;;1.91;;5.60;

Total des codons par génome, corrélations et indices des doublons[modifier | modifier le wikicode]

A10-tc;;néant;;B42-tc;;1 diag;;C42-tc;;1 diag;;E79e-tc;;1 diag;;E79o-tc;;néant;;E79-tc;;néant
A10-tc;Ab-tc;Af-tc;;B42-tc;Bb-tc;Bf-tc;;C42-tc;Cb-tc;Cf-tc;;Ee-tc;Ebe-tc;Efe-tc;;Eo-tc;Ebo-tc;Efo-tc;;E-tc;Eb-tc;Ef-tc
fpl;0;5;;hmr;2;3;;ecu;0;2;;acs;91;77;;acs;91;124;;acs;92;72
hbo;5;3;;bbd;4;4;;ede;0;12;;aga;288;101;;aga;288;145;;aga;284;94
mac;8;6;;saci;10;17;;sre;1;53;;aml;171;383;;aml;171;435;;aml;172;1250
mbw;10;8;;sep;13;19;;uma;15;51;;ath;404;217;;ath;404;268;;ath;431;217
mhor;5;11;;sma;14;19;;ttt;17;94;;bacu;211;471;;bacu;211;525;;bacu;342;6717
mls;6;7;;sho;15;14;;vma;18;103;;bdi;377;219;;bdi;377;271;;bdi;381;215
mmet;7;5;;ksk;19;13;;cneg;22;83;;bta;306;555;;bta;306;614;;bta;320;3678
mpl;4;8;;lpl;20;9;;mgr;22;123;;cbr;527;204;;cbr;527;248;;cbr;530;169
mru;2;22;;bcoh;20;24;;cot;26;16;;cbre;763;228;;cbre;763;280;;cbre;817;226
nou;4;5;;ype;22;10;;mth;28;118;;cel;411;154;;cel;411;201;;cel;416;133
;;;;pdi;27;14;;opa;33;8;;cfa;142;332;;cfa;142;382;;cfa;139;723
;;;;bae;27;16;;bfu;39;130;;cge;172;209;;cge;172;258;;cge;173;276
;;;;sty;28;13;;cal;40;44;;cjap;598;176;;cjap;598;223;;cjap;607;173
;;;;gmc;30;23;;kpa;56;23;;cjc;153;277;;cjc;153;333;;cjc;146;290
;;;;ksa;33;9;;ani;69;67;;cmk;413;769;;cmk;413;830;;cmk;3402;10269
;;;;eal;33;12;;fve;72;166;;cpic;79;411;;cpic;79;468;;cpic;74;426
;;;;cbl;34;12;;kna;85;32;;cpo;152;193;;cpo;152;243;;cpo;140;194
;;;;eclx;34;14;;vda;92;90;;csi;162;241;;csi;162;291;;csi;161;308
;;;;eno;35;10;;kla;100;21;;dme;192;60;;dme;192;104;;dme;195;54
;;;;yrb;36;8;;spo;100;23;;dno;187;413;;dno;187;464;;dno;190;878
;;;;sbz;36;9;;pch;100;55;;dsi;164;55;;dsi;164;97;;dsi;161;55
;;;;pge;37;7;;aor;103;98;;dya;227;63;;dya;227;109;;dya;228;58
;;;;eco;37;10;;fgr5;103;124;;ecb;207;252;;ecb;207;302;;ecb;194;250
;;;;pse;37;10;;pic;104;25;;eeu;175;165;;eeu;175;211;;eeu;163;276
;;;;mme;39;9;;fvr;104;136;;fca;164;535;;fca;164;594;;fca;158;3561
;;;;kpn;41;5;;sas;116;51;;gac;632;694;;gac;632;742;;gac;1694;747
;;;;dzc;42;6;;cjd;122;29;;gfr;63;92;;gfr;63;138;;gfr;63;94
;;;;vau;44;16;;fgr;126;136;;gga;113;119;;gga;113;166;;gga;114;122
;;;;hmo;44;23;;tdl;127;25;;ggo;129;316;;ggo;129;371;;ggo;129;324
;;;;bcef;45;19;;dha;130;44;;gmo;435;883;;gmo;435;938;;gmo;452;990
;;;;sfr;47;15;;lth;132;55;;gmx;498;200;;gmx;498;248;;gmx;501;189
;;;;pdix;51;12;;tpf;135;30;;hgl;83;230;;hgl;83;282;;hgl;85;230
;;;;ppoy;54;19;;cgr;150;16;;hsa-18;177;220;;hsa-18;177;268;;hsa-18;164;221
;;;;sbn;59;13;;lkl;171;45;;lav;248;760;;lav;248;816;;lav;253;1695
;;;;blr;60;20;;ncs;175;54;;lcm;59;261;;lcm;59;313;;lcm;59;266
;;;;pha;62;11;;kaf;181;45;;lma;34;4;;lma;34;49;;lma;34;4
;;;;vag;64;9;;zro;185;45;;mcc;132;335;;mcc;132;392;;mcc;132;341
;;;;vvm;66;14;;ncr;194;160;;mdo;252;184;;mdo;252;231;;mdo;259;175
;;;;vha;74;15;;sce;205;29;;meu;141;163;;meu;141;212;;meu;144;160
;;;;vpf;84;15;;mfa;208;38;;mgp;54;58;;mgp;54;103;;mgp;50;60
;;;;mvs;91;10;;tbl;210;78;;mlu;114;94;;mlu;114;140;;mlu;110;96
;;;;spl;103;8;;yli;263;204;;mmr;104;106;;mmr;104;152;;mmr;105;107
;;;;;;;;;;;;mmu;188;234;;mmu;188;289;;mmu;185;230
;;;;;;;;;;;;mpu;125;324;;mpu;125;374;;mpu;124;582
;;;;;;;;;;;;mtr;328;259;;mtr;328;316;;mtr;319;308
;;;;;;;;;;;;mun;65;100;;mun;65;147;;mun;52;102
;;;;;;;;;;;;nle;126;319;;nle;126;375;;nle;125;327
;;;;;;;;;;;;oaa;278;492;;oaa;278;546;;oaa;276;529
;;;;;;;;;;;;oas;77;359;;oas;77;414;;oas;79;1045
;;;;;;;;;;;;ocu;218;234;;ocu;218;284;;ocu;225;231
;;;;;;;;;;;;oga;123;149;;oga;123;199;;oga;124;153
;;;;;;;;;;;;oni;274;352;;oni;274;402;;oni;273;351
;;;;;;;;;;;;opr;159;142;;opr;159;188;;opr;150;142
;;;;;;;;;;;;osa;420;267;;osa;420;319;;osa;438;260
;;;;;;;;;;;;pan;180;304;;pan;180;360;;pan;174;301
;;;;;;;;;;;;pfa;0;1;;pfa;0;35;;pfa;0;1
;;;;;;;;;;;;pha;154;205;;pha;154;258;;pha;156;203
;;;;;;;;;;;;pma;742;765;;pma;742;820;;pma;1401;1032
;;;;;;;;;;;;pop;377;225;;pop;377;277;;pop;387;208
;;;;;;;;;;;;ppp;250;133;;ppp;250;186;;ppp;249;128
;;;;;;;;;;;;ppy;172;378;;ppy;172;435;;ppy;175;381
;;;;;;;;;;;;ptr;164;389;;ptr;164;449;;ptr;161;392
;;;;;;;;;;;;rno;161;201;;rno;161;250;;rno;160;198
;;;;;;;;;;;;san;147;175;;san;147;223;;san;146;181
;;;;;;;;;;;;sbi;330;243;;sbi;330;300;;sbi;334;237
;;;;;;;;;;;;sbq;115;216;;sbq;115;269;;sbq;117;226
;;;;;;;;;;;;shr;223;179;;shr;223;226;;shr;230;171
;;;;;;;;;;;;spu;523;381;;spu;523;427;;spu;639;381
;;;;;;;;;;;;ssc;253;258;;ssc;253;308;;ssc;236;522
;;;;;;;;;;;;str;152;342;;str;152;398;;str;146;602
;;;;;;;;;;;;tgu;83;147;;tgu;83;200;;tgu;78;148
;;;;;;;;;;;;tma;119;473;;tma;119;530;;tma;111;1851
;;;;;;;;;;;;tng;210;335;;tng;210;387;;tng;205;357
;;;;;;;;;;;;tru;273;291;;tru;273;342;;tru;271;294
;;;;;;;;;;;;tsy;134;227;;tsy;134;279;;tsy;135;271
;;;;;;;;;;;;ttr;170;466;;ttr;170;522;;ttr;231;5586
;;;;;;;;;;;;vvi;232;289;;vvi;232;346;;vvi;236;290
;;;;;;;;;;;;xtr;848;763;;xtr;848;820;;xtr;1588;997
;;;;;;;;;;;;zma;572;412;;zma;572;465;;zma;601;548
;;;;;;;;;;;;;;;;;;;;;;
;-0.26;−;;;0.00;−;;;0.14;−;;;0.46;−;;;0.46;−;;;0.58;−
;51;80;;;1673;538;;;4179;2781;;;18969;22508;;;18969;26546;;;24801;56149
;0.6375;;;;3.11;;;;1.50;;;;0.84;;;;0.71;;;;0.44;

Distribution des fréquences des champignons C42 et des 79 eucaryotes E79[modifier | modifier le wikicode]

Distribution des simples des eucaryotes E79[modifier | modifier le wikicode]

Simples 79;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;Lys;Asn;Lys;Asn;Thr;Thr;Thr;Thr;Arg;Ser;Arg;Ser;Ile;Ile;Met;Ile;Gln;His;Gln;His;Pro;Pro;Pro;Pro;Arg;Arg;Arg;Arg;Leu;Leu;Leu;Leu;Glu;Asp;Glu;Asp;Ala;Ala;Ala;Ala;Gly;Gly;Gly;Gly;Val;Val;Val;Val;Stp;Tyr;Stp;Tyr;Ser;Ser;Ser;Ser;SeC;Cys;Trp;Cys;Leu;Phe;Leu;Phe
;aaa;aac;aag;aat;aca;acc;acg;act;aga;agc;agg;agt;ata;atc;atg;att;caa;cac;cag;cat;cca;ccc;ccg;cct;cga;cgc;cgg;cgt;cta;ctc;ctg;ctt;gaa;gac;gag;gat;gca;gcc;gcg;gct;gga;ggc;ggg;ggt;gta;gtc;gtg;gtt;taa;tac;tag;tat;tca;tcc;tcg;tct;tga;tgc;tgg;tgt;tta;ttc;ttg;ttt
acs;3;4;3;0;2;0;1;3;3;3;3;0;1;0;8;2;3;2;3;0;1;1;1;1;3;0;1;2;3;0;2;2;2;2;4;0;6;0;3;6;3;2;1;0;2;0;1;3;0;6;0;0;1;0;2;1;1;4;4;0;2;1;1;0
aga;5;2;2;0;1;0;3;1;2;2;2;0;2;0;5;2;2;5;6;0;2;0;6;5;4;0;0;1;2;0;2;2;3;2;3;0;2;0;2;4;1;1;0;0;1;0;8;7;1;21;0;0;1;0;1;2;0;1;1;0;5;1;4;0
aml;50;18;760;6;8;0;10;6;17;10;44;2;6;0;13;5;42;1;21;0;8;0;2;2;82;1;5;3;5;0;5;5;7;6;34;1;7;0;4;14;4;2;5;0;7;0;2;2;1;10;10;0;6;0;4;4;2;12;7;0;4;3;7;0
ath;6;9;5;0;5;1;4;3;9;9;4;0;2;1;16;2;4;6;5;0;6;0;3;5;2;0;3;7;5;1;1;3;9;8;4;0;3;0;3;3;2;9;1;0;3;1;2;3;1;33;0;0;6;2;4;11;0;14;5;0;3;5;6;0
bacu;82;7;24;0;7;0;4;9;55;10;67;0;8;1;13;6;8;4;16;0;3;0;2;2;8;0;20;6;4;0;4;2;2321;38;447;19;42;0;19;18;962;51;2045;11;18;1;24;9;24;14;9;0;5;1;4;7;17;19;243;2;12;9;8;0
bdi;9;6;2;0;8;1;4;7;7;6;6;0;3;2;31;7;8;7;3;3;10;0;3;4;1;1;4;4;4;0;1;7;7;5;3;0;6;0;2;3;3;9;1;0;3;2;3;5;0;14;0;1;5;3;1;3;0;9;6;0;2;5;7;0
bta;68;14;25;0;8;1;7;10;44;11;114;4;8;0;19;4;18;5;32;4;3;0;1;2;11;7;13;6;5;0;3;5;424;33;161;6;31;2;14;19;385;55;1266;20;19;0;27;13;4;38;13;11;7;28;7;5;29;313;173;134;10;18;14;6
cbr;5;3;4;0;4;0;4;2;3;3;1;0;16;0;5;4;5;3;4;0;11;0;2;4;6;0;0;5;2;0;5;5;4;7;9;0;1;0;5;7;9;5;5;0;4;0;3;7;0;6;0;0;5;0;4;3;0;2;1;0;4;6;10;0
cbre;9;5;4;0;3;1;4;5;3;5;7;0;13;1;5;2;11;5;5;1;6;1;5;12;6;0;11;4;2;0;5;3;9;3;3;0;4;0;4;2;5;14;14;0;5;0;8;3;0;8;0;2;7;0;6;4;2;5;3;2;3;6;12;0
cel;1;3;6;0;2;0;5;3;3;3;3;1;4;0;3;2;5;6;3;0;8;0;1;4;4;0;1;4;1;0;2;6;3;7;5;0;2;0;4;6;6;4;1;0;4;0;2;4;0;12;0;0;7;0;3;4;2;2;3;0;3;5;7;0
cfa;28;13;398;1;3;0;5;6;9;6;28;0;5;0;17;5;42;2;16;0;7;0;2;1;15;0;3;5;4;0;3;1;11;4;16;2;8;0;4;11;4;3;7;0;5;0;3;4;3;9;3;0;5;0;7;5;1;12;6;0;4;6;5;0
cge;10;9;75;0;3;1;4;7;5;6;5;0;5;0;9;3;4;3;6;0;2;0;1;1;4;0;3;3;4;0;5;2;5;5;14;0;14;1;5;17;1;5;5;1;4;0;6;9;0;11;0;0;3;0;3;1;2;17;4;0;4;4;4;0
cjap;7;3;7;0;5;0;3;7;3;3;1;0;5;0;5;6;3;5;5;0;10;0;1;2;5;0;1;4;4;0;7;4;4;9;9;0;5;0;1;8;11;10;2;0;5;0;5;4;0;2;0;0;3;0;5;5;1;3;4;0;5;5;7;1
cjc;11;18;12;0;7;1;4;9;6;5;4;0;5;3;13;8;7;4;8;1;3;0;1;1;4;1;3;2;4;0;9;4;18;6;9;1;5;2;3;13;3;6;4;0;5;3;7;4;1;25;3;1;4;0;4;4;2;23;10;0;11;4;7;0
cmk;38;32;25;2;157;12;133;17;14;23;7;0;19;0;74;23;6;27;10;1;44;6;41;11;22;0;2;5;18;2;20;14;59;35;406;6;3009;165;3758;56;44;7;74;2;116;16;1503;16;1;29;4;1;51;1;48;14;3;10;20;1;12;25;30;3
cpic;32;12;7;1;17;0;5;16;25;19;10;3;13;1;11;9;15;8;10;0;3;1;2;8;4;0;3;5;4;1;4;2;17;10;3;0;12;1;4;10;14;6;1;0;5;0;6;15;1;5;2;1;15;0;9;22;4;14;9;5;13;20;6;2
cpo;7;9;19;0;3;0;3;10;5;7;4;0;5;0;10;3;2;2;5;0;2;0;1;2;4;0;3;3;3;0;2;2;4;4;1;1;7;4;5;24;4;5;5;0;2;1;3;2;0;11;1;0;2;0;3;2;1;16;7;0;4;3;6;0
csi;11;4;16;2;6;0;5;7;6;6;7;0;5;0;15;6;3;2;8;0;3;0;2;2;4;0;2;6;3;0;2;3;7;7;73;1;12;0;5;16;2;2;6;0;7;1;11;6;0;11;1;0;3;0;4;5;1;20;4;0;5;6;6;0
dme;2;1;1;0;2;0;1;3;3;2;1;0;2;0;4;2;2;1;4;0;1;0;3;1;4;0;0;1;1;0;1;1;1;3;5;0;2;0;1;2;2;2;0;0;1;0;2;2;0;9;0;0;2;0;1;3;1;4;2;0;4;1;4;0
dno;14;6;30;0;7;0;7;10;9;7;46;0;6;1;20;6;3;4;7;1;2;0;3;1;7;0;5;5;3;0;4;2;15;9;38;0;64;2;16;16;24;9;322;24;16;1;76;8;0;11;0;0;5;0;6;3;1;13;12;0;8;7;7;0
dsi;2;1;1;0;2;0;2;1;4;2;2;0;0;0;4;3;2;2;4;0;2;0;3;1;3;0;0;1;1;0;1;1;3;1;4;0;0;0;2;1;2;2;0;0;1;0;2;2;0;10;0;0;2;0;1;3;1;3;2;0;3;3;4;0
dya;3;1;4;1;2;0;1;1;3;4;2;0;2;0;4;2;1;1;5;0;1;0;2;1;2;0;0;1;1;0;1;1;2;3;3;0;1;0;3;4;2;2;1;0;1;0;3;2;0;9;0;0;2;0;1;3;1;3;2;0;4;1;4;0
ecb;8;8;8;1;5;0;3;7;5;7;6;0;5;0;13;7;4;3;6;1;3;0;2;1;3;0;2;4;5;0;2;2;6;5;48;0;9;0;7;16;2;1;5;0;6;3;6;5;0;10;0;1;4;0;4;4;4;15;4;0;4;4;6;0
eeu;5;2;121;0;6;0;4;7;5;3;6;0;4;0;6;2;3;1;6;0;2;0;1;2;4;0;2;3;3;0;4;2;5;4;4;0;10;0;4;10;2;4;3;0;6;0;2;4;0;13;0;0;3;0;3;2;2;20;5;0;3;3;6;0
fca;45;21;879;5;12;0;9;6;54;8;52;2;9;0;15;2;777;8;45;2;64;1;5;2;1194;9;24;4;33;0;3;1;11;2;41;1;9;1;6;14;46;3;5;2;6;0;3;4;36;9;12;0;13;1;5;3;18;19;22;1;19;8;8;1
gac;31;41;23;1;16;0;9;50;25;16;5;0;15;0;65;17;13;19;20;0;7;0;5;5;14;0;2;12;12;0;3;18;24;49;25;0;17;0;15;22;21;2;3;0;8;1;11;12;0;13;0;0;19;0;6;14;1;35;27;0;8;12;6;0
gfr;2;5;6;1;4;0;1;3;3;3;2;0;2;1;4;2;2;4;2;0;4;0;1;1;2;0;0;5;0;0;5;3;4;4;2;0;5;0;2;7;2;1;3;0;1;1;2;2;0;8;0;0;3;0;1;1;0;5;3;0;11;2;2;0
gga;4;6;2;0;3;0;2;4;4;4;3;0;2;0;6;1;2;4;3;0;3;0;2;1;2;0;2;4;2;0;5;3;7;3;2;0;4;0;4;11;4;2;2;0;3;1;5;5;0;13;0;0;3;0;1;5;1;5;3;0;3;5;3;0
ggo;11;20;14;2;5;0;5;7;5;4;5;0;6;3;7;9;10;1;16;0;4;0;1;5;5;0;3;4;5;0;4;5;13;8;7;0;6;2;5;20;4;8;5;0;8;1;6;7;1;22;3;4;5;2;5;5;3;30;7;1;8;8;9;0
gmo;46;18;23;2;24;0;23;20;19;0;21;1;16;0;112;21;8;16;23;1;15;1;12;30;15;2;7;23;20;0;34;22;39;15;30;1;20;0;20;31;21;13;14;0;9;0;19;13;1;47;4;0;15;27;13;18;2;19;19;0;15;24;15;6
gmx;5;10;2;2;5;1;2;6;8;12;3;0;3;0;14;19;3;3;5;0;7;0;2;5;3;0;4;2;3;0;1;1;4;8;7;0;5;0;3;3;2;3;3;0;4;1;2;7;0;20;0;0;5;0;2;5;0;1;3;0;5;5;8;0
hgl;5;4;11;0;4;2;4;15;6;5;4;2;3;0;8;3;3;2;3;0;4;0;2;9;4;0;4;3;5;0;4;3;4;6;1;2;4;6;5;45;3;4;2;4;3;1;3;11;0;7;0;0;3;0;3;5;4;18;5;0;4;2;5;0
hsa-18;8;17;10;0;6;0;5;6;6;6;5;0;5;1;9;10;4;1;7;0;3;0;2;2;6;0;2;2;3;0;2;4;5;3;2;0;7;0;4;16;4;5;3;0;4;0;6;6;0;13;0;1;4;0;4;4;2;23;5;0;4;5;7;0
lav;46;37;22;4;17;1;10;13;90;69;14;3;7;0;34;30;11;13;23;3;12;0;1;7;14;0;3;10;11;0;6;18;107;14;18;0;47;0;15;40;616;26;70;4;39;1;26;34;2;19;0;1;7;0;3;20;24;23;17;1;14;19;14;1
lcm;13;7;9;3;8;0;2;8;9;7;8;0;7;0;8;6;9;3;7;0;7;0;4;10;4;0;1;2;4;0;8;3;9;16;6;1;19;0;2;2;5;5;1;0;7;0;3;3;1;8;2;2;6;0;3;3;4;14;13;5;11;6;4;0
lma;1;1;2;0;1;0;1;1;1;2;1;0;1;0;2;1;1;1;1;0;1;0;1;1;1;0;1;1;1;0;1;1;1;1;1;0;1;0;1;1;1;1;1;0;1;0;1;1;0;2;0;0;1;0;1;1;0;1;1;0;1;1;1;0
mcc;13;21;9;2;6;0;4;7;6;4;6;0;7;6;14;8;15;4;10;0;7;1;1;2;5;0;2;3;5;0;4;7;10;9;4;1;11;1;4;18;3;9;5;0;6;3;8;7;2;31;2;1;16;2;4;4;2;20;6;2;15;5;8;0
mdo;4;4;9;0;2;0;3;6;6;2;4;0;7;0;11;1;7;1;3;0;3;0;1;1;3;0;3;5;6;0;6;3;4;12;3;1;6;0;4;6;7;5;2;0;4;0;3;3;0;13;0;0;5;0;3;6;0;15;6;4;2;4;3;0
meu;7;4;3;0;3;0;3;5;6;4;4;0;6;0;7;2;3;1;6;1;1;0;1;3;3;0;3;5;3;0;5;3;6;12;2;0;6;0;3;9;4;9;3;0;1;0;4;3;0;8;0;1;2;0;2;2;4;10;7;0;3;7;8;1
mgp;2;2;2;0;2;0;0;4;3;5;2;0;1;0;4;2;1;3;1;0;2;0;1;2;1;0;2;2;1;0;3;1;4;1;3;0;4;0;3;3;2;1;2;0;2;1;3;3;0;4;0;0;3;0;1;3;0;3;3;0;1;4;2;0
mlu;2;2;7;0;3;0;3;3;4;3;5;0;3;0;6;4;3;3;5;5;3;0;1;1;4;0;2;5;2;0;2;2;4;3;1;0;1;0;3;5;2;2;2;0;3;0;1;2;0;5;0;0;2;0;2;2;0;10;2;0;2;2;3;0
mmr;2;5;2;0;3;0;2;3;5;5;3;0;2;0;6;2;3;3;5;0;3;0;1;1;2;0;2;4;2;0;3;2;6;2;4;0;5;0;3;8;2;3;2;0;2;0;2;2;0;8;0;0;2;0;3;6;0;9;4;1;3;2;3;0
mmu;6;5;19;0;3;0;4;9;6;6;4;0;5;1;11;5;6;3;7;1;5;1;1;3;4;0;3;3;4;0;4;3;3;4;6;0;8;4;7;19;2;6;5;2;1;1;8;6;1;11;0;0;2;1;3;5;1;28;6;1;5;3;4;0
mpu;25;8;266;6;6;0;5;8;15;8;21;0;5;0;14;4;35;2;14;1;6;0;1;1;28;0;3;3;4;0;3;2;6;4;15;0;7;0;4;13;7;2;3;0;6;0;4;5;2;9;5;0;4;0;4;3;1;10;9;0;4;5;6;0
mtr;13;16;3;44;7;2;1;2;6;9;4;0;7;0;23;9;10;8;3;0;3;1;1;1;2;0;2;7;4;0;2;6;9;14;3;1;8;0;3;10;6;4;2;1;5;3;5;6;30;11;0;3;4;2;1;5;1;3;7;1;5;6;9;1
mun;2;5;10;0;2;0;0;4;4;8;3;0;1;0;3;2;1;4;5;0;3;0;2;3;1;0;1;2;0;0;6;3;3;5;1;0;5;0;2;2;6;6;1;0;1;1;2;3;1;5;0;0;4;1;2;4;1;5;3;0;3;4;3;0
nle;15;14;14;3;6;0;5;9;7;6;4;0;5;3;10;9;8;4;14;0;3;2;1;4;7;0;2;3;4;0;6;6;12;8;10;0;11;1;4;17;2;8;9;0;6;1;9;7;3;19;5;0;6;3;5;7;3;14;10;1;8;13;6;1
oaa;25;11;15;0;16;1;8;16;6;12;7;11;8;0;18;17;8;20;14;1;9;4;3;6;5;0;11;8;5;0;13;5;13;14;14;0;11;0;8;51;9;23;5;2;13;1;5;16;3;26;0;0;6;4;7;0;5;19;9;0;7;18;10;1
oas;17;5;11;0;4;0;3;5;22;6;32;0;5;0;14;3;7;5;6;0;4;0;1;1;6;2;6;2;3;0;2;3;136;6;57;2;12;3;6;11;132;27;339;5;8;0;7;4;0;16;3;2;4;3;3;1;4;56;45;16;5;4;7;1
ocu;8;15;20;1;6;1;5;6;6;3;5;0;7;1;10;5;3;1;7;0;3;0;1;1;3;0;3;3;4;0;6;3;9;6;5;1;9;0;4;14;2;3;11;0;5;0;4;8;0;12;0;0;4;0;4;3;1;16;7;0;5;8;3;0
oga;7;4;5;0;5;0;3;8;4;5;5;2;11;9;8;4;4;1;4;0;3;0;1;1;4;0;3;4;3;0;4;1;4;4;2;0;5;0;2;8;6;5;1;0;2;0;2;3;1;7;0;0;2;0;3;4;1;11;6;0;3;2;5;1
oni;7;1;21;0;22;1;7;12;26;5;6;2;20;0;7;13;5;14;4;0;5;0;2;4;7;0;6;4;6;0;8;9;8;4;2;0;6;0;8;7;6;5;7;0;7;0;2;2;0;18;0;3;9;0;5;4;1;34;5;1;12;14;7;0
opr;6;5;7;0;5;0;7;6;5;3;5;0;4;0;4;2;3;1;6;0;3;0;1;1;5;0;3;3;5;0;3;3;4;3;4;0;6;0;3;11;2;6;2;0;4;0;2;5;0;10;0;0;3;0;3;2;1;4;4;0;3;6;4;0
osa;8;13;5;0;7;3;2;3;6;6;5;0;3;0;29;4;12;10;7;0;9;0;6;4;2;0;5;7;5;0;2;4;6;11;11;1;1;1;5;4;5;9;5;0;1;4;4;7;0;17;0;2;7;1;6;5;0;9;7;1;3;7;5;0
pan;13;20;11;2;8;0;7;7;6;7;4;0;7;2;11;9;12;1;10;0;4;0;1;4;5;0;2;3;3;0;6;4;6;7;3;2;10;1;4;16;2;10;6;0;5;2;6;5;3;23;0;4;9;1;3;4;3;18;6;4;10;5;9;1
pfa;0;1;0;0;1;0;1;0;1;1;0;0;1;0;2;1;1;0;1;0;1;0;1;1;1;0;0;0;1;0;1;1;1;1;1;0;1;0;1;1;1;0;0;0;1;0;1;1;0;1;0;0;1;0;1;1;0;0;0;0;1;1;1;0
pha;6;10;6;1;7;0;6;6;6;5;4;0;4;2;6;7;4;1;7;0;4;0;1;2;5;0;2;4;3;0;5;5;7;4;1;1;9;1;4;16;2;7;5;0;5;1;6;4;1;13;0;0;5;0;3;3;1;15;5;2;7;3;6;0
pma;7;68;10;0;9;11;12;33;10;31;25;0;7;0;91;63;21;12;48;1;14;0;9;18;9;1;6;30;14;0;38;56;9;34;3;2;10;0;6;44;4;25;2;1;19;1;25;70;1;50;1;0;10;0;17;8;1;30;8;0;3;23;24;2
pop;5;13;2;0;6;0;2;5;6;6;4;1;3;1;8;6;1;4;7;0;10;0;2;2;2;0;5;8;0;1;2;36;1;5;8;0;8;0;3;2;7;5;1;0;3;0;5;4;1;16;0;0;5;1;4;6;1;6;2;1;6;3;3;5
ppp;4;5;5;1;4;0;3;2;3;3;5;0;3;0;9;3;7;3;2;0;2;0;5;2;5;1;3;3;5;1;2;1;2;3;8;1;2;0;2;9;4;3;8;1;1;0;9;3;0;7;2;0;3;0;2;3;1;5;1;0;1;3;3;2
ppy;15;30;19;1;4;0;7;8;6;4;7;0;6;3;13;9;13;4;20;0;6;1;2;3;5;0;3;3;3;1;8;10;15;6;6;1;7;1;3;19;5;6;11;0;5;1;11;6;1;28;2;2;8;2;5;8;3;25;9;0;8;13;7;0
ptr;14;24;18;2;5;0;6;8;6;6;4;3;5;3;14;11;17;2;14;0;6;1;2;7;6;1;3;2;4;1;7;6;12;10;7;1;9;1;5;26;5;7;14;0;10;1;10;5;2;29;4;5;9;3;4;6;2;24;5;1;9;11;7;0
rno;1;7;9;0;4;0;4;7;6;7;6;1;3;0;6;7;5;1;6;0;2;0;1;23;4;0;3;3;1;0;3;1;5;3;3;1;6;2;4;31;3;4;4;0;2;0;5;5;0;2;0;0;4;0;3;9;1;14;7;0;3;4;0;1
san;3;4;7;0;5;0;5;6;6;4;4;0;5;0;8;8;3;1;3;0;4;0;1;1;5;0;2;5;2;1;10;2;9;10;5;0;7;0;2;8;7;11;1;0;5;0;4;2;0;9;1;0;3;0;4;4;2;12;5;0;4;5;4;0
sbi;8;7;7;1;8;2;3;9;6;6;3;0;4;0;30;3;8;7;8;2;5;2;4;5;1;0;3;4;6;0;4;4;5;4;9;2;5;7;2;13;3;6;2;0;2;3;3;7;1;14;2;1;6;3;6;3;1;7;3;0;4;5;5;0
sbq;14;7;7;0;6;0;5;7;6;4;4;0;6;1;7;5;8;4;8;0;3;0;1;4;4;0;2;2;4;0;3;3;17;5;7;1;7;0;4;12;4;5;4;0;4;1;6;4;1;15;0;2;5;1;3;3;3;11;7;1;9;5;7;0
shr;6;1;23;0;3;0;2;5;5;2;3;0;4;0;8;1;29;1;3;0;1;0;1;2;3;0;3;4;4;0;4;3;5;7;2;0;4;0;2;8;3;3;3;0;3;0;4;1;2;10;0;0;5;0;3;3;2;6;5;0;6;7;3;0
spu;20;9;12;0;10;0;5;13;9;3;12;9;16;2;30;12;7;9;11;0;6;0;5;5;10;0;1;9;6;0;3;13;8;20;10;0;7;0;3;11;14;16;3;0;6;0;0;3;1;17;0;0;9;0;5;0;0;11;13;0;9;0;12;2
ssc;23;8;9;2;5;0;4;7;6;4;4;0;4;0;11;1;6;3;8;0;2;0;1;1;3;0;1;2;3;0;2;3;205;83;8;9;12;0;6;18;8;10;4;0;9;1;5;6;1;14;0;0;5;0;4;4;0;13;4;1;4;10;5;0
str;5;2;5;1;4;5;7;32;5;5;5;0;4;6;7;8;2;2;2;0;5;1;1;5;5;0;3;3;3;0;2;3;3;3;4;6;39;30;17;252;3;6;19;7;4;3;36;14;0;9;0;0;7;1;6;9;1;19;4;0;3;4;10;1
tgu;1;5;5;3;3;5;2;6;4;3;2;2;1;5;3;35;2;3;2;0;1;0;1;3;3;0;0;4;1;0;4;2;2;4;2;0;5;0;3;10;3;5;4;1;2;2;1;8;0;10;0;0;4;0;1;1;1;4;3;1;3;4;4;2
tma;26;18;9;1;17;1;4;15;122;34;13;5;8;1;14;8;6;5;6;0;5;0;1;4;12;0;6;5;5;0;4;5;112;11;19;1;37;1;5;16;1068;18;88;9;26;0;13;8;2;15;0;1;6;0;3;10;18;20;11;5;6;8;10;1
tng;11;11;11;0;9;0;10;17;10;6;5;1;5;0;12;10;5;8;5;0;10;1;4;9;7;1;2;4;6;0;19;13;13;13;5;0;9;0;4;13;11;9;5;0;3;0;9;7;0;11;0;4;9;18;2;9;1;8;7;0;4;10;12;1
tru;13;13;7;0;6;0;7;11;12;13;5;0;6;0;12;3;7;9;6;2;5;0;4;3;7;1;4;3;4;0;7;8;9;6;7;1;5;0;6;5;5;3;3;0;7;0;13;11;0;14;0;1;8;0;5;6;1;10;10;0;7;13;10;1
tsy;6;9;7;1;4;0;4;7;6;7;4;0;4;0;5;3;51;5;3;1;32;1;3;2;5;0;2;3;4;0;4;3;7;7;7;1;4;0;2;10;4;5;6;0;3;0;4;5;3;10;0;0;5;0;3;4;1;19;4;1;13;5;4;0
ttr;70;6;16;0;5;1;3;7;48;8;53;0;5;0;11;6;12;5;8;0;3;0;2;3;7;1;12;5;4;0;5;1;1872;44;387;10;36;2;20;14;814;37;1696;18;16;3;19;7;20;17;8;1;6;0;4;9;21;20;208;5;6;8;7;0
vvi;6;14;11;1;6;2;2;6;3;2;4;0;6;2;20;6;7;9;8;1;8;0;3;6;3;0;6;10;7;0;3;5;10;12;14;3;21;0;2;2;12;6;3;0;4;1;5;7;1;19;0;4;3;1;1;9;1;6;1;1;7;12;10;2
xtr;21;19;23;1;43;0;14;75;53;59;9;0;25;5;39;18;8;18;10;1;17;1;17;18;8;3;6;13;10;1;15;18;24;13;19;0;18;0;21;17;27;15;35;0;19;0;28;19;2;48;1;0;19;2;10;17;1;46;12;2;35;18;16;2
zma;68;18;91;0;6;5;2;13;6;4;6;0;4;0;48;37;14;8;7;1;18;0;4;4;4;0;3;10;5;0;3;10;10;12;14;1;7;0;11;32;3;3;2;0;2;1;3;11;0;18;4;0;5;12;3;5;0;15;7;1;3;8;8;1
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
Simples 79;;fréquences;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;Lys;Asn;Lys;Asn;Thr;Thr;Thr;Thr;Arg;Ser;Arg;Ser;Ile;Ile;Met;Ile;Gln;His;Gln;His;Pro;Pro;Pro;Pro;Arg;Arg;Arg;Arg;Leu;Leu;Leu;Leu;Glu;Asp;Glu;Asp;Ala;Ala;Ala;Ala;Gly;Gly;Gly;Gly;Val;Val;Val;Val;Stp;Tyr;Stp;Tyr;Ser;Ser;Ser;Ser;SeC;Cys;Trp;Cys;Leu;Phe;Leu;Phe
critère;aaa;aac;aag;aat;aca;acc;acg;act;aga;agc;agg;agt;ata;atc;atg;att;caa;cac;cag;cat;cca;ccc;ccg;cct;cga;cgc;cgg;cgt;cta;ctc;ctg;ctt;gaa;gac;gag;gat;gca;gcc;gcg;gct;gga;ggc;ggg;ggt;gta;gtc;gtg;gtt;taa;tac;tag;tat;tca;tcc;tcg;tct;tga;tgc;tgg;tgt;tta;ttc;ttg;ttt
0;1;0;1;46;0;56;2;1;0;1;1;61;1;52;0;0;0;1;0;57;0;61;0;0;0;65;8;1;3;70;0;0;0;0;0;44;1;55;0;0;0;1;4;61;0;42;1;0;41;0;53;52;0;52;0;2;16;1;1;48;0;1;1;52
1;4;7;2;16;3;13;7;4;2;1;4;5;6;12;0;6;6;17;3;15;8;14;37;24;6;9;8;5;9;8;8;13;4;4;7;22;6;11;4;3;4;5;12;5;12;25;5;3;21;1;5;13;4;11;13;7;32;3;5;18;4;6;3;16
2;7;5;8;9;8;4;11;3;1;7;6;6;7;5;2;15;8;9;4;3;10;2;18;16;8;2;19;11;7;1;15;14;4;4;8;6;4;6;13;6;18;10;12;4;9;3;13;10;7;3;6;6;9;6;7;6;12;2;5;5;4;5;2;7
3;3;3;3;3;11;1;12;8;11;12;8;3;8;5;3;9;13;12;10;2;19;0;8;7;11;1;23;18;15;0;13;19;6;10;11;1;1;1;15;4;11;9;11;0;9;7;12;11;5;0;4;2;12;5;21;16;6;5;9;0;17;8;9;1
4;3;7;3;1;9;0;15;3;6;10;18;1;10;0;6;6;6;11;5;1;7;1;5;10;17;0;4;16;19;0;14;6;11;11;8;0;6;2;18;3;11;5;5;2;10;1;7;10;1;1;4;4;10;1;16;14;6;4;10;2;15;10;11;0
5;7;9;6;1;11;3;12;5;9;9;13;1;16;2;5;5;5;8;10;1;6;0;5;8;12;0;4;12;13;0;9;8;6;6;5;0;10;0;9;2;6;12;13;1;11;0;8;9;0;3;2;1;15;0;8;12;1;5;9;4;8;14;6;1
6;7;4;3;2;12;0;2;12;24;13;7;0;8;2;6;8;4;2;10;0;6;1;2;2;5;0;6;3;5;0;6;4;6;7;3;3;8;1;5;3;5;9;3;0;7;0;8;6;0;2;0;0;8;0;6;5;0;3;7;0;4;7;10;2
7;6;5;9;0;6;0;8;14;2;7;5;0;8;0;5;4;7;2;9;0;5;0;0;2;6;1;1;3;1;0;3;2;6;6;6;0;9;1;2;3;4;3;2;1;5;0;2;11;0;3;0;0;6;0;3;2;0;1;11;0;4;4;13;0
8;5;3;1;0;6;0;1;5;1;4;1;0;4;0;7;5;8;5;7;0;3;0;0;1;2;0;0;2;0;0;3;1;2;4;3;0;4;0;2;5;1;2;1;0;3;0;4;4;0;5;1;0;2;0;0;2;0;1;1;0;5;6;6;0
9;2;5;6;0;2;0;2;5;5;2;1;1;1;1;3;6;1;3;0;0;2;0;1;2;1;1;0;1;0;0;1;1;8;3;4;1;6;0;0;2;2;7;1;1;2;0;3;2;0;7;1;0;5;0;1;5;0;3;4;0;3;1;3;0
10;1;2;3;0;1;0;3;3;2;2;1;0;0;0;3;2;2;1;5;0;4;0;0;1;1;0;0;3;1;0;1;2;3;3;2;1;3;0;0;5;0;3;0;0;1;0;1;0;0;7;1;0;1;0;1;1;0;5;3;0;2;2;6;0
11;4;2;5;0;0;1;0;1;0;1;0;1;1;0;6;1;2;0;1;0;1;0;0;1;1;0;2;0;1;0;0;0;2;2;1;0;3;0;1;5;2;1;2;1;0;0;3;3;0;7;0;1;0;0;0;1;0;3;1;0;3;1;0;0
12;0;1;2;0;1;1;1;1;1;2;1;0;0;0;2;1;3;1;0;0;1;0;1;1;1;0;1;1;1;0;0;0;2;4;0;0;4;0;0;1;1;0;0;0;0;0;0;1;0;2;1;0;0;1;0;0;0;3;2;0;3;2;3;0
13;5;4;0;0;0;0;0;3;0;1;1;0;2;0;5;1;2;1;0;0;0;0;0;0;0;0;1;1;0;0;1;2;3;2;0;0;0;0;0;4;0;1;0;0;1;0;2;2;0;6;1;0;1;0;1;0;0;2;2;0;2;3;0;0
14;3;3;2;0;0;0;1;0;1;0;1;0;0;0;6;0;1;1;4;0;1;0;0;0;2;0;0;0;1;0;0;1;0;3;4;0;1;0;1;4;2;1;3;0;0;0;0;1;0;5;0;0;0;0;0;2;0;5;0;0;1;1;2;0
15;2;1;1;0;0;0;0;2;1;0;0;0;1;0;2;0;2;0;0;0;1;0;0;0;2;0;0;0;0;0;1;0;2;1;1;0;0;0;2;0;0;1;0;0;0;0;0;1;0;2;0;0;2;0;0;0;0;4;0;0;2;0;1;0
16;0;1;2;0;2;0;0;2;0;1;0;0;3;0;1;0;0;1;3;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;1;7;0;1;0;0;2;1;0;2;0;2;0;0;1;0;0;0;0;2;0;1;0;0;1;0
17;1;1;0;0;3;0;0;2;1;0;0;0;0;0;1;2;1;0;0;0;1;0;1;0;0;0;0;0;0;0;0;0;2;0;0;0;1;0;1;3;0;0;0;0;0;0;0;0;0;3;0;0;0;0;1;1;1;1;1;0;0;0;0;0
18;0;5;1;0;0;0;0;0;0;0;0;0;0;0;1;1;1;1;0;0;1;0;0;2;0;0;0;0;1;0;0;3;1;0;1;0;1;0;0;3;0;1;0;1;1;0;0;0;0;2;0;0;0;1;0;1;2;2;0;0;0;3;0;0
19;0;1;3;0;0;0;0;0;1;1;0;0;1;0;1;1;0;1;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;2;1;1;0;1;3;0;0;1;0;3;0;2;1;0;3;0;0;2;0;0;0;0;6;1;0;1;1;0;0
20;1;2;1;0;0;0;0;1;0;0;0;0;1;0;2;0;0;1;2;0;0;0;0;0;0;0;1;0;1;0;1;0;0;1;0;0;1;0;2;1;0;0;0;1;0;0;0;0;1;1;0;0;0;0;0;1;0;5;1;0;0;1;0;0
21;1;2;1;0;0;0;0;0;0;0;2;0;0;0;0;1;1;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;0;2;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;1;0;0;0;0;0;0;0
22;0;0;1;0;1;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;1;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;1;0;0;1;0;0;0;0;0
23;1;0;4;0;0;0;1;0;0;1;0;0;0;0;1;1;0;0;2;0;0;0;0;1;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;3;0;0;0;1;0;0
24;0;1;1;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;2;0;0;0;0;0;0;1;1;0;0;1;0;0;1;0;1;0;0;0;0;0;0;0;1;1;0;0;0;1;1;0
25;2;0;2;0;0;0;0;0;2;0;1;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;1;0;0;0;0;1;0;0;1;0;0;0;0;0;0;0;1;0;0;0;1;0;0
26;1;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;0;0;1;0;1;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0
27;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;1;0;0;0;0;0;0;1;0;0;0;0;1;0;0;0;0;0
28;1;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;1;0;0;0;1;0;0;0;1;0;0;0;0;0;0
29;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;1;0;0;0;0;0;0;0
30;0;1;1;0;0;0;0;0;0;0;0;0;0;0;2;1;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;0;1;0;0;1;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;2;0;0;0;0;1;0
31;1;0;0;0;0;0;0;0;0;1;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;2;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0
32;1;1;0;0;0;0;0;1;0;0;1;0;0;0;0;0;0;0;1;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
33;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0
34;0;0;0;0;0;0;0;0;0;1;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0
35;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;1;0;0;0
36;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;1;0;0;0;0;0;0;0;0;0;1;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
37;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
38;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0
39;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
40;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
41;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
42;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
43;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
44;0;0;0;1;0;0;0;0;1;0;1;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
45;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0
46;2;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0
47;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0
48;0;0;0;0;0;0;0;0;1;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;1;0;0;0;0;0;0;0;0;0
49;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
50;1;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0
51;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0
52;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
53;0;0;0;0;0;0;0;0;1;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
54;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
55;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
56;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0
57;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
58;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
59;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
60;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0

Distribution des simples des champignons C42[modifier | modifier le wikicode]

Simples 42;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;Lys;Asn;Lys;Asn;Thr;Thr;Thr;Thr;Arg;Ser;Arg;Ser;Ile;Ile;Met;Ile;Gln;His;Gln;His;Pro;Pro;Pro;Pro;Arg;Arg;Arg;Arg;Leu;Leu;Leu;Leu;Glu;Asp;Glu;Asp;Ala;Ala;Ala;Ala;Gly;Gly;Gly;Gly;Val;Val;Val;Val;Stp;Tyr;Stp;Tyr;Ser;Ser;Ser;Ser;SeC;Cys;Trp;Cys;Leu;Phe;Leu;Phe
;aaa;aac;aag;aat;aca;acc;acg;act;aga;agc;agg;agt;ata;atc;atg;att;caa;cac;cag;cat;cca;ccc;ccg;cct;cga;cgc;cgg;cgt;cta;ctc;ctg;ctt;gaa;gac;gag;gat;gca;gcc;gcg;gct;gga;ggc;ggg;ggt;gta;gtc;gtg;gtt;taa;tac;tag;tat;tca;tcc;tcg;tct;tga;tgc;tgg;tgt;tta;ttc;ttg;ttt
ani;2;6;1;0;2;0;2;2;1;4;2;0;1;0;5;5;2;2;4;0;2;0;2;5;2;0;2;3;2;0;3;6;3;6;3;0;2;0;1;1;3;1;1;0;1;0;2;2;0;5;0;0;1;0;2;1;0;2;1;0;1;3;2;0
aor;3;4;3;0;2;0;2;2;2;5;2;0;2;0;8;5;3;7;4;0;3;0;0;6;1;0;3;2;1;0;4;0;5;8;3;0;2;0;3;2;2;1;1;0;2;1;3;2;0;11;0;1;1;0;3;3;0;4;1;1;3;6;0;0
bfu;3;5;9;0;3;0;0;4;5;5;1;0;1;0;5;8;4;4;2;0;8;0;1;4;3;0;2;5;1;0;1;5;6;6;9;0;5;0;2;1;4;8;2;1;2;0;2;8;0;5;0;0;3;0;2;1;0;5;2;0;2;5;5;0
cal;2;3;2;0;1;0;1;2;1;2;1;0;1;0;2;6;5;3;1;0;4;0;0;1;0;0;1;2;0;0;1;2;5;1;1;0;2;0;0;1;1;1;1;0;1;0;1;3;0;4;0;0;2;0;1;1;0;2;2;0;2;4;5;0
cgr;1;3;1;0;1;0;1;1;1;2;1;0;2;0;2;1;1;2;1;0;2;0;0;1;0;0;1;1;1;1;0;0;1;1;1;0;1;0;0;1;1;1;1;0;2;0;1;1;0;1;0;0;1;0;1;1;0;1;5;0;1;1;5;0
cjd;3;2;1;0;2;0;1;1;2;1;0;0;1;1;4;1;1;2;2;0;1;0;0;0;0;0;1;3;2;0;1;1;2;3;1;0;2;0;0;1;2;1;1;0;2;0;1;2;0;4;0;0;3;0;1;1;1;2;1;0;1;4;1;0
cneg;1;4;2;0;1;0;1;5;1;2;3;0;1;0;6;5;2;4;1;0;1;0;1;6;1;0;1;3;0;0;1;4;3;2;10;0;1;0;2;8;2;5;2;0;0;0;2;6;0;4;0;0;1;0;1;5;0;3;3;0;1;5;3;0
cot;1;1;3;0;1;0;1;1;1;1;1;0;1;0;4;1;3;1;1;0;3;0;0;1;0;0;1;2;0;0;1;1;2;1;1;0;1;0;0;1;1;1;0;0;1;0;1;2;0;2;0;0;2;0;1;2;0;0;1;0;1;2;1;0
dha;3;2;4;0;3;0;1;2;3;2;1;0;2;1;9;1;2;2;1;0;5;0;0;1;0;0;1;2;1;0;1;2;2;2;1;0;2;0;1;1;3;1;1;0;2;0;1;2;0;3;0;0;3;0;1;1;1;1;1;0;2;4;1;0
ecu;1;2;1;0;1;0;1;1;1;1;1;0;1;0;2;1;1;1;1;0;1;0;1;1;1;0;0;1;1;0;1;1;1;1;1;0;1;0;1;1;1;1;1;0;1;0;1;1;0;1;0;0;1;0;1;1;0;1;1;0;1;1;1;0
ede;1;1;0;0;1;0;1;2;0;1;1;0;1;0;2;2;1;2;1;0;1;0;1;0;2;0;1;2;1;1;1;1;1;2;2;0;1;0;1;2;1;2;2;0;1;0;1;2;0;1;0;0;1;0;1;1;1;1;0;0;1;1;1;0
fgr;3;6;4;0;3;0;2;4;3;7;3;0;3;0;6;5;5;5;1;0;3;0;2;6;7;0;1;2;2;0;3;2;4;1;7;0;4;0;2;9;6;12;1;0;2;0;3;8;0;4;0;0;2;0;2;6;1;3;4;0;2;8;3;0
fgr5;2;5;4;0;3;0;2;4;3;7;3;0;3;0;5;5;5;5;1;0;3;0;2;6;7;0;1;2;2;0;3;1;3;1;5;0;3;0;3;9;5;13;1;0;2;0;3;6;0;3;0;0;2;0;2;6;1;3;4;0;1;7;3;0
fve;6;8;9;1;3;0;2;7;2;1;4;0;2;0;7;2;4;7;6;0;3;0;2;4;4;0;2;11;2;0;1;4;5;7;11;1;6;0;2;3;5;11;7;0;3;0;2;2;0;6;0;0;2;0;3;4;0;4;4;0;1;15;4;2
fvr;2;5;5;1;3;0;2;7;2;6;2;0;1;0;6;7;4;5;2;0;3;0;2;9;6;0;1;2;2;0;4;5;5;1;12;1;2;0;2;13;2;3;1;0;2;0;3;2;0;7;0;0;2;0;3;4;0;4;5;0;2;9;4;0
kaf;7;1;1;0;1;0;1;3;2;2;1;0;2;0;4;1;2;1;1;0;9;0;0;1;0;0;1;2;2;0;0;2;1;1;1;0;2;0;0;1;3;1;1;0;2;0;1;2;0;3;0;0;1;0;1;3;0;1;2;0;3;7;2;0
kapa;3;1;2;0;1;0;1;2;2;2;1;0;1;0;3;1;1;1;2;0;1;0;1;1;1;0;1;2;1;0;2;2;2;1;1;0;1;0;0;1;3;2;1;0;1;0;1;2;0;4;0;0;1;0;1;1;0;1;2;0;1;1;3;0
kla;2;1;2;0;1;0;1;1;2;2;1;0;1;0;3;1;3;1;1;0;6;0;0;1;0;0;1;1;2;1;0;0;1;1;1;0;1;0;0;1;2;1;1;0;1;0;2;1;0;1;0;0;1;0;1;1;0;1;3;0;2;1;3;0
kna;3;1;1;0;2;0;1;1;2;1;1;0;2;0;2;1;1;1;2;0;4;0;0;1;0;0;1;2;2;0;0;1;2;2;1;0;1;0;1;3;1;2;1;0;1;0;2;1;0;4;0;0;1;0;1;1;0;3;4;0;1;5;3;0
lkl;4;1;1;0;1;0;1;3;2;4;1;0;1;0;2;2;2;1;1;0;5;1;0;1;0;0;1;1;3;1;0;0;1;1;2;0;1;0;0;2;1;1;1;0;1;0;1;1;0;7;0;0;1;0;1;7;0;2;4;0;1;4;7;0
lth;2;1;2;0;2;0;1;2;3;3;1;0;1;0;4;1;3;3;1;0;7;0;0;1;0;0;1;2;3;1;3;0;2;1;3;0;3;0;2;1;1;2;2;0;1;0;1;2;0;5;0;0;1;0;2;1;0;2;3;0;1;7;7;0
mfa;4;4;2;0;1;0;1;1;1;3;1;0;3;0;5;2;2;1;1;0;6;0;0;1;0;0;1;3;0;0;1;2;2;1;2;0;2;0;1;2;2;1;1;0;1;0;2;2;0;2;0;0;1;0;1;3;0;2;1;0;2;1;2;0
mgr;1;13;7;0;2;0;2;5;1;3;3;0;1;0;6;8;2;1;6;0;2;0;2;4;2;0;2;6;1;0;4;6;2;5;9;0;3;0;2;9;3;14;3;0;1;0;2;6;0;5;0;0;2;0;3;4;0;3;1;0;1;5;2;0
mth;2;2;9;0;2;0;3;5;1;5;2;0;1;1;7;8;2;4;5;0;2;0;3;6;1;0;2;7;1;0;4;7;2;10;8;0;2;0;3;7;3;2;2;0;2;0;3;3;0;4;0;0;3;0;2;4;1;2;3;0;1;4;2;0
ncr;2;3;4;0;3;0;3;3;4;6;4;0;1;1;8;17;3;6;10;0;3;0;4;4;2;0;2;2;2;0;6;15;2;8;12;0;3;0;5;13;2;2;6;0;2;0;4;1;0;6;1;0;3;0;3;2;0;2;2;0;1;4;5;0
ncs;6;2;1;0;2;0;2;1;1;3;1;0;2;0;2;1;1;1;1;0;8;0;0;1;0;0;2;2;3;0;0;2;2;1;1;0;2;0;0;2;1;1;1;0;2;0;1;3;0;2;0;0;2;0;1;2;0;1;7;0;2;7;9;0
opa;2;1;1;0;1;0;1;1;1;1;1;0;1;0;2;1;1;1;1;0;2;0;0;0;0;0;1;2;1;0;1;1;1;1;2;0;1;0;0;1;2;1;0;0;0;0;1;1;0;2;0;0;1;0;1;1;0;1;2;0;1;1;1;0
pch;1;2;1;0;3;0;2;6;0;3;2;0;2;0;10;3;3;5;1;0;0;0;1;0;2;0;1;1;0;1;3;1;3;2;1;0;2;0;2;1;4;1;1;0;1;0;1;5;1;3;0;0;1;0;2;4;1;3;0;0;2;2;0;0
pic;3;2;3;0;1;0;1;1;2;2;1;0;1;0;5;1;2;1;2;0;4;0;0;1;0;0;1;1;0;0;1;1;1;1;1;0;1;0;0;1;2;1;1;0;2;0;1;3;0;4;0;0;1;0;2;1;0;1;1;0;1;2;1;0
sas;3;2;1;0;3;0;2;2;2;3;1;0;1;1;6;1;1;3;3;0;5;0;0;1;0;0;1;1;3;1;1;0;2;2;1;0;5;0;2;1;1;1;2;0;2;0;3;2;0;3;0;0;3;0;3;1;1;2;2;0;2;4;3;0
sce;2;1;1;0;2;0;1;1;1;2;1;0;2;0;2;1;3;1;1;0;7;0;0;1;0;0;1;2;2;1;0;0;2;2;1;0;1;0;0;1;1;1;2;0;1;0;1;2;0;2;0;0;1;0;1;2;0;1;1;0;1;5;5;0
spo;2;2;3;0;2;0;1;2;2;1;1;0;1;0;4;2;2;1;1;0;2;0;1;1;1;0;1;1;1;0;1;2;1;1;1;0;1;0;1;1;3;1;1;0;1;0;1;2;0;3;0;0;2;0;1;1;0;2;1;0;2;2;1;0
sre;1;4;5;0;1;0;1;4;1;0;1;0;1;0;4;4;3;2;2;0;1;0;1;3;1;0;0;4;1;0;2;4;2;3;4;0;1;0;1;3;2;5;1;0;1;0;1;4;0;2;0;0;1;0;2;2;1;2;2;0;0;4;0;0
tbl;3;1;2;0;2;0;1;4;3;6;1;0;2;0;6;4;3;1;1;0;13;0;0;1;0;0;1;1;2;2;0;0;5;3;1;0;2;0;0;3;2;1;1;0;2;0;1;3;0;7;0;0;1;0;2;3;0;0;6;0;2;7;6;0
tdl;3;2;3;0;1;0;1;2;2;1;1;0;1;0;2;1;2;1;1;0;2;0;0;1;0;0;1;1;4;1;0;0;1;1;2;0;1;0;0;1;1;1;1;0;1;0;1;2;0;4;0;0;1;0;1;1;0;1;1;0;1;4;5;0
tpf;2;2;2;0;2;0;1;3;2;3;1;0;1;0;4;1;2;1;1;0;7;0;0;1;0;0;1;1;2;1;0;0;3;2;1;0;1;0;0;2;2;1;1;0;1;0;1;1;0;2;0;0;1;0;1;1;0;1;3;0;1;3;1;0
ttt;2;3;6;0;1;0;2;4;1;3;2;0;1;0;5;6;2;3;4;0;2;0;3;4;1;0;2;6;1;0;4;4;2;6;6;0;2;0;3;7;2;3;2;0;1;0;3;3;0;4;0;0;1;0;3;1;0;2;3;0;7;5;1;0
uma;1;3;5;0;1;0;1;1;1;1;1;0;1;0;4;2;2;1;3;0;1;0;1;4;3;0;0;4;2;0;2;3;2;3;5;0;1;0;1;4;2;6;1;0;1;0;1;3;0;1;0;0;1;0;3;3;2;2;2;0;0;2;0;0
vda;2;6;1;0;3;0;3;2;3;3;2;0;0;0;5;1;2;1;3;0;3;0;2;4;2;0;2;5;1;0;4;2;2;6;2;0;2;0;2;9;3;1;3;0;1;0;2;9;0;6;0;1;3;1;3;3;1;4;3;0;1;5;2;0
vma;0;5;7;0;3;0;2;4;1;3;3;0;1;0;5;7;2;6;4;0;2;0;1;1;1;0;2;6;3;0;4;2;3;5;9;0;2;0;2;7;1;9;2;1;1;0;2;7;0;3;0;0;1;0;3;3;0;2;3;0;0;3;3;0
yli;4;9;24;0;3;0;2;1;1;6;1;0;1;0;7;12;3;5;15;0;1;0;2;6;11;0;0;1;2;0;7;12;3;25;16;0;1;0;1;2;10;1;0;0;1;0;5;3;0;10;0;0;2;0;3;4;0;1;8;0;1;11;3;0
zro;2;2;1;0;1;0;2;1;1;5;1;0;1;1;2;2;1;2;2;0;1;0;0;2;0;0;1;2;5;1;0;0;2;4;1;0;3;0;0;1;1;2;2;0;2;0;1;2;0;1;0;0;3;0;2;1;0;1;4;0;1;4;10;0
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
Simples 42;;fréquences;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;Lys;Asn;Lys;Asn;Thr;Thr;Thr;Thr;Arg;Ser;Arg;Ser;Ile;Ile;Met;Ile;Gln;His;Gln;His;Pro;Pro;Pro;Pro;Arg;Arg;Arg;Arg;Leu;Leu;Leu;Leu;Glu;Asp;Glu;Asp;Ala;Ala;Ala;Ala;Gly;Gly;Gly;Gly;Val;Val;Val;Val;Stp;Tyr;Stp;Tyr;Ser;Ser;Ser;Ser;SeC;Cys;Trp;Cys;Leu;Phe;Leu;Phe
critère;aaa;aac;aag;aat;aca;acc;acg;act;aga;agc;agg;agt;ata;atc;atg;att;caa;cac;cag;cat;cca;ccc;ccg;cct;cga;cgc;cgg;cgt;cta;ctc;ctg;ctt;gaa;gac;gag;gat;gca;gcc;gcg;gct;gga;ggc;ggg;ggt;gta;gtc;gtg;gtt;taa;tac;tag;tat;tca;tcc;tcg;tct;tga;tgc;tgg;tgt;tta;ttc;ttg;ttt
0;1;0;1;40;0;42;1;0;2;1;1;42;1;36;0;0;0;0;0;42;1;41;21;4;20;42;4;0;6;30;11;11;0;0;0;40;0;42;16;0;0;0;3;40;2;41;0;0;41;0;41;40;0;41;0;0;31;2;2;41;3;0;4;41
1;9;11;14;2;18;0;24;14;18;10;27;0;28;6;0;18;10;19;22;0;9;1;10;21;9;0;27;12;14;11;14;9;10;18;19;2;18;0;10;20;14;24;25;2;23;1;23;8;1;6;1;2;24;1;20;20;10;15;12;1;24;7;10;0
2;15;12;8;0;12;0;14;11;14;9;7;0;10;0;11;7;16;7;8;0;9;0;8;1;6;0;10;17;15;1;3;10;18;8;6;0;15;0;11;7;14;7;10;0;16;0;10;17;0;7;0;0;10;0;11;5;1;14;9;0;12;5;6;1
3;11;5;5;0;12;0;3;4;6;10;5;0;3;0;2;1;10;4;3;0;8;0;2;1;2;0;1;4;5;0;5;1;7;4;3;0;5;0;4;4;8;2;2;0;1;0;7;8;0;7;0;0;8;0;11;7;0;6;8;0;2;3;9;0
4;3;4;4;0;0;0;0;7;1;2;2;0;0;0;8;2;3;3;4;0;3;0;1;7;1;0;0;2;1;0;7;4;1;1;1;0;1;0;0;1;2;0;0;0;0;0;1;1;0;10;0;0;0;0;0;6;0;4;6;0;0;10;2;0
5;0;4;3;0;0;0;0;3;1;4;0;0;0;0;8;5;3;5;1;0;3;0;0;1;0;0;0;2;1;0;0;2;5;2;2;0;2;0;1;0;2;2;0;0;0;0;1;1;0;4;0;0;0;0;0;1;0;1;2;0;0;7;6;0
6;2;3;1;0;0;0;0;1;0;4;0;0;0;0;6;2;0;2;2;0;2;0;0;6;1;0;0;3;0;0;1;2;1;4;1;0;1;0;0;0;1;1;1;0;0;0;0;3;0;3;0;0;0;0;0;2;0;0;1;0;0;1;1;0
7;1;0;2;0;0;0;0;2;0;2;0;0;0;0;3;2;0;2;0;0;3;0;0;0;2;0;0;1;0;0;1;1;0;1;1;0;0;0;0;3;0;0;1;0;0;0;0;1;0;3;0;0;0;0;0;1;0;0;1;0;1;5;2;0
8;0;1;0;0;0;0;0;0;0;0;0;0;0;0;2;3;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;2;1;0;0;0;0;1;0;1;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;1;0;0;1;0;0
9;0;1;3;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;1;0;0;1;0;0;0;0;0;0;0;0;0;0;3;0;0;0;0;4;0;1;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0
10;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;1;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;1;0
11;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;1;0;0;0;0;0;0;1;0;0;0;0;0;0;1;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;1;0;0
12;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;2;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
13;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
14;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
15;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0
16;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
17;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
18;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
19;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
20;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
21;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
22;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
23;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
24;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
25;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
26;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
27;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
28;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
29;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
30;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
31;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
32;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
33;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
34;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
35;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
36;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
37;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
38;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
39;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
40;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
41;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
42;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
43;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
44;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
45;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
46;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
47;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
48;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
49;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
50;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
51;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
52;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
53;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
54;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
55;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
56;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
57;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
58;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
59;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
60;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0

Distribution des doublons des eucaryotes E79[modifier | modifier le wikicode]

Doublons 79;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;Lys;Asn;Lys;Asn;Thr;Thr;Thr;Thr;Arg;Ser;Arg;Ser;Ile;Ile;Met;Ile;Gln;His;Gln;His;Pro;Pro;Pro;Pro;Arg;Arg;Arg;Arg;Leu;Leu;Leu;Leu;Glu;Asp;Glu;Asp;Ala;Ala;Ala;Ala;Gly;Gly;Gly;Gly;Val;Val;Val;Val;Stp;Tyr;Stp;Tyr;Ser;Ser;Ser;Ser;SeC;Cys;Trp;Cys;Leu;Phe;Leu;Phe
;aaa;aac;aag;aat;aca;acc;acg;act;aga;agc;agg;agt;ata;atc;atg;att;caa;cac;cag;cat;cca;ccc;ccg;cct;cga;cgc;cgg;cgt;cta;ctc;ctg;ctt;gaa;gac;gag;gat;gca;gcc;gcg;gct;gga;ggc;ggg;ggt;gta;gtc;gtg;gtt;taa;tac;tag;tat;tca;tcc;tcg;tct;tga;tgc;tgg;tgt;tta;ttc;ttg;ttt
acs;2;6;3;0;1;0;0;1;0;2;0;0;0;0;4;4;0;3;2;0;2;0;1;2;0;0;0;2;0;0;2;2;5;6;1;0;0;0;0;6;5;5;1;0;0;0;2;2;0;0;0;0;0;0;0;4;0;8;3;0;0;4;1;0
aga;3;10;15;0;1;0;3;7;0;4;0;0;0;0;13;10;2;16;5;0;6;0;7;2;4;0;0;9;1;0;8;3;8;18;12;0;1;0;4;13;7;14;0;0;2;0;21;24;0;1;0;0;1;0;7;4;0;4;5;0;1;8;0;0
aml;5;10;12;0;1;0;0;4;0;3;1;0;0;0;11;7;1;7;4;0;3;0;3;7;2;0;2;5;0;0;2;2;4;5;3;0;2;0;1;3;3;8;2;0;0;0;7;8;0;1;0;0;0;0;0;6;0;13;3;0;1;8;2;0
ath;10;10;14;0;4;0;2;7;1;7;4;0;3;1;16;15;6;6;4;0;41;0;2;11;4;0;1;4;6;0;2;9;7;21;9;0;7;0;4;13;11;16;4;0;4;1;6;12;0;50;0;0;6;1;3;26;0;4;11;0;3;16;6;0
bacu;4;17;5;0;1;0;0;4;0;3;0;0;0;0;8;6;2;7;4;0;2;0;2;5;1;0;1;3;0;0;3;4;47;7;21;1;0;0;1;2;25;13;103;1;0;0;8;5;0;0;0;0;0;0;0;3;0;5;13;0;1;4;0;0
bdi;3;10;16;0;2;2;2;2;2;12;4;0;1;0;25;13;7;14;8;0;8;0;5;11;4;0;2;12;6;0;7;7;8;21;16;0;7;0;9;16;6;19;8;0;2;2;8;11;0;3;0;0;5;1;4;8;0;6;12;0;2;13;9;0
bta;10;16;15;0;2;0;0;4;0;8;2;0;0;0;16;14;2;14;8;0;6;0;3;11;1;0;3;7;0;0;3;6;11;9;3;0;4;0;2;12;6;8;29;0;2;0;12;7;0;1;0;0;0;4;0;8;0;25;5;9;0;12;0;0
cbr;11;20;36;0;6;0;5;20;7;6;1;0;8;0;18;17;19;18;6;0;30;0;2;2;4;0;0;17;3;0;2;21;15;27;21;0;13;0;2;22;33;16;0;0;2;0;3;18;0;13;0;0;3;0;4;14;0;14;12;0;2;16;1;0
cbre;20;28;45;0;12;0;6;26;10;9;4;0;13;0;24;31;29;21;6;0;48;1;4;13;11;0;13;28;6;0;3;29;27;31;34;0;7;0;2;33;61;25;11;0;3;0;7;30;0;20;0;0;7;0;3;16;1;16;19;0;4;18;2;0
cel;13;17;24;0;9;0;2;14;5;6;1;0;3;0;16;19;15;13;4;0;23;0;3;2;4;0;0;14;2;0;3;14;14;20;19;0;7;0;0;16;28;10;2;0;1;0;4;15;0;7;0;0;2;0;3;11;0;11;9;0;1;10;0;0
cfa;6;8;10;0;1;0;0;2;0;2;1;0;0;0;6;4;1;7;4;0;1;0;2;7;0;0;1;1;0;0;4;3;4;9;6;0;3;0;0;3;7;8;2;0;0;0;5;2;0;0;0;0;0;0;1;5;0;9;0;0;0;4;0;0
cge;5;8;11;0;1;0;0;1;0;3;1;0;0;0;7;10;1;11;5;0;4;0;2;6;2;0;0;3;0;0;5;3;2;10;6;0;1;0;1;5;5;9;2;0;1;0;3;4;0;0;0;0;0;0;0;5;0;24;2;0;0;4;0;0
cjap;23;20;30;0;7;0;8;17;9;12;2;0;2;0;25;20;11;12;11;0;33;0;7;7;6;0;0;17;2;0;5;22;16;32;31;0;6;0;7;23;36;24;0;0;2;0;8;19;0;22;0;0;4;0;10;14;0;12;14;0;0;19;0;0
cjc;5;9;4;0;0;0;0;1;0;3;1;0;0;0;7;5;0;5;5;0;3;0;3;6;0;2;1;4;0;0;3;4;3;8;6;0;1;0;1;2;6;9;1;0;1;0;4;3;0;10;0;0;1;0;0;5;0;9;1;0;0;4;0;0
cmk;5;16;11;0;49;0;4;7;0;10;5;0;4;0;20;8;1;10;8;0;7;0;0;1;3;0;0;4;2;0;5;6;7;14;22;0;2889;3;100;19;22;12;7;0;29;0;37;6;0;7;0;0;3;0;0;12;0;5;10;0;1;10;1;0
cpic;4;5;2;0;1;0;0;1;1;1;0;0;0;0;5;2;1;2;1;0;1;0;0;4;1;0;0;2;0;0;2;0;0;4;2;0;3;0;0;1;10;5;1;0;0;0;0;1;0;0;0;0;0;0;1;2;0;4;1;0;0;2;1;0
cpo;4;9;7;0;1;0;0;0;0;3;1;0;0;0;5;7;2;6;3;0;2;0;2;6;0;0;0;4;0;0;4;3;2;6;4;0;2;0;0;4;2;6;1;0;1;0;3;4;0;4;0;0;1;0;1;6;0;18;1;0;0;5;0;0
csi;4;10;6;0;2;0;0;3;0;7;0;0;0;0;11;7;2;8;4;0;4;0;2;8;1;0;2;4;1;0;2;3;4;6;4;0;1;0;1;7;2;8;3;0;0;0;4;5;0;0;0;0;2;0;0;8;0;4;4;0;0;7;0;0
dme;4;9;12;0;4;0;2;6;0;4;2;0;0;0;8;8;2;4;4;0;4;0;2;6;6;0;0;9;1;0;7;3;5;11;10;0;0;0;2;10;4;12;0;0;1;0;5;4;0;0;0;0;0;0;3;5;0;3;6;0;0;7;0;0
dno;4;17;13;0;1;0;0;1;0;3;1;0;0;0;10;6;2;6;3;0;5;0;1;6;1;0;0;5;0;0;6;3;5;12;7;0;2;0;1;7;10;10;4;0;0;0;5;4;0;3;0;0;1;0;0;7;0;9;3;0;0;5;1;0
dsi;2;5;10;0;3;0;2;7;0;1;1;0;0;0;8;6;2;4;4;0;3;0;2;5;2;0;0;8;1;0;8;4;2;5;6;0;0;0;3;8;3;13;0;0;1;0;4;5;0;0;0;0;0;0;2;5;0;4;7;0;0;5;0;0
dya;3;10;12;0;4;0;4;7;0;4;2;0;0;0;11;8;3;4;3;0;7;0;3;5;5;0;0;11;1;0;7;4;5;14;11;0;1;0;2;14;5;14;0;0;1;0;8;5;0;0;0;0;0;0;4;6;0;5;6;0;1;8;0;0
ecb;7;9;8;0;2;0;0;2;0;5;1;0;0;0;12;13;2;8;6;0;4;0;1;9;1;0;2;6;0;0;1;5;5;5;3;0;2;0;1;11;2;9;3;0;0;0;9;7;0;4;0;0;0;0;0;8;0;10;3;0;0;8;0;0
eeu;6;5;28;0;0;0;0;2;0;4;1;0;0;0;10;7;1;4;2;0;3;0;2;8;1;0;1;3;0;0;2;4;3;9;5;0;0;0;0;4;5;10;2;0;0;0;2;3;0;0;0;0;0;0;0;5;0;14;2;0;0;5;0;0
fca;5;7;8;0;1;0;0;3;0;4;1;0;0;0;9;8;5;8;2;0;4;0;2;6;7;0;0;5;0;0;2;5;4;7;3;0;1;0;1;4;2;7;1;0;0;0;6;4;1;1;0;0;1;0;0;5;0;13;1;0;0;4;0;0
gac;30;82;74;0;19;0;14;49;43;14;21;0;46;0;221;84;47;33;61;0;22;0;13;58;65;0;0;37;5;0;6;31;22;135;28;0;36;0;41;31;40;10;1;0;4;0;7;9;0;4;0;0;43;0;23;38;0;72;47;0;4;23;1;0
gfr;2;1;1;0;0;0;0;2;0;3;0;0;0;0;2;4;0;0;1;0;1;0;0;3;0;0;0;1;0;0;2;1;0;1;4;0;0;0;0;9;2;7;1;0;0;0;1;0;0;4;0;0;0;0;0;1;0;5;0;0;0;4;0;0
gga;2;5;4;0;1;0;0;0;0;3;0;0;0;0;8;6;0;2;2;0;1;0;1;6;0;0;0;4;0;0;2;0;2;7;5;0;3;0;0;13;3;5;2;0;0;0;2;2;0;3;0;0;1;0;1;4;0;6;3;0;0;5;0;0
ggo;3;9;5;0;1;0;1;2;0;4;1;0;0;0;10;5;1;6;5;0;3;0;3;5;1;0;2;3;0;0;1;4;3;7;2;0;1;0;0;3;1;5;4;0;0;0;5;2;1;1;0;0;0;0;0;6;0;5;2;0;1;5;0;0
gmo;17;16;20;0;6;0;7;10;2;0;7;0;2;0;42;5;3;10;22;0;6;0;10;25;2;0;3;8;4;0;13;11;12;15;20;0;4;0;6;24;18;17;4;0;0;0;9;8;0;3;0;0;3;14;1;12;0;8;10;0;1;12;0;0
gmx;15;12;20;0;5;0;2;3;10;16;10;0;5;0;22;12;10;15;8;0;20;0;3;16;6;0;1;11;7;0;6;15;12;25;17;0;12;0;5;21;16;26;6;0;5;0;11;15;0;1;0;0;6;0;4;10;0;13;15;0;4;17;10;0
hgl;3;5;4;0;0;0;0;0;0;2;1;0;0;0;6;5;0;5;3;0;1;0;1;4;0;0;0;2;0;0;1;2;2;4;3;0;1;0;1;1;1;6;1;0;1;0;3;1;0;0;0;0;0;0;0;2;3;5;1;0;0;4;0;0
hsa-18;4;8;5;0;0;0;0;3;0;2;0;0;0;2;11;5;2;8;6;0;4;0;2;7;0;0;2;5;0;0;7;5;3;10;6;0;1;0;0;10;5;9;2;0;1;0;7;4;0;0;0;0;0;0;0;5;0;6;2;0;0;5;0;0
lav;14;14;14;0;5;0;0;1;0;7;2;0;0;0;16;13;3;14;5;0;2;0;2;9;4;0;0;4;0;0;4;4;7;6;6;0;6;0;0;14;3;7;2;0;11;0;9;7;0;0;0;0;0;0;1;9;0;5;6;0;1;13;3;0
lcm;7;2;4;0;1;0;0;3;0;1;0;0;0;0;3;1;1;2;2;0;3;0;0;2;0;0;0;2;1;0;0;1;2;3;2;0;1;0;1;3;0;2;1;0;0;0;1;0;0;0;1;0;0;0;0;0;0;3;2;0;0;1;0;0
lma;0;2;2;0;0;0;1;2;0;0;0;0;0;0;2;2;0;1;2;0;0;0;1;1;0;0;0;3;0;0;1;2;0;2;1;0;0;0;1;1;0;3;0;0;0;0;1;1;0;1;0;0;0;0;0;0;0;0;0;0;0;1;0;0
mcc;6;6;7;0;0;0;0;3;0;4;1;0;0;0;5;4;1;10;4;0;3;0;2;6;0;0;2;3;0;0;2;2;2;6;2;0;0;0;1;4;2;6;3;0;1;0;4;3;0;0;0;0;4;0;0;5;0;8;3;0;1;5;1;0
mdo;9;9;10;0;5;0;0;6;0;7;1;0;0;0;14;12;0;8;8;0;5;0;2;10;2;0;1;0;0;0;5;5;10;12;10;0;3;0;2;9;4;19;6;0;1;0;6;6;0;2;0;0;1;0;0;6;0;31;3;0;0;8;1;0
meu;3;10;8;0;3;0;0;3;1;6;0;0;0;0;7;4;1;6;1;0;3;0;1;4;2;0;0;2;1;0;1;2;6;1;5;0;0;0;2;4;6;7;2;0;0;0;3;5;0;0;0;0;2;0;0;6;3;19;1;0;0;3;0;0
mgp;2;2;1;0;0;0;0;0;0;1;1;0;0;0;7;1;0;0;0;0;0;0;0;5;0;0;0;0;0;0;1;0;1;2;3;0;2;0;0;4;2;4;1;0;0;0;0;0;0;2;0;0;0;0;0;2;0;2;2;0;0;2;0;0
mlu;1;7;4;0;2;0;0;2;1;2;0;0;0;0;8;6;0;4;2;0;0;0;2;5;1;0;0;1;0;0;3;1;1;5;5;0;0;0;0;3;4;6;1;0;0;0;4;3;0;0;0;0;0;0;0;4;0;17;2;0;0;3;0;0
mmr;3;4;4;0;0;0;0;0;0;2;0;0;1;0;8;2;1;3;7;0;1;0;2;6;1;0;0;2;0;0;4;3;3;3;4;0;0;0;0;3;5;8;0;0;0;0;3;2;0;0;0;0;0;0;0;1;0;11;2;0;0;6;0;0
mmu;8;8;7;0;1;0;0;2;0;2;1;0;0;0;8;7;1;7;5;0;3;0;2;5;1;0;0;3;0;0;6;2;5;12;8;0;3;0;3;4;6;9;2;0;2;0;4;2;0;0;0;0;1;0;0;5;0;32;2;0;2;4;0;0
mpu;6;4;5;0;1;0;0;2;1;4;0;0;0;0;6;6;2;5;3;0;1;0;1;8;1;0;2;3;0;0;2;4;1;4;4;0;1;0;1;2;2;7;1;0;0;0;3;3;0;0;0;0;0;0;0;5;0;15;2;0;0;6;0;0
mtr;7;14;13;4;3;2;0;8;2;6;2;0;7;0;18;14;10;10;2;0;8;0;0;6;3;0;1;5;6;0;2;3;13;16;8;0;8;0;0;15;9;19;1;0;2;0;2;11;2;2;0;0;4;1;1;7;0;7;7;0;3;20;5;0
mun;1;4;3;0;0;0;0;1;0;0;1;0;0;0;6;3;1;0;0;0;1;0;0;0;0;0;0;1;0;0;0;0;0;4;0;0;0;0;0;7;5;4;0;0;0;0;2;1;0;2;0;0;1;0;0;0;0;0;1;0;1;2;0;0
nle;8;7;6;0;0;0;0;3;0;3;1;0;0;0;7;4;2;7;3;0;2;0;3;5;0;0;1;4;0;0;3;4;2;5;7;0;0;0;1;2;4;5;1;0;0;0;4;4;0;0;0;0;0;1;0;3;0;9;0;0;0;4;0;0
oaa;7;10;10;0;2;0;2;7;0;6;2;7;2;0;14;10;3;4;5;0;3;0;4;13;2;0;3;4;2;0;5;3;3;13;13;0;6;0;3;32;6;17;4;0;2;0;5;7;0;2;0;0;0;0;1;0;0;18;5;0;3;6;0;0
oas;5;8;5;0;1;0;0;0;0;1;1;0;0;0;4;3;0;3;3;0;2;0;0;3;0;0;0;0;0;0;0;3;3;2;3;0;0;0;1;7;1;3;2;0;0;0;2;3;0;0;0;0;0;0;0;1;0;5;2;0;0;2;0;0
ocu;4;11;9;0;1;0;0;2;0;7;1;0;0;0;8;6;2;8;8;0;2;0;3;8;2;0;1;4;0;0;10;2;9;17;14;0;0;0;0;7;12;18;5;0;3;0;10;4;0;0;0;0;0;0;1;7;0;9;3;0;1;6;0;0
oga;4;8;4;0;1;0;0;1;0;2;0;0;0;0;5;6;1;7;5;0;1;0;2;6;0;0;0;2;0;0;5;3;1;9;6;0;2;0;1;5;3;7;2;0;1;0;3;3;0;1;0;0;1;0;0;2;0;10;0;0;0;4;0;0
oni;9;8;22;0;3;0;1;6;1;5;12;0;5;0;20;12;1;9;7;0;6;0;2;10;0;0;0;12;1;0;8;5;6;6;13;0;5;0;4;11;6;8;2;0;2;0;7;6;0;0;0;0;1;0;1;6;0;8;7;0;0;9;0;0
opr;3;9;4;0;1;0;0;1;0;4;1;0;0;0;11;6;2;4;6;0;1;0;3;7;1;0;1;4;0;0;8;2;3;11;7;0;1;0;1;4;5;11;3;0;0;0;5;2;0;0;0;0;0;0;1;5;0;6;2;0;0;4;0;0
osa;4;17;15;0;9;5;3;8;6;14;6;0;2;0;31;14;9;16;3;0;5;0;3;10;2;0;3;17;5;0;8;11;10;20;14;0;9;0;8;16;5;19;4;0;3;13;7;11;0;3;0;0;10;3;3;7;0;8;11;0;1;13;14;0
pan;6;9;6;0;0;0;0;4;0;4;1;0;0;0;8;5;2;9;4;0;2;0;3;5;0;0;2;4;0;0;6;4;7;8;7;0;0;0;1;4;6;10;3;0;2;0;6;4;0;1;0;0;0;0;0;6;0;12;4;0;0;9;0;0
pfa;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
pha;6;8;6;0;0;0;0;4;0;4;1;0;0;0;9;5;2;9;4;0;2;0;3;5;1;0;2;3;0;0;1;4;6;6;3;0;0;0;1;3;2;6;3;0;2;0;6;5;0;2;0;0;0;0;0;6;0;13;3;0;0;9;1;0
pma;17;100;13;0;10;8;11;29;8;34;25;0;3;0;187;47;23;15;60;0;29;0;12;36;17;0;4;55;26;0;37;56;3;56;8;0;21;0;18;62;13;29;4;0;7;0;46;96;1;40;0;0;10;0;18;14;0;38;1;0;2;34;18;0
pop;13;11;15;0;5;0;2;2;5;10;7;0;6;0;18;14;10;9;4;0;13;0;2;12;5;0;1;4;0;0;5;13;13;29;13;0;13;0;2;18;10;21;6;0;5;0;6;13;0;2;0;0;4;0;1;8;0;8;12;0;1;15;0;1
ppp;4;9;11;0;1;0;3;8;4;6;5;0;2;0;15;9;3;6;8;0;6;0;0;11;2;0;2;5;1;0;3;5;5;8;7;0;7;0;6;10;5;13;3;0;1;0;2;10;0;1;0;0;2;0;5;10;0;2;8;0;1;11;3;0
ppy;8;11;8;1;0;0;0;4;2;4;2;0;0;3;9;7;0;7;4;0;3;0;3;8;1;0;4;4;0;0;3;6;9;7;5;0;2;0;1;3;3;8;2;0;2;0;7;4;0;1;0;0;0;0;1;3;0;9;1;0;0;5;0;0
ptr;6;9;8;0;1;0;0;2;0;3;1;0;0;0;9;6;3;8;7;0;4;0;3;4;0;0;2;5;0;0;2;5;6;7;6;0;1;0;0;5;2;6;2;0;0;0;4;6;0;2;0;0;0;1;0;6;0;9;3;0;2;5;0;0
rno;0;8;10;0;1;0;0;2;0;5;2;0;0;0;7;5;1;9;4;0;4;0;2;10;1;0;0;3;0;0;2;0;5;12;5;1;3;0;0;5;6;7;1;0;1;0;2;3;0;0;0;0;0;0;0;2;0;26;1;0;0;4;0;0
san;5;8;6;0;0;0;0;2;0;4;2;0;0;0;7;7;2;6;4;0;2;0;1;7;0;0;1;4;0;0;3;4;1;9;9;0;1;0;1;2;5;11;1;0;0;0;3;5;0;0;0;0;0;0;0;4;0;13;1;0;0;5;0;0
sbi;3;9;15;0;4;0;3;3;2;7;7;0;1;0;9;14;3;8;5;0;6;0;4;9;3;0;4;11;3;0;7;11;8;20;17;0;8;4;9;14;7;18;4;0;2;0;8;9;0;0;0;0;7;0;4;8;0;6;10;0;0;16;4;0
sbq;4;5;3;0;1;0;0;2;0;3;1;0;0;0;8;6;0;5;3;0;2;0;3;5;0;0;1;4;0;0;2;4;4;6;3;0;1;0;1;3;2;7;0;0;1;0;2;2;0;0;0;0;1;0;0;6;0;10;1;0;0;5;0;0
shr;8;12;9;0;4;0;0;4;0;6;1;0;0;0;14;10;16;8;7;0;5;0;2;8;2;0;0;0;0;0;5;6;10;12;8;0;3;0;2;10;6;16;3;0;1;0;6;7;0;1;0;0;0;0;0;7;0;2;3;0;0;6;0;0
spu;37;30;30;0;11;0;4;14;9;14;7;17;6;0;43;57;10;17;10;0;15;0;4;14;9;0;0;20;2;0;2;5;18;62;19;0;10;0;4;21;19;26;1;0;5;0;0;17;0;7;0;0;6;0;1;0;0;20;5;0;5;0;6;0
ssc;15;10;7;0;3;0;0;6;1;6;0;0;1;0;12;12;3;7;4;0;2;0;2;8;2;0;2;5;2;0;3;5;30;14;5;1;2;0;1;5;2;9;2;0;2;0;7;4;0;3;0;0;0;0;0;6;0;10;3;0;0;11;1;0
str;5;7;7;0;2;0;0;2;0;2;1;0;0;0;7;6;2;4;4;0;2;0;2;7;0;0;0;3;0;0;2;3;2;5;3;0;0;1;1;4;2;7;1;0;1;0;3;4;0;0;0;0;0;0;0;6;0;29;3;0;0;6;0;0
tgu;3;3;1;0;1;0;0;2;0;2;0;1;0;0;2;5;0;2;4;0;0;0;1;3;0;0;0;2;0;0;3;0;0;3;1;0;2;0;0;8;4;7;0;0;0;0;0;1;0;3;0;0;0;0;0;2;0;5;0;0;1;6;0;0
tma;5;5;7;0;1;0;0;1;1;2;0;0;0;0;7;5;2;7;4;0;3;0;2;7;0;0;1;3;0;0;1;3;2;4;0;0;3;0;1;4;5;5;2;0;0;0;3;3;0;0;0;0;0;0;1;4;0;2;2;0;0;3;0;0
tng;4;6;10;0;3;0;3;9;0;5;6;0;0;0;8;8;4;4;13;0;4;0;1;4;0;0;0;10;0;0;18;2;3;6;8;0;2;0;0;7;5;5;1;0;1;0;7;3;0;2;0;0;0;5;1;5;0;7;5;0;1;9;0;0
tru;7;10;13;0;1;0;1;7;1;6;5;0;0;0;24;9;3;10;8;0;4;0;2;7;0;0;0;13;0;0;14;3;4;18;14;0;3;0;0;7;7;15;1;0;2;0;16;8;0;1;0;0;0;0;0;5;0;5;7;0;0;10;0;0
tsy;4;6;0;0;0;0;0;2;0;2;0;0;0;0;7;5;13;5;3;0;0;0;1;5;0;0;1;3;1;0;3;3;2;6;3;0;0;0;1;2;2;9;1;0;1;0;2;1;0;0;0;0;0;0;0;3;0;6;2;0;29;1;0;0
ttr;4;7;3;0;1;0;0;2;0;3;1;0;0;0;6;5;4;4;7;0;2;0;2;4;0;0;0;2;0;0;1;5;29;5;8;0;0;0;1;5;19;6;70;1;0;0;3;1;0;1;0;0;0;0;0;3;0;2;9;1;0;4;0;0
vvi;5;7;5;0;2;0;1;4;3;7;4;0;3;0;6;9;3;5;3;0;8;0;1;9;3;0;0;1;4;0;4;5;5;11;12;0;16;0;3;9;7;11;3;0;1;0;6;8;0;0;0;0;5;0;2;4;0;5;9;0;2;11;4;0
xtr;51;28;74;0;48;0;15;76;52;40;18;0;26;0;99;45;20;24;30;0;36;0;19;42;25;0;2;20;15;1;17;20;60;46;32;0;29;0;15;50;53;70;70;0;17;0;25;36;0;59;0;0;22;1;13;23;0;46;21;0;11;40;6;0
zma;14;31;36;0;8;8;4;7;3;10;5;0;1;0;31;32;8;18;6;0;13;0;5;11;3;0;3;25;4;0;10;19;12;30;16;0;8;0;11;34;8;30;9;0;2;11;13;11;0;3;0;0;6;10;3;8;0;10;20;0;2;17;12;0
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
doublonss 79;;fréquences;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;Lys;Asn;Lys;Asn;Thr;Thr;Thr;Thr;Arg;Ser;Arg;Ser;Ile;Ile;Met;Ile;Gln;His;Gln;His;Pro;Pro;Pro;Pro;Arg;Arg;Arg;Arg;Leu;Leu;Leu;Leu;Glu;Asp;Glu;Asp;Ala;Ala;Ala;Ala;Gly;Gly;Gly;Gly;Val;Val;Val;Val;Stp;Tyr;Stp;Tyr;Ser;Ser;Ser;Ser;SeC;Cys;Trp;Cys;Leu;Phe;Leu;Phe
critère;aaa;aac;aag;aat;aca;acc;acg;act;aga;agc;agg;agt;ata;atc;atg;att;caa;cac;cag;cat;cca;ccc;ccg;cct;cga;cgc;cgg;cgt;cta;ctc;ctg;ctt;gaa;gac;gag;gat;gca;gcc;gcg;gct;gga;ggc;ggg;ggt;gta;gtc;gtg;gtt;taa;tac;tag;tat;tca;tcc;tcg;tct;tga;tgc;tgg;tgt;tta;ttc;ttg;ttt
0;3;1;2;77;17;74;50;7;51;4;20;76;55;76;1;1;14;4;3;79;6;78;10;2;29;78;40;5;49;78;4;7;6;1;3;76;21;76;23;1;3;1;12;77;31;75;5;4;75;34;78;79;44;68;44;6;76;3;7;77;46;2;54;78
1;2;1;3;1;27;0;5;10;9;5;30;1;5;1;0;2;16;1;3;0;10;1;13;2;16;0;16;5;10;1;9;3;5;2;3;3;15;1;27;3;3;0;21;2;20;1;3;7;3;14;1;0;12;6;16;3;1;0;12;1;17;3;10;1
2;5;3;2;0;8;2;8;20;5;12;10;0;5;1;3;3;19;4;8;0;14;0;28;5;12;1;14;9;6;0;18;10;11;3;4;0;10;0;9;6;14;1;17;0;16;1;10;8;1;9;0;0;4;0;2;6;0;5;14;0;7;4;2;0
3;10;1;4;0;6;0;5;9;2;12;0;0;4;1;1;2;10;3;11;0;12;0;16;3;5;0;5;13;2;0;13;16;10;3;11;0;9;1;4;9;6;2;9;0;3;0;12;10;0;8;0;0;3;1;6;5;2;2;13;0;3;3;2;0
4;15;3;8;1;5;0;4;8;1;13;4;0;1;0;2;6;2;10;19;0;10;0;4;6;6;0;3;16;3;0;5;13;6;5;5;0;2;1;4;11;5;2;8;0;2;0;9;12;0;4;0;0;4;1;5;7;0;5;2;0;3;14;2;0
5;10;7;6;0;4;1;1;0;2;4;4;0;2;0;4;12;1;6;9;0;4;0;2;12;2;0;0;8;2;0;8;11;9;7;7;0;1;0;1;6;13;7;1;0;3;0;6;7;0;0;0;0;2;1;1;14;0;11;5;0;1;12;1;0
6;7;4;5;0;2;0;1;4;1;9;2;0;2;0;6;12;1;7;6;0;6;0;0;11;3;0;0;1;4;0;5;4;4;10;8;0;3;0;2;1;10;7;3;0;0;0;8;4;0;0;0;0;4;0;0;13;0;6;3;0;0;7;3;0
7;5;6;6;0;1;0;1;8;1;7;4;1;1;0;10;7;1;9;5;0;2;0;2;9;1;0;0;1;1;0;5;1;4;6;5;0;5;0;1;7;5;10;1;0;1;0;9;5;0;3;0;0;2;0;1;5;0;2;4;0;0;2;0;0
8;4;10;5;0;1;2;1;3;1;1;0;0;1;0;11;5;1;9;8;0;3;0;0;7;0;0;0;2;0;0;5;0;3;3;6;0;3;0;1;2;1;7;1;0;0;0;5;4;0;0;0;0;0;0;0;7;0;6;1;0;0;5;0;0
9;2;11;2;0;2;0;0;1;2;1;0;0;0;0;5;3;1;5;0;0;0;0;0;4;1;0;0;2;0;0;0;1;2;5;2;0;1;0;2;3;1;7;1;0;0;0;3;2;0;0;0;0;0;0;0;1;0;7;3;1;0;4;1;0
10;2;10;6;0;1;0;0;1;2;3;1;0;0;0;3;4;4;5;1;0;0;0;1;4;0;0;0;1;0;0;2;0;3;2;2;0;1;0;0;4;3;5;0;0;0;0;1;1;0;1;0;0;2;1;1;2;0;5;3;0;0;3;1;0
11;1;3;3;0;1;0;1;0;0;0;0;0;0;0;5;0;1;1;1;0;0;0;0;5;1;0;0;3;0;0;0;3;1;3;1;0;0;0;1;2;1;3;1;0;1;1;1;4;0;0;0;0;0;0;0;1;0;2;2;0;1;3;0;0
12;0;2;3;0;1;0;0;0;0;2;1;0;0;0;2;4;0;1;0;0;0;0;1;1;0;0;0;2;0;0;0;0;3;5;2;0;1;0;0;1;1;2;0;0;0;0;1;1;0;0;0;0;0;0;0;2;0;2;3;0;0;2;1;0
13;2;0;4;0;0;0;0;0;0;0;0;0;1;0;1;3;1;1;1;0;2;0;1;2;0;0;1;1;0;0;1;1;2;1;3;0;2;0;0;3;1;3;0;0;0;1;1;1;0;1;0;0;0;0;1;0;0;5;1;0;0;3;0;0
14;2;2;2;0;0;0;1;2;0;3;0;0;0;0;3;5;0;3;0;0;0;0;0;1;0;0;0;1;0;0;1;1;1;3;3;0;0;0;0;3;0;2;0;0;0;0;0;0;0;0;0;0;0;1;0;3;0;2;1;0;0;0;1;0
15;2;0;5;0;0;0;1;0;0;0;0;0;0;0;1;1;1;2;0;0;1;0;0;0;0;0;0;0;1;0;0;1;1;1;0;0;0;0;1;1;0;1;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;1;1;0;0;1;0;0
16;0;3;1;0;0;0;0;0;0;1;0;0;0;0;4;0;1;2;0;0;0;0;0;1;0;0;0;0;0;0;0;0;1;1;2;0;1;0;0;3;1;3;0;0;0;0;1;0;0;0;0;0;0;0;0;1;0;1;0;0;0;3;0;0
17;2;4;0;0;0;0;0;1;0;0;0;1;0;0;0;1;0;1;0;0;0;0;0;0;1;0;0;3;0;0;1;0;0;1;2;0;0;0;0;0;0;2;0;0;1;0;0;1;0;0;0;0;0;0;0;0;0;1;0;0;0;2;0;0
18;0;0;0;0;0;0;0;0;0;0;1;0;0;0;3;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;2;0;0;0;0;1;1;1;2;0;0;0;0;0;1;0;0;0;0;0;0;1;0;0;2;0;0;0;1;1;0
19;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;1;0;0;0;0;0;0;0;0;1;0;0;2;0;0;0;0;1;2;4;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;1;1;0;0;1;0;0
20;1;2;2;0;0;0;0;1;0;0;0;0;0;0;2;1;1;0;0;0;1;0;0;0;0;0;0;2;0;0;0;1;0;3;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;1;1;0;0;1;0;0
21;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;2;2;0;1;0;0;2;0;1;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0
22;0;0;1;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;1;0;0;0;0;0;0;0;0;0;0;1;1;0;1;0;0;0;0;1;1;0;0;0;0;0;0;0;0;1;0;0;1;0;0;0;0;0;0;0;0;0;0;0
23;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;1;0;0
24;0;0;1;0;0;0;0;0;0;0;0;0;0;0;2;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0
25;0;0;0;0;0;0;0;0;0;0;1;0;0;0;2;0;0;0;0;0;0;0;0;1;1;0;0;1;0;0;0;0;0;1;0;0;0;0;0;0;1;1;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0
26;0;0;0;0;0;0;0;1;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;0;0;0;0;0;0
27;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
28;0;2;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
29;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;0;0;0;0;0;1;1;1;0;0;1;0;0;0;0;1;1;0;1;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;1;0;0;0
30;1;1;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
31;0;1;0;0;0;0;0;0;0;0;0;0;0;0;2;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;1;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0
32;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0
33;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
34;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0
35;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
36;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
37;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
38;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;0;0;0;0;0;0
39;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
40;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;1;0;0
41;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
42;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
43;0;0;0;0;0;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0
44;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
45;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
46;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0
47;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0
48;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
49;0;0;0;0;1;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
50;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0
51;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
52;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
53;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
54;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
55;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
56;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
57;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
58;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
59;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0
60;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0

Distribution des doublons des champignons C42[modifier | modifier le wikicode]

Légende:

Doublons 42;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;Lys;Asn;Lys;Asn;Thr;Thr;Thr;Thr;Arg;Ser;Arg;Ser;Ile;Ile;Met;Ile;Gln;His;Gln;His;Pro;Pro;Pro;Pro;Arg;Arg;Arg;Arg;Leu;Leu;Leu;Leu;Glu;Asp;Glu;Asp;Ala;Ala;Ala;Ala;Gly;Gly;Gly;Gly;Val;Val;Val;Val;Stp;Tyr;Stp;Tyr;Ser;Ser;Ser;Ser;SeC;Cys;Trp;Cys;Leu;Phe;Leu;Phe
;aaa;aac;aag;aat;aca;acc;acg;act;aga;agc;agg;agt;ata;atc;atg;att;caa;cac;cag;cat;cca;ccc;ccg;cct;cga;cgc;cgg;cgt;cta;ctc;ctg;ctt;gaa;gac;gag;gat;gca;gcc;gcg;gct;gga;ggc;ggg;ggt;gta;gtc;gtg;gtt;taa;tac;tag;tat;tca;tcc;tcg;tct;tga;tgc;tgg;tgt;tta;ttc;ttg;ttt
ani;0;0;7;0;0;0;0;4;1;0;0;0;0;0;2;2;0;3;1;0;0;0;0;1;0;0;0;6;0;0;0;0;0;2;5;0;0;0;2;7;0;10;0;0;0;0;0;6;0;1;0;0;0;0;0;4;0;1;2;0;0;2;0;0
aor;0;4;8;0;0;0;0;8;0;1;0;0;0;0;0;5;1;1;3;0;0;0;0;3;1;0;0;10;0;0;0;0;1;5;8;0;1;0;1;8;2;14;0;0;0;0;0;8;0;2;0;0;0;0;0;4;0;0;3;0;0;1;0;0
bfu;0;1;1;0;0;0;0;2;0;0;0;0;0;0;3;0;2;0;0;0;0;0;0;0;1;0;0;1;0;0;0;1;0;3;0;0;0;0;0;7;3;0;0;0;0;0;0;0;0;1;0;0;1;0;0;6;0;0;4;0;0;2;0;0
cal;3;0;0;0;1;0;0;2;4;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;5;0;0;0;0;0;5;1;4;0;0;0;0;0;3;0;0;0;0;1;0;0;3;0;0;0;0;3;1;1;0
cgr;2;6;11;0;2;0;0;8;8;1;0;0;0;0;5;8;5;4;1;0;5;0;0;0;0;0;0;3;3;0;0;0;8;8;2;0;4;0;0;9;1;11;0;0;0;0;0;9;0;5;0;0;1;0;0;8;0;2;0;0;2;5;3;0
cjd;2;5;7;0;1;0;0;5;5;2;0;0;0;0;3;5;5;4;0;0;6;0;0;0;0;0;0;3;1;0;0;3;3;5;8;0;1;0;0;5;2;10;0;0;0;0;2;7;0;2;0;0;0;0;0;6;0;1;3;0;0;4;6;0
cneg;0;0;5;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;2;0;0;0;0;0;4;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;1;4;0;0;0;0;0;1;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0
cot;3;2;0;0;1;0;0;3;1;0;0;0;0;0;0;3;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;4;0;0;1;0;0;2;0;1;0;0;0;0;0;2;0;1;0;0;0;0;0;0;0;0;0;0;2;0;0;0
dha;5;7;6;0;0;0;0;6;7;1;0;0;0;0;1;8;5;4;0;0;2;0;0;0;0;0;0;3;0;0;0;0;7;8;0;0;3;0;0;6;2;10;0;0;0;0;0;8;0;3;0;0;1;0;0;5;0;3;3;0;8;5;3;0
ecu;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
ede;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
fgr;0;3;12;0;1;0;1;7;0;1;0;0;0;0;0;8;0;2;6;0;0;0;0;4;2;0;0;8;0;0;2;11;1;13;12;0;0;0;0;5;0;2;0;0;0;0;0;11;0;4;0;0;0;0;0;5;0;2;0;0;0;3;0;0
fgr5;0;4;8;0;1;0;1;7;0;1;0;0;0;0;0;6;0;2;6;0;0;0;0;4;2;0;0;8;0;0;2;5;1;9;8;0;0;0;0;4;0;2;0;0;0;0;0;10;0;3;0;0;0;0;0;5;0;2;0;0;0;2;0;0
fve;0;4;2;0;0;0;2;0;0;3;2;0;0;0;8;9;0;0;0;0;1;0;0;0;4;0;0;2;0;0;1;2;1;0;1;0;3;0;3;10;4;0;1;0;0;0;1;5;0;0;0;0;0;0;0;3;0;0;0;0;0;0;0;0
fvr;0;3;10;0;1;0;0;4;0;1;0;0;0;0;2;4;0;1;6;0;0;0;0;1;1;0;0;8;0;0;1;7;0;13;4;0;1;0;1;1;3;11;0;0;0;0;0;11;0;1;0;0;0;0;0;6;0;1;0;0;0;1;0;0
kaf;1;9;11;0;2;0;0;8;9;2;0;0;0;0;5;12;7;5;0;0;1;0;0;0;0;0;0;2;0;0;0;0;14;12;1;0;3;0;0;11;1;16;0;0;0;0;0;11;0;6;0;0;3;0;0;8;0;4;4;0;11;2;0;0
kapa;0;3;3;0;0;0;0;3;2;0;0;0;0;0;1;4;2;2;0;0;3;0;0;1;0;0;0;0;0;0;0;0;3;5;3;0;1;0;0;4;0;3;0;0;0;0;0;3;0;0;0;0;1;0;0;3;0;1;1;0;0;4;0;0
kla;2;5;7;0;1;0;0;5;5;0;0;0;0;0;3;6;3;3;0;0;1;0;0;0;0;0;0;2;0;0;0;0;7;7;1;0;2;0;0;6;0;6;0;0;0;0;0;6;0;4;0;0;1;0;0;5;0;2;1;0;1;4;4;0
kna;1;5;6;0;0;0;0;6;4;2;0;0;0;0;2;6;3;3;0;0;2;0;0;0;0;0;0;1;1;0;0;0;4;6;2;0;0;0;0;4;0;7;1;0;0;0;0;6;0;1;0;0;0;0;0;6;0;1;0;0;2;1;2;0
lkl;1;8;13;0;1;0;0;9;10;0;0;0;0;0;8;10;8;5;0;0;5;0;0;0;0;0;0;4;0;0;0;0;12;12;1;0;3;0;0;11;1;14;1;0;0;0;2;13;0;0;0;0;1;0;0;4;0;3;1;0;2;4;4;0
lth;2;6;13;0;0;0;0;7;6;0;0;0;0;0;4;9;2;2;4;0;1;0;0;1;0;0;0;2;0;1;0;0;4;9;8;0;0;0;0;9;2;13;0;0;0;0;2;9;0;1;0;0;1;0;0;8;0;2;2;0;1;0;1;0
mfa;2;8;8;0;3;0;1;9;9;3;1;0;1;0;5;10;6;7;3;0;2;0;0;1;0;0;1;1;0;0;1;2;6;13;6;0;6;0;1;10;4;15;1;0;1;0;2;10;0;8;0;0;3;0;1;7;0;2;5;0;2;9;12;0
mgr;1;127;2;0;0;0;0;1;0;0;0;0;0;0;2;0;0;3;0;0;0;0;0;1;0;0;0;0;0;0;0;1;1;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;3;0;0;2;0;0
mth;1;4;0;0;0;0;0;1;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;9;0;0;0;0;0;4;0;2;0;0;0;0;1;1;0;1;1;0;0;1;0;0
ncr;0;9;20;0;0;0;0;9;1;0;1;0;0;0;9;0;0;3;1;0;1;0;0;8;0;0;1;19;0;0;0;2;3;10;12;0;0;0;0;6;2;24;0;0;0;0;0;18;0;4;0;0;0;0;1;12;0;5;5;0;0;8;0;0
ncs;2;8;13;0;1;0;0;10;9;1;0;0;0;0;7;11;8;7;0;0;2;0;0;0;0;0;0;3;0;0;0;0;11;13;0;0;3;0;0;10;2;12;1;0;0;0;1;10;0;7;0;0;2;0;0;10;0;3;0;0;5;3;0;0
opa;0;1;2;0;0;0;0;2;2;1;0;0;0;0;2;3;1;1;0;0;1;0;0;0;0;0;0;0;0;0;0;0;1;2;1;0;1;0;0;2;0;3;0;0;0;0;0;2;0;0;0;0;0;0;0;1;0;0;0;0;0;2;2;0
pch;0;4;8;0;0;0;0;6;0;1;0;0;0;0;1;7;0;6;4;0;0;0;0;0;0;0;1;9;0;0;0;5;0;7;9;0;0;0;0;7;1;10;0;0;0;0;2;4;0;2;0;0;0;0;0;3;0;0;0;0;0;3;0;0
pic;0;5;6;0;1;0;0;6;5;0;0;0;0;0;1;6;3;3;0;0;2;0;0;0;0;0;0;2;0;0;0;2;7;7;1;0;2;0;0;6;1;9;0;0;0;0;0;4;0;1;0;0;1;0;0;5;0;2;3;0;2;4;7;0
sas;1;6;8;0;0;0;0;5;5;1;0;0;0;0;4;8;3;3;1;0;3;0;0;0;0;0;1;3;1;0;0;0;2;9;7;0;1;0;0;6;1;10;0;0;1;0;1;5;0;2;0;0;0;0;0;6;0;1;3;0;1;3;4;0
sce;5;9;13;0;2;0;0;10;10;2;0;0;0;0;8;12;6;6;0;0;3;0;0;1;0;0;0;4;1;0;0;0;12;14;1;0;4;0;0;10;2;15;0;0;1;0;1;12;0;6;0;0;2;0;0;9;0;3;5;0;6;5;5;0
spo;1;4;6;0;0;0;0;5;0;2;0;0;0;0;3;6;2;3;1;0;0;0;0;5;0;0;0;7;0;0;0;3;3;7;5;0;1;0;0;5;0;7;0;0;1;0;0;7;0;1;0;0;0;0;0;6;0;1;2;0;0;3;3;0
sre;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
tbl;6;10;13;0;1;0;0;11;10;0;0;0;0;0;5;13;7;6;0;0;0;0;0;0;0;0;0;3;0;4;0;0;11;16;0;0;3;0;0;16;1;22;0;0;0;0;0;15;0;2;0;0;3;0;0;13;0;0;1;0;10;5;3;0
tdl;2;5;7;0;1;0;0;7;5;2;0;0;0;0;5;7;4;3;1;0;4;0;0;0;0;0;0;3;0;0;0;0;7;8;2;0;3;0;0;7;1;10;0;0;0;0;1;10;0;3;0;0;1;0;0;6;0;2;3;0;2;2;3;0
tpf;4;7;7;0;0;0;0;6;6;0;0;0;1;0;4;9;5;4;0;0;0;0;0;0;0;0;0;2;0;0;0;0;8;10;0;0;2;0;0;7;0;12;0;0;1;0;0;9;0;4;0;0;1;0;0;7;0;3;1;0;8;6;1;0
ttt;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;1;0;0;1;0;0;0;0;0;0;7;0;0;0;0;0;3;0;0;0;0;0;0;0;2;0;1;1;0;0;0;0;0
uma;0;1;0;0;0;0;0;3;0;1;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;2;0;0;0;0;0;1;0;0;0;0;0;0;0;1;0;2;0;0;0;0;0;0;0;0;0;0;0;1;0;0
vda;0;0;11;0;0;0;0;6;0;2;0;0;0;0;4;8;0;5;3;0;0;0;0;4;0;0;0;4;0;0;0;6;0;4;10;0;0;0;2;2;0;12;0;0;0;0;0;2;0;0;0;0;0;0;1;3;0;1;0;0;0;2;0;0
vma;0;0;2;0;0;0;0;0;0;0;0;0;0;0;3;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;3;0;1;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;2;0;0;0;0;0;2;0;1;0;0;0;1;0;0
yli;0;7;10;0;0;0;0;21;3;0;0;0;0;0;11;14;0;7;0;0;2;0;0;15;14;0;0;0;0;0;6;9;3;3;11;0;3;0;1;28;1;29;0;0;1;0;3;21;0;4;0;0;0;0;1;17;0;7;5;0;0;6;0;0
zro;5;7;13;0;1;0;0;9;7;0;1;0;0;0;7;9;9;4;1;0;9;0;0;1;0;0;0;3;0;0;0;0;8;10;3;0;6;0;0;11;4;15;0;0;0;0;3;10;0;6;0;0;0;0;0;11;0;3;2;0;3;4;0;0
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
Doublons 42;;fréquences;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;Lys;Asn;Lys;Asn;Thr;Thr;Thr;Thr;Arg;Ser;Arg;Ser;Ile;Ile;Met;Ile;Gln;His;Gln;His;Pro;Pro;Pro;Pro;Arg;Arg;Arg;Arg;Leu;Leu;Leu;Leu;Glu;Asp;Glu;Asp;Ala;Ala;Ala;Ala;Gly;Gly;Gly;Gly;Val;Val;Val;Val;Stp;Tyr;Stp;Tyr;Ser;Ser;Ser;Ser;SeC;Cys;Trp;Cys;Leu;Phe;Leu;Phe
critère;aaa;aac;aag;aat;aca;acc;acg;act;aga;agc;agg;agt;ata;atc;atg;att;caa;cac;cag;cat;cca;ccc;ccg;cct;cga;cgc;cgg;cgt;cta;ctc;ctg;ctt;gaa;gac;gag;gat;gca;gcc;gcg;gct;gga;ggc;ggg;ggt;gta;gtc;gtg;gtt;taa;tac;tag;tat;tca;tcc;tcg;tct;tga;tgc;tgg;tgt;tta;ttc;ttg;ttt
0;21;9;8;42;25;42;38;7;18;22;38;42;40;42;9;10;20;12;26;42;22;42;42;27;33;42;37;14;37;40;36;24;14;7;15;42;19;42;35;8;17;7;37;42;36;42;30;6;42;12;42;42;26;42;37;6;42;14;18;42;24;8;25;42
1;7;3;1;0;13;0;3;2;3;11;3;0;2;0;6;1;2;3;7;0;6;0;0;8;4;0;5;3;4;1;3;4;7;1;8;0;8;0;4;2;12;2;5;0;6;0;5;2;0;8;0;0;11;0;5;3;0;11;7;0;3;7;3;0
2;7;1;4;0;3;0;1;3;2;7;1;0;0;0;6;2;4;4;1;0;6;0;0;0;2;0;0;6;0;0;2;5;1;3;3;0;3;0;2;3;8;2;0;0;0;0;5;3;0;8;0;0;2;0;0;2;0;8;4;0;7;8;2;0
3;2;3;1;0;1;0;0;3;1;2;0;0;0;0;5;2;4;9;3;0;3;0;0;1;0;0;0;8;1;0;0;3;5;2;2;0;8;0;1;0;2;2;0;0;0;0;2;3;0;3;0;0;3;0;0;5;0;6;7;0;2;5;5;0
4;1;6;0;0;0;0;0;2;2;0;0;0;0;0;4;2;1;5;2;0;1;0;0;3;2;0;0;3;0;1;0;0;2;2;1;0;2;0;0;3;3;2;0;0;0;0;0;3;0;5;0;0;0;0;0;3;0;1;2;0;0;6;3;0
5;3;5;1;0;0;0;0;4;5;0;0;0;0;0;5;2;4;3;0;0;2;0;0;1;0;0;0;0;0;0;0;2;0;5;2;0;0;0;0;4;0;0;0;0;0;0;0;2;0;1;0;0;0;0;0;5;0;1;4;0;1;4;1;0
6;1;3;4;0;0;0;0;6;2;0;0;0;0;0;0;5;2;3;3;0;1;0;0;0;0;0;0;1;0;0;1;1;1;1;1;0;2;0;0;5;0;1;0;0;0;0;0;3;0;3;0;0;0;0;0;7;0;0;0;0;1;2;1;0
7;0;4;5;0;0;0;0;4;2;0;0;0;0;0;2;2;2;3;0;0;0;0;0;0;0;0;0;1;0;0;0;1;4;4;1;0;0;0;0;5;0;3;0;0;0;0;0;2;0;1;0;0;0;0;0;2;0;1;0;0;0;0;1;0
8;0;3;5;0;0;0;0;3;1;0;0;0;0;0;3;5;2;0;0;0;0;0;0;1;0;0;0;3;0;0;0;0;3;3;4;0;0;0;0;1;0;0;0;0;0;0;0;2;0;1;0;0;0;0;0;3;0;0;0;0;2;1;0;0
9;0;3;0;0;0;0;0;4;3;0;0;0;0;0;1;4;1;0;0;0;1;0;0;0;0;0;0;1;0;0;0;1;0;3;1;0;0;0;0;2;0;2;0;0;0;0;0;3;0;0;0;0;0;0;0;1;0;0;0;0;0;1;0;0
10;0;1;2;0;0;0;0;2;3;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;3;1;0;0;0;0;4;0;6;0;0;0;0;0;5;0;0;0;0;0;0;0;1;0;0;0;0;1;0;0;0
11;0;0;3;0;0;0;0;1;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;2;0;1;0;0;0;0;3;0;2;0;0;0;0;0;3;0;0;0;0;0;0;0;1;0;0;0;0;1;0;0;0
12;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;2;2;0;0;0;0;0;0;3;0;0;0;0;0;1;0;0;0;0;0;0;0;1;0;0;0;0;0;0;1;0
13;0;0;6;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;4;0;0;0;0;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0
14;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
15;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;3;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
16;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;1;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
17;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0
18;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
19;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
20;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
21;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
22;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
23;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
24;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
25;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
26;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
27;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
28;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
29;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
30;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
31;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
32;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
33;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
34;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
35;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
36;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
37;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
38;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
39;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
40;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
41;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
42;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
43;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
44;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
45;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
46;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
47;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
48;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
49;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
50;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
51;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
52;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
53;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
54;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
55;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
56;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
57;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
58;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
59;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
60;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0

Tableaux pour les diagrammes des simples, E79-C42[modifier | modifier le wikicode]

;Phe;;Leu;;;;Leu;;;;;;Ile;;;;Met;;Val;;;;;;;;Ser;;;;;;Pro;;;;;;Thr;;;;;;Ala;;;;;;;;Tyr;;Stp;;;;His;;Gln;;;;Asn;;Lys;;;;Asp;;Glu;;;;;;Cys;;SeC;;Trp;;Arg;;;;;;Ser;;Arg;;;;Gly;;;;;
critère;s79-ttc;s42-ttc;s79-tta;s42-tta;s79-ttg;s42-ttg;s79-ctt;s42-ctt;s79-cta;s42-cta;s79-ctg;s42-ctg;s79-att;s42-att;s79-ata;s42-ata;s79-atg;s42-atg;s79-gtt;s42-gtt;s79-gta;s42-gta;s79-gtg;s42-gtg;;critère;s79-tct;s42-tct;s79-tca;s42-tca;s79-tcg;s42-tcg;s79-cct;s42-cct;s79-cca;s42-cca;s79-ccg;s42-ccg;s79-act;s42-act;s79-aca;s42-aca;s79-acg;s42-acg;s79-gct;s42-gct;s79-gca;s42-gca;s79-gcg;s42-gcg;;critère;s79-tac;s42-tac;s79-taa;s42-taa;s79-tag;s42-tag;s79-cac;s42-cac;s79-caa;s42-caa;s79-cag;s42-cag;s79-aac;s42-aac;s79-aaa;s42-aaa;s79-aag;s42-aag;s79-gac;s42-gac;s79-gaa;s42-gaa;s79-gag;s42-gag;;critère;s79-tgc;s42-tgc;s79-tga;s42-tga;s79-tgg;s42-tgg;s79-cgt;s42-cgt;s79-cga;s42-cga;s79-cgg;s42-cgg;s79-agc;s42-agc;s79-aga;s42-aga;s79-agg;s42-agg;s79-ggc;s42-ggc;s79-gga;s42-gga;s79-ggg;s42-ggg
0;1;0;0;3;1;4;0;11;3;6;0;11;0;0;1;1;0;0;0;0;0;2;1;0;;0;2;0;0;0;0;0;0;4;0;1;0;21;1;0;0;0;2;1;0;0;1;0;0;16;;0;0;0;;;;;1;0;0;0;0;0;0;0;1;1;1;1;0;0;0;0;0;0;;0;1;2;16;2;1;2;1;0;0;20;8;4;1;1;0;2;1;1;1;0;0;0;4;3
1;6;7;4;24;3;10;13;9;9;14;8;14;6;18;6;28;0;0;3;8;12;23;5;23;;1;7;20;4;24;13;20;24;21;8;9;37;10;4;14;3;18;7;24;3;20;6;18;4;10;;1;1;6;;;;;17;19;6;10;3;22;7;11;4;9;2;14;4;18;4;10;7;19;;1;3;15;32;12;5;12;5;12;6;9;8;27;1;10;2;18;4;27;5;24;4;14;12;25
2;5;5;4;12;2;6;14;10;7;15;15;3;15;7;7;10;2;11;10;17;9;16;13;10;;2;6;5;9;10;7;11;16;1;10;9;18;8;3;11;8;12;11;14;6;7;4;15;13;11;;2;3;7;;;;;9;7;8;16;4;8;5;12;7;15;8;8;4;8;4;18;8;6;;2;2;14;12;9;5;9;11;17;8;6;19;10;7;9;1;14;6;7;10;7;18;14;12;10
3;8;3;17;2;9;9;19;1;15;5;13;5;9;1;8;3;3;2;11;8;9;1;12;7;;3;16;7;12;8;21;11;7;1;19;8;8;2;8;4;11;12;12;3;4;4;1;5;15;4;;3;0;7;;;;;12;4;13;10;10;3;3;5;3;11;3;5;10;4;6;7;11;3;;3;5;6;6;8;9;8;18;4;11;2;23;1;12;10;11;6;8;5;9;2;11;8;11;2
4;10;10;15;0;11;2;6;4;19;1;14;7;6;2;10;0;6;8;10;1;10;0;7;1;;4;14;6;10;0;16;0;10;7;7;3;5;1;3;7;9;0;15;0;3;1;6;1;18;0;;4;1;10;;;;;11;3;6;3;5;4;7;4;3;3;3;4;11;1;11;1;8;1;;4;4;4;6;6;10;6;16;2;17;1;4;0;10;2;6;1;18;2;5;0;11;2;5;0
5;14;7;8;0;6;6;8;2;13;1;9;0;5;5;16;0;5;8;9;1;11;0;8;1;;5;12;1;15;0;8;0;8;1;6;3;5;0;5;3;11;0;12;0;2;0;10;2;9;1;;5;3;4;;;;;8;5;5;3;10;1;9;4;7;0;6;3;6;2;6;5;5;2;;5;5;1;1;2;9;2;12;2;12;0;4;0;9;4;9;1;13;0;12;2;6;2;13;0
6;7;1;4;0;10;1;4;2;5;0;6;1;8;2;8;0;6;6;6;3;7;0;8;0;;6;5;2;8;0;6;0;2;6;6;2;2;0;12;1;12;0;2;0;3;0;8;1;5;0;;6;2;3;;;;;2;2;4;0;10;2;4;3;7;2;3;1;7;4;6;1;3;1;;6;3;0;0;1;7;1;3;3;5;1;6;0;13;4;24;0;7;0;9;1;5;1;3;1
7;4;5;4;1;13;2;2;1;1;0;3;1;4;2;8;0;5;3;11;1;5;0;2;0;;7;2;1;6;0;3;0;2;0;5;3;0;0;14;2;6;0;8;0;3;3;9;0;2;0;;7;3;3;;;;;2;2;7;0;9;0;5;0;6;1;9;2;6;1;6;0;6;1;;7;1;0;0;1;11;1;3;1;6;2;1;0;7;2;2;0;5;0;3;0;4;0;2;1
8;6;1;5;0;6;0;1;0;0;0;3;0;5;3;4;0;7;2;4;2;3;0;4;0;;8;2;0;2;0;0;0;1;0;3;2;0;0;5;0;6;0;1;0;5;1;4;0;2;0;;8;5;0;;;;;5;0;8;0;7;0;3;1;5;0;1;0;4;2;2;0;3;1;;8;1;0;0;1;1;1;2;0;2;0;0;0;4;0;1;0;1;0;2;1;1;0;1;0
9;1;1;3;0;3;1;1;0;0;0;1;0;6;0;1;0;3;1;2;1;2;0;3;0;;9;5;0;5;0;1;0;2;1;2;1;1;0;5;0;2;0;2;0;2;4;6;0;0;0;;9;7;0;;;;;3;0;1;0;0;0;5;1;2;0;6;3;3;0;8;0;4;3;;9;3;0;0;0;4;0;1;0;1;0;0;0;2;0;5;0;1;0;7;1;2;0;1;0
10;2;0;2;0;6;1;2;0;1;0;1;0;2;0;0;0;3;1;0;0;1;0;1;0;;10;1;0;1;0;1;0;1;0;4;0;0;0;3;0;1;0;3;0;5;0;3;0;0;0;;10;7;1;;;;;1;0;2;0;5;1;2;0;1;0;3;0;3;1;3;0;2;1;;10;5;0;0;0;3;0;3;0;1;0;0;0;2;0;2;0;1;0;3;0;0;1;0;0
11;1;1;3;0;0;0;0;0;1;0;0;0;1;0;1;0;6;0;3;0;0;0;3;0;;11;1;0;0;0;0;0;1;0;1;0;0;0;1;0;0;0;0;0;5;0;3;0;1;0;;11;7;1;;;;;0;0;2;0;1;0;2;0;4;0;5;0;2;0;2;0;1;1;;11;3;0;0;0;1;0;0;1;1;1;2;0;1;0;0;0;0;0;1;1;2;0;2;0
12;2;0;3;0;3;0;0;1;1;0;0;0;1;1;0;0;2;0;1;0;0;0;0;0;;12;0;0;0;0;0;0;1;0;1;0;1;0;1;0;1;0;1;0;1;0;4;0;0;0;;12;2;0;;;;;1;0;3;0;0;0;1;0;0;0;2;0;4;0;2;0;0;2;;12;3;0;0;0;2;0;1;0;1;0;1;0;2;0;1;0;1;0;0;1;1;0;0;0
13;3;0;2;0;0;0;2;0;0;0;1;0;1;0;2;0;5;0;2;0;1;0;2;0;;13;0;0;1;0;1;0;0;0;0;1;0;0;3;0;0;0;0;0;4;2;0;0;0;0;;13;6;0;;;;;1;0;2;0;0;0;4;1;5;0;0;0;2;0;3;0;0;0;;13;2;0;0;0;2;0;1;0;0;0;1;0;1;0;0;0;1;0;1;1;0;0;0;0
14;1;0;1;0;2;0;1;0;1;0;0;0;0;0;0;0;6;0;1;0;0;0;0;0;;14;2;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;1;0;4;0;1;0;1;0;;14;5;0;;;;;1;0;1;0;4;0;3;0;3;0;2;0;3;0;0;0;4;0;;14;5;0;0;0;0;0;0;0;2;0;0;0;0;0;1;0;1;0;1;1;2;0;3;0
15;0;1;2;0;1;0;0;1;0;0;1;0;0;0;1;0;2;0;1;0;0;0;0;0;;15;0;0;2;0;0;0;0;0;1;0;0;0;2;0;0;0;0;0;0;0;0;0;2;0;;15;2;0;;;;;0;0;2;0;0;1;1;0;2;0;1;0;1;0;2;0;1;0;;15;4;0;0;0;0;0;0;0;2;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0
16;0;0;0;0;1;0;0;0;0;0;0;0;0;0;3;0;1;0;2;0;2;0;0;0;;16;0;0;1;0;0;0;0;0;0;0;0;0;2;0;2;0;0;0;7;0;0;0;1;0;;16;2;0;;;;;1;0;0;0;3;0;1;0;0;0;2;0;1;0;0;0;1;1;;16;2;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0
17;0;0;0;0;0;0;0;0;0;0;0;0;2;1;0;0;1;0;0;0;0;0;0;0;;17;1;0;0;0;1;0;0;0;1;0;1;0;2;0;3;0;0;0;3;0;1;0;1;0;;17;3;0;;;;;0;0;1;0;0;0;1;0;1;0;0;0;0;0;2;0;0;0;;17;1;0;1;0;1;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0
18;3;0;0;0;0;0;3;0;1;0;0;0;1;0;0;0;1;0;0;0;1;0;0;0;;18;1;0;0;0;0;0;2;0;1;0;0;0;0;0;0;0;0;0;3;0;1;0;0;0;;18;2;0;;;;;1;0;1;0;0;0;5;0;0;0;1;0;0;0;1;0;1;0;;18;2;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0
19;1;0;1;0;0;0;0;0;0;0;1;0;1;0;1;0;1;0;1;0;3;0;2;0;;19;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;3;0;1;0;1;0;;19;3;0;;;;;1;0;0;0;0;0;1;0;0;0;3;0;0;0;0;0;2;0;;19;6;0;0;0;1;0;0;0;0;0;0;0;1;0;1;0;0;0;0;0;0;0;1;0
20;1;0;0;0;0;0;0;0;1;0;1;0;0;0;1;0;2;0;0;0;0;0;0;0;;20;1;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;1;0;1;0;2;0;;20;1;0;;;;;1;0;0;0;2;0;2;0;1;0;1;0;1;0;0;0;0;0;;20;5;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0
21;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;;21;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;0;;21;1;0;;;;;0;0;1;0;1;0;2;0;1;0;1;0;0;0;0;0;0;0;;21;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;2;0;0;0
22;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;22;1;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;;22;1;0;;;;;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;;22;0;0;0;0;1;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0
23;1;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;0;0;;23;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;;23;1;0;;;;;0;0;0;0;2;0;0;0;1;0;4;0;0;0;0;0;0;0;;23;3;0;0;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0
24;1;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;;24;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;;24;0;0;;;;;0;0;0;0;0;0;1;0;0;0;1;1;0;0;2;0;0;0;;24;1;0;1;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;1;0;0;0
25;1;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;1;0;;25;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;25;1;0;;;;;0;0;0;0;0;0;0;0;2;0;2;0;0;1;0;0;1;0;;25;1;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;1;0;1;0;0;0;0;0
26;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;0;;26;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;26;1;0;;;;;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;;26;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0
27;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;;27;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;27;0;0;;;;;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;27;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;0;0;0
28;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;;28;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;28;1;0;;;;;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;;28;1;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0
29;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;;29;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;29;2;0;;;;;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;29;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
30;0;0;0;0;1;0;0;0;0;0;0;0;1;0;0;0;2;0;0;0;0;0;0;0;;30;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;30;0;0;;;;;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;1;0;;30;2;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
31;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;;31;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;1;0;0;0;;31;1;0;;;;;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;;31;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0
32;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;32;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0;;32;0;0;;;;;0;0;0;0;1;0;1;0;1;0;0;0;0;0;0;0;0;0;;32;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0
33;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;33;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;;33;1;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;33;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
34;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;1;0;1;0;0;0;0;0;;34;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;34;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;;34;1;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0
35;0;0;1;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;;35;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;35;0;0;;;;;0;0;1;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;35;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0
36;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;;36;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;;36;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;36;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
37;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;;37;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;;37;0;0;;;;;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;;37;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0
38;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;;38;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;38;1;0;;;;;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;1;0;;38;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
39;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;;39;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;;39;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;;39;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
40;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;40;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;40;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;40;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
41;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;41;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;;41;0;0;;;;;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;1;0;;41;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
42;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;42;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;;42;0;0;;;;;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;42;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
43;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;43;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;;43;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;43;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
44;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;44;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;44;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;44;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;0;0;0;1;0;0;0
45;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;45;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;45;0;0;;;;;0;0;0;0;1;0;0;0;1;0;0;0;0;0;0;0;0;0;;45;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
46;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;46;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;46;0;0;;;;;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;;46;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0
47;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;47;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;;47;1;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;47;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
48;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;;48;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;48;1;0;;;;;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;1;0;;48;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0
49;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;49;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;49;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;49;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
50;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;50;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;;50;1;0;;;;;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;;50;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
51;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;51;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;51;0;0;;;;;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;51;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0
52;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;52;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;52;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;52;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0
53;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;53;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;53;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;53;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;0;0;0;0;0;0;0
54;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;54;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;54;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;54;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0
55;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;55;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;55;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;55;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0
56;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;56;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;56;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;56;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
57;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;57;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;57;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;;57;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
58;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;58;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;58;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;58;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
59;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;59;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;59;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;;59;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0
60;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;60;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;60;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;60;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0

Tableaux pour les diagrammes des doublons, E79-C42[modifier | modifier le wikicode]

;Phe;;Leu;;;;Leu;;;;;;Ile;;;;Met;;Val;;;;;;;;Ser;;;;;;Pro;;;;;;Thr;;;;;;Ala;;;;;;;;Tyr;;Stp;;;;His;;Gln;;;;Asn;;Lys;;;;Asp;;Glu;;;;;;Cys;;SeC;;Trp;;Arg;;;;;;Ser;;Arg;;;;Gly;;;;;
critère;d79-ttc;d42-ttc;d79-tta;d42-tta;d79-ttg;d42-ttg;d79-ctt;d42-ctt;d79-cta;d42-cta;d79-ctg;d42-ctg;d79-att;d42-att;d79-ata;d42-ata;d79-atg;d42-atg;d79-gtt;d42-gtt;d79-gta;d42-gta;d79-gtg;d42-gtg;;critère;d79-tct;d42-tct;d79-tca;d42-tca;d79-tcg;d42-tcg;d79-cct;d42-cct;d79-cca;d42-cca;d79-ccg;d42-ccg;d79-act;d42-act;d79-aca;d42-aca;d79-acg;d42-acg;d79-gct;d42-gct;d79-gca;d42-gca;d79-gcg;d42-gcg;;critère;d79-tac;d42-tac;d79-taa;d42-taa;d79-tag;d42-tag;d79-cac;d42-cac;d79-caa;d42-caa;d79-cag;d42-cag;d79-aac;d42-aac;d79-aaa;d42-aaa;d79-aag;d42-aag;d79-gac;d42-gac;d79-gaa;d42-gaa;d79-gag;d42-gag;;critère;d79-tgc;d42-tgc;d79-tga;d42-tga;d79-tgg;d42-tgg;d79-cgt;d42-cgt;d79-cga;d42-cga;d79-cgg;d42-cgg;d79-agc;d42-agc;d79-aga;d42-aga;d79-agg;d42-agg;d79-ggc;d42-ggc;d79-gga;d42-gga;d79-ggg;d42-ggg
0;2;8;46;24;54;25;7;24;49;37;4;36;1;10;55;40;1;9;4;6;31;36;5;30;;0;6;6;44;26;44;37;2;27;6;22;10;42;7;7;17;25;50;38;1;8;21;19;23;35;;0;34;12;;;;;4;12;14;20;3;26;1;9;3;21;2;8;1;7;6;14;3;15;;0;3;14;76;42;7;18;5;14;29;33;40;37;4;22;51;18;20;38;1;7;3;17;12;37
1;3;7;17;3;10;3;3;4;10;4;9;3;2;1;5;2;0;6;7;2;20;6;3;5;;1;3;3;12;11;16;5;2;8;10;6;13;0;10;2;27;13;5;3;3;2;15;8;27;4;;1;14;8;;;;;1;3;16;2;3;7;1;3;2;7;3;1;2;1;5;7;3;8;;1;0;11;1;0;12;7;5;3;16;4;16;5;5;11;9;3;30;3;0;2;3;12;21;5
2;4;8;7;7;2;2;10;5;6;0;18;2;3;2;5;0;3;6;8;3;16;0;10;5;;2;6;2;4;2;2;0;5;0;14;6;28;0;20;3;8;3;8;1;6;3;10;3;9;2;;2;9;8;;;;;4;4;19;4;8;1;3;1;5;7;2;4;3;3;11;1;4;3;;2;5;8;0;0;14;4;9;6;12;2;14;0;12;7;5;2;10;1;1;2;14;8;17;0
3;3;5;3;2;2;5;16;3;2;1;13;0;2;2;4;0;1;5;10;3;3;0;12;2;;3;5;5;3;3;6;0;3;1;12;3;16;0;9;3;6;1;5;0;9;0;9;8;4;1;;3;8;3;;;;;3;9;10;4;11;3;1;3;10;2;4;1;3;2;10;5;11;2;;3;2;6;2;0;13;7;13;8;5;0;5;0;12;2;2;1;0;0;2;2;6;2;9;0
4;14;6;3;0;2;3;13;0;3;0;5;0;6;2;1;0;2;4;12;3;2;0;9;0;;4;7;3;4;0;5;0;6;3;10;1;4;0;8;2;5;0;4;0;11;3;2;2;4;0;;4;4;5;;;;;10;5;2;1;19;2;3;6;15;1;8;0;5;2;6;2;5;1;;4;5;1;0;0;2;2;16;3;6;2;3;0;13;0;1;2;4;0;2;2;5;3;8;0
5;12;4;1;1;1;1;11;2;2;0;8;0;12;2;2;0;4;5;7;2;3;0;6;0;;5;14;5;2;0;1;0;12;1;4;2;2;0;0;4;4;0;1;0;6;4;1;0;1;0;;5;0;1;;;;;6;3;1;4;9;0;7;5;10;3;6;1;7;5;9;0;7;2;;5;11;1;0;0;5;4;8;0;2;0;0;0;4;0;2;5;4;0;7;0;13;0;1;0
6;7;2;0;1;3;1;4;1;4;0;5;1;12;5;2;0;6;0;4;3;0;0;8;0;;6;13;7;4;0;0;0;11;0;6;1;0;0;4;6;2;0;1;0;1;5;3;2;2;0;;6;0;3;;;;;7;3;1;2;6;3;4;3;7;1;5;4;10;1;4;1;8;1;;6;6;0;0;0;3;0;1;1;3;0;0;0;9;0;1;2;2;0;7;1;10;0;3;0
7;2;0;0;0;0;1;1;1;1;0;5;0;7;2;1;0;10;2;5;2;1;0;9;0;;7;5;2;2;0;1;0;9;0;2;0;2;0;8;4;1;0;1;0;7;5;5;0;1;0;;7;3;1;;;;;9;3;1;2;5;0;6;4;5;0;6;5;6;4;4;4;5;1;;7;2;1;0;0;4;0;1;1;1;0;0;0;7;0;1;2;4;0;10;3;5;0;1;0
8;5;1;0;2;0;0;0;0;0;0;5;0;5;5;1;0;11;3;4;2;0;0;5;0;;8;7;3;0;0;0;0;7;1;3;0;0;0;3;3;1;0;1;0;2;1;3;0;1;0;;8;0;1;;;;;9;0;1;2;8;0;10;3;4;0;5;5;3;3;3;3;6;4;;8;6;0;0;0;1;0;2;3;0;0;0;0;1;0;1;1;0;0;7;0;1;0;1;0
9;4;1;0;0;1;0;1;1;0;0;0;0;3;4;0;0;5;1;2;3;0;0;3;0;;9;1;1;0;0;0;0;4;0;0;1;0;0;1;4;2;0;0;0;3;2;1;0;2;0;;9;0;0;;;;;5;0;1;1;0;0;11;3;2;0;2;0;5;3;2;0;2;1;;9;7;0;0;0;3;0;2;1;1;0;0;0;1;0;2;3;0;0;7;2;1;0;1;0
10;3;0;0;1;1;0;0;0;0;0;2;0;4;2;0;0;3;0;1;5;0;0;1;0;;10;2;1;2;0;1;0;4;0;0;0;1;0;1;2;1;0;0;0;4;4;1;0;0;0;;10;1;0;;;;;5;0;4;0;1;0;10;1;2;0;6;2;2;3;3;0;2;1;;10;5;0;0;0;3;0;1;1;0;0;0;0;3;0;2;3;1;0;5;6;3;0;0;0
11;3;0;1;1;0;0;3;1;0;0;0;0;0;1;0;0;5;1;4;3;1;0;1;0;;11;1;1;0;0;0;0;5;0;0;0;0;0;0;1;1;0;1;0;2;3;0;0;1;0;;11;0;0;;;;;1;0;1;0;1;0;3;0;1;0;3;3;3;0;1;2;1;1;;11;2;0;0;0;2;0;3;0;1;0;0;0;0;0;0;0;0;0;3;2;1;0;1;0
12;2;0;0;0;1;1;0;0;0;0;0;0;4;2;0;0;2;0;1;1;0;0;1;0;;12;2;1;0;0;0;0;1;0;0;0;1;0;0;0;1;0;0;0;1;0;1;0;0;0;;12;0;0;;;;;1;0;0;0;0;0;2;0;0;0;3;1;5;2;3;2;2;2;;12;2;0;0;0;3;0;2;0;0;0;0;0;2;0;0;0;1;0;2;3;1;0;0;0
13;3;0;0;0;0;0;1;0;0;0;1;0;3;1;1;0;1;0;1;1;0;0;1;0;;13;0;1;0;0;1;0;2;0;2;0;1;0;0;0;0;0;0;0;3;0;2;0;0;0;;13;1;0;;;;;1;0;1;0;1;0;0;0;2;0;4;6;1;4;2;0;3;0;;13;5;0;0;0;1;0;1;0;0;0;1;0;0;0;0;0;0;0;3;1;1;0;0;0
14;0;0;0;0;1;0;1;0;0;0;1;0;5;1;0;0;3;0;0;0;0;0;0;0;;14;3;0;0;0;0;0;1;0;0;0;0;0;2;0;0;0;1;0;3;0;0;0;0;0;;14;0;0;;;;;3;0;0;0;0;0;2;0;2;0;2;0;3;1;1;1;3;0;;14;2;0;0;0;1;0;1;0;0;1;0;0;3;0;0;0;0;0;2;2;0;0;0;0
15;1;0;0;0;0;0;1;0;1;0;0;0;1;0;0;0;1;0;2;1;0;0;0;0;;15;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;1;0;1;0;0;0;1;0;;15;0;0;;;;;2;0;1;0;0;0;0;0;2;0;5;0;1;0;1;0;0;0;;15;1;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;1;3;0;0;0;0
16;3;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;4;0;0;0;0;0;1;0;;16;1;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;3;1;1;0;0;0;;16;0;0;;;;;2;0;1;0;0;0;3;0;0;0;1;0;1;1;1;0;2;0;;16;1;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;3;1;1;0;0;0
17;2;0;0;0;0;0;0;0;0;0;1;0;1;0;0;0;0;0;1;0;1;0;0;0;;17;0;1;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;;17;0;0;;;;;1;0;0;0;0;0;4;0;2;0;0;0;1;0;0;0;2;0;;17;1;0;0;0;0;0;3;0;1;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0
18;1;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0;3;0;1;1;0;0;0;0;;18;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;;18;0;0;;;;;2;0;0;0;0;0;0;0;0;0;0;0;2;0;1;0;0;0;;18;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;2;0;1;0;0;0
19;1;0;0;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0;;19;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;1;0;0;0;0;0;;19;0;0;;;;;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;;19;1;0;0;0;1;0;0;1;0;0;0;0;0;0;0;0;0;0;4;0;2;0;0;0
20;1;0;0;0;0;0;1;0;0;0;0;0;1;0;0;0;2;0;0;0;0;0;0;0;;20;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;;20;1;0;;;;;0;0;1;0;0;0;2;0;1;0;2;1;3;0;0;0;1;0;;20;1;0;0;0;1;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
21;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;1;0;;21;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;2;0;1;0;0;0;;21;0;0;;;;;1;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;2;0;;21;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;1;0;1;0;0;0;0;0
22;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;;22;0;0;1;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;22;1;0;;;;;0;0;0;0;1;0;0;0;0;0;1;0;0;0;1;0;1;0;;22;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0
23;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;23;1;0;0;0;1;0;0;0;1;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;23;0;0;;;;;0;0;1;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;;23;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
24;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;1;0;0;0;0;0;;24;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;24;0;0;;;;;1;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;;24;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0
25;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;1;0;;25;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;25;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;25;1;0;0;0;0;0;1;0;1;0;0;0;0;0;0;0;1;0;1;0;1;0;0;0
26;0;0;0;0;0;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;;26;1;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;;26;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;26;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0
27;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;27;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;27;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;0;0;0;;27;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
28;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;28;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;;28;0;0;;;;;0;0;0;0;0;0;2;0;0;0;1;0;0;0;0;0;1;0;;28;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0
29;0;0;1;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;;29;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;0;0;1;0;0;0;;29;0;0;;;;;0;0;1;0;0;0;0;0;0;0;0;0;1;0;1;0;0;0;;29;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;1;0
30;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;30;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;30;0;0;;;;;0;0;0;0;1;0;1;0;1;0;2;0;1;0;1;0;0;0;;30;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0
31;0;0;0;0;0;0;1;0;0;0;0;0;1;0;0;0;2;0;0;0;0;0;0;0;;31;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;31;0;0;;;;;0;0;0;0;0;0;1;0;0;0;0;0;1;0;0;0;1;0;;31;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
32;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;;32;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;32;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;;32;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
33;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;33;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;33;0;0;;;;;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;33;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0
34;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;34;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;34;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;;34;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0
35;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;35;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;35;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;35;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
36;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;36;0;0;0;0;0;0;1;0;1;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;;36;0;0;;;;;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;;36;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0
37;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;1;0;;37;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;37;0;0;;;;;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;;37;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
38;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;38;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;38;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;38;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
39;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;39;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;39;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;39;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
40;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;40;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;40;1;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;40;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;1;0;0;0
41;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;41;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;;41;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;41;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
42;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;;42;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;42;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;42;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
43;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;;43;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;43;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;43;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0
44;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;44;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;44;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;44;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
45;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;;45;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;45;0;0;;;;;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;;45;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
46;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;1;0;;46;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;46;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;46;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
47;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;;47;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;47;0;0;;;;;0;0;1;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;;47;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
48;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;48;0;0;0;0;0;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;;48;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;48;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
49;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;49;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;0;0;0;0;0;0;0;0;0;;49;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;49;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
50;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;50;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;50;1;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;50;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
51;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;51;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;51;0;0;;;;;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;;51;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
52;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;52;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;52;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;52;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0
53;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;53;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;53;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;53;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0
54;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;54;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;54;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;54;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
55;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;55;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;55;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;55;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
56;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;56;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;56;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;56;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
57;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;;57;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;57;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;57;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
58;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;58;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;58;0;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;58;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
59;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;59;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;59;1;0;;;;;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;59;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
60;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;60;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;60;0;0;;;;;0;0;0;0;1;0;0;0;0;0;0;0;0;0;1;0;0;0;;60;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0

Les indices de multiplicité dans les 3 domaines[modifier | modifier le wikicode]

Multiplicité Tableau I[modifier | modifier le wikicode]

bacilli;nombres;;672;;;;;;Bactéries;Nombres;;4032;;;;;;E79t-tg;;nombres;;db + diff;;79;!!!;;C42-tg;;nombres;;db + diff;;42;!!!
ttt;4;tct;2;tat;1;tgt;1;;ttt;10;tct;5;tat;4;tgt;3;;ttt;51;tct;920;tat;57;tgt;68;;ttt;2;tct;310;tat;2;tgt;1
ctt;290;cct;4;cat;1;cgt;1741;;ctt;369;cct;10;cat;4;cgt;7478;;ctt;857;cct;908;cat;36;cgt;884;;ctt;170;cct;155;cat;0;cgt;238
att;0;act;71;aat;2;agt;0;;att;5;act;103;aat;5;agt;1;;att;1238;act;1021;aat;75;agt;80;;att;378;act;332;aat;2;agt;0
gtt;1;gct;0;gat;0;ggt;0;;gtt;9;gct;2;gat;0;ggt;1;;gtt;1022;gct;1733;gat;76;ggt;80;;gtt;401;gct;389;gat;2;ggt;2
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
ttc;1642;tcc;723;tac;1440;tgc;710;;ttc;6105;tcc;4520;tac;6420;tgc;4473;;ttc;1195;tcc;86;tac;1310;tgc;1845;;ttc;296;tcc;1;tac;252;tgc;143
ctc;451;ccc;38;cac;1123;cgc;0;;ctc;3849;ccc;2742;cac;4715;cgc;333;;ctc;11;ccc;29;cac;1028;cgc;24;;ctc;18;ccc;1;cac;220;cgc;0
atc;1865;acc;559;aac;2286;agc;960;;atc;9203;acc;4513;aac;8764;agc;4422;;atc;71;acc;68;aac;1592;agc;910;;atc;6;acc;0;aac;297;agc;155
gtc;316;gcc;178;gac;2321;ggc;1874;;gtc;4430;gcc;4166;gac;9023;ggc;9273;;gtc;67;gcc;69;gac;1571;ggc;1411;;gtc;1;gcc;0;gac;409;ggc;487
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
tta;1252;tca;1459;taa;1;tga;6;;tta;4749;tca;5299;taa;12;tga;1315;;tta;592;tca;579;taa;75;tga;140;;tta;132;tca;92;taa;1;tga;12
cta;1204;cca;1463;caa;1803;cga;36;;cta;4940;cca;5453;caa;6388;cga;887;;cta;486;cca;995;caa;942;cga;609;;cta;75;cca;205;caa;196;cga;92
ata;13;aca;1771;aaa;2045;aga;726;;ata;55;aca;5878;aaa;9105;aga;4804;;ata;564;aca;716;aaa;1413;aga;682;;ata;59;aca;100;aaa;155;aga;207
gta;2397;gca;2677;gaa;2823;gga;1669;;gta;8859;gca;10185;gaa;9679;gga;5515;;gta;635;gca;1100;gaa;1176;gga;1041;;gta;64;gca;141;gaa;252;gga;146
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
ttg;752;tcg;309;tag;1;tgg;824;;ttg;3999;tcg;2622;tag;18;tgg;4366;;ttg;657;tcg;438;tag;81;tgg;936;;ttg;190;tcg;80;tag;1;tgg;173
ctg;370;ccg;115;cag;105;cgg;662;;ctg;5186;ccg;2183;cag;2389;cgg;3355;;ctg;711;ccg;405;cag;1095;cgg;369;;ctg;89;ccg;36;cag;149;cgg;55
atg;3527;acg;290;aag;447;agg;446;;atg;18026;acg;2760;aag;2427;agg;3452;;atg;2188;acg;480;aag;1627;agg;794;;atg;324;acg;66;aag;426;agg;69
gtg;5;gcg;53;gag;98;ggg;112;;gtg;1313;gcg;1224;gag;1388;ggg;2266;;gtg;1002;gcg;611;gag;1401;ggg;582;;gtg;94;gcg;60;gag;296;ggg;69
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
bacilli;Indices;;672;;;;;;Bactéries;Indices;;4032;;;;;;E79t-tg;;Indices;;db + diff;;79;!!!;;C42-tg;;Indices;;db + diff;;42;!!!
ttt;0.6;tct;0.3;tat;0.1;tgt;0.1;;ttt;0.2;tct;0.1;tat;0.1;tgt;0.1;;ttt;7.2;tct;131;tat;8.1;tgt;10;;ttt;1.1;tct;177;tat;1.1;tgt;0.6
ctt;43;cct;0.6;cat;0.1;cgt;259;;ctt;9.2;cct;0.2;cat;0.1;cgt;185;;ctt;122;cct;129;cat;5.1;cgt;126;;ctt;97;cct;89;cat;0;cgt;136
att;0;act;11;aat;0.3;agt;0;;att;0.1;act;2.6;aat;0.1;agt;0.0;;att;176;act;145;aat;11;agt;11;;att;216;act;190;aat;1.1;agt;0
gtt;0.1;gct;0;gat;0;ggt;0;;gtt;0.2;gct;0.0;gat;0;ggt;0.0;;gtt;145;gct;246;gat;11;ggt;11;;gtt;229;gct;222;gat;1.1;ggt;1.1
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
ttc;244;tcc;108;tac;214;tgc;106;;ttc;151;tcc;112;tac;159;tgc;111;;ttc;170;tcc;12;tac;186;tgc;262;;ttc;169;tcc;0.6;tac;144;tgc;82
ctc;67;ccc;5.7;cac;167;cgc;0;;ctc;95;ccc;68;cac;117;cgc;8.3;;ctc;1.6;ccc;4.1;cac;146;cgc;3.4;;ctc;10;ccc;0.6;cac;126;cgc;0
atc;278;acc;83;aac;340;agc;143;;atc;228;acc;112;aac;217;agc;110;;atc;10;acc;10;aac;226;agc;129;;atc;3.4;acc;0;aac;170;agc;89
gtc;47;gcc;26;gac;345;ggc;279;;gtc;110;gcc;103;gac;224;ggc;230;;gtc;10;gcc;10;gac;223;ggc;200;;gtc;0.6;gcc;0;gac;234;ggc;278
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
tta;186;tca;217;taa;0.1;tga;0.9;;tta;118;tca;131;taa;0.3;tga;33;;tta;84;tca;82;taa;11;tga;20;;tta;75;tca;53;taa;0.6;tga;6.9
cta;179;cca;218;caa;268;cga;5.4;;cta;123;cca;135;caa;158;cga;22;;cta;69;cca;141;caa;134;cga;87;;cta;43;cca;117;caa;112;cga;53
ata;1.9;aca;264;aaa;304;aga;108;;ata;1.4;aca;146;aaa;226;aga;119;;ata;80;aca;102;aaa;201;aga;97;;ata;34;aca;57;aaa;89;aga;118
gta;357;gca;398;gaa;420;gga;248;;gta;220;gca;253;gaa;240;gga;137;;gta;90;gca;156;gaa;167;gga;148;;gta;37;gca;81;gaa;144;gga;83
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
ttg;112;tcg;46;tag;0.1;tgg;123;;ttg;99;tcg;65;tag;0.4;tgg;108;;ttg;93;tcg;62;tag;12;tgg;133;;ttg;108;tcg;46;tag;0.6;tgg;99
ctg;55;ccg;17;cag;16;cgg;99;;ctg;129;ccg;54;cag;59;cgg;83;;ctg;101;ccg;58;cag;156;cgg;52;;ctg;51;ccg;21;cag;85;cgg;31
atg;525;acg;43;aag;67;agg;66;;atg;447;acg;68;aag;60;agg;86;;atg;311;acg;68;aag;231;agg;113;;atg;185;acg;38;aag;243;agg;39
gtg;0.7;gcg;7.9;gag;15;ggg;17;;gtg;33;gcg;30;gag;34;ggg;56;;gtg;142;gcg;87;gag;199;ggg;83;;gtg;54;gcg;34;gag;169;ggg;39

Multiplicité Tableau II[modifier | modifier le wikicode]

Archées;nombres;;184;;;;;;methanococci;;nombres;;16;;;;;alpha bactéries;;Nombres;;354;;;;;cyanobactéries;;Nombres;;83;;;
ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;2;tgt;0;;ttt;2;tct;0;tat;0;tgt;0
ctt;1;cct;0;cat;0;cgt;2;;ctt;0;cct;0;cat;0;cgt;0;;ctt;1;cct;1;cat;0;cgt;368;;ctt;14;cct;0;cat;2;cgt;91
att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0;;att;1;act;1;aat;3;agt;0
gtt;1;gct;0;gat;0;ggt;1;;gtt;0;gct;0;gat;0;ggt;0;;gtt;0;gct;0;gat;0;ggt;0;;gtt;0;gct;1;gat;0;ggt;0
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
ttc;215;tcc;190;tac;190;tgc;299;;ttc;16;tcc;16;tac;16;tgc;16;;ttc;362;tcc;343;tac;354;tgc;358;;ttc;99;tcc;85;tac;101;tgc;94
ctc;214;ccc;171;cac;185;cgc;187;;ctc;16;ccc;15;cac;16;cgc;16;;ctc;389;ccc;277;cac;348;cgc;0;;ctc;77;ccc;83;cac;91;cgc;1
atc;212;acc;189;aac;214;agc;187;;atc;16;acc;16;aac;16;agc;16;;atc;827;acc;360;aac;379;agc;345;;atc;161;acc;88;aac;97;agc;94
gtc;212;gcc;184;gac;218;ggc;243;;gtc;16;gcc;16;gac;25;ggc;16;;gtc;356;gcc;332;gac;511;ggc;448;;gtc;84;gcc;85;gac;100;ggc;92
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
tta;191;tca;184;taa;0;tga;18;;tta;16;tca;16;taa;0;tga;16;;tta;321;tca;345;taa;1;tga;32;;tta;69;tca;93;taa;2;tga;0
cta;185;cca;184;caa;196;cga;185;;cta;16;cca;16;caa;16;cga;17;;cta;349;cca;354;caa;377;cga;30;;cta;97;cca;97;caa;94;cga;2
ata;2;aca;198;aaa;197;aga;186;;ata;0;aca;16;aaa;25;aga;16;;ata;4;aca;353;aaa;354;aga;345;;ata;2;aca;96;aaa;97;aga;93
gta;186;gca;256;gaa;230;gga;189;;gta;17;gca;22;gaa;32;gga;17;;gta;358;gca;814;gaa;471;gga;351;;gta;90;gca;228;gaa;97;gga;91
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
ttg;163;tcg;152;tag;1;tgg;184;;ttg;0;tcg;0;tag;0;tgg;16;;ttg;298;tcg;268;tag;0;tgg;347;;ttg;91;tcg;87;tag;2;tgg;91
ctg;160;ccg;151;cag;165;cgg;139;;ctg;0;ccg;0;cag;0;cgg;0;;ctg;307;ccg;239;cag;221;cgg;358;;ctg;76;ccg;69;cag;11;cgg;83
atg;589;acg;169;aag;166;agg;165;;atg;56;acg;1.0;aag;0;agg;0;;atg;1536;acg;305;aag;263;agg;250;;atg;264;acg;84;aag;31;agg;64
gtg;170;gcg;159;gag;160;ggg;155;;gtg;7;gcg;0;gag;0;ggg;0;;gtg;196;gcg;196;gag;178;ggg;234;;gtg;35;gcg;68;gag;7;ggg;63
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
Archées;Indices;;184;;;;;;methanococci;;Indices;;16;;;;;alpha bactéries;;Indices;;354;;;;;cyanobactéries;;Indices;;83;;;
ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0.6;tgt;0;;ttt;2.4;tct;0;tat;0;tgt;0
ctt;0.5;cct;0;cat;0;cgt;1.1;;ctt;0;cct;0;cat;0;cgt;0;;ctt;0.3;cct;0.3;cat;0;cgt;104;;ctt;17;cct;0;cat;2.4;cgt;110
att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0;;att;1.2;act;1.2;aat;3.6;agt;0
gtt;0.5;gct;0;gat;0;ggt;0.5;;gtt;0;gct;0;gat;0;ggt;0;;gtt;0;gct;0;gat;0;ggt;0;;gtt;0;gct;1.2;gat;0;ggt;0
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
ttc;117;tcc;103;tac;103;tgc;163;;ttc;100;tcc;100;tac;100;tgc;100;;ttc;102;tcc;97;tac;100;tgc;101;;ttc;119;tcc;102;tac;122;tgc;113
ctc;116;ccc;93;cac;101;cgc;102;;ctc;100;ccc;94;cac;100;cgc;100;;ctc;110;ccc;78;cac;98;cgc;0;;ctc;93;ccc;100;cac;110;cgc;1.2
atc;115;acc;103;aac;116;agc;102;;atc;100;acc;100;aac;100;agc;100;;atc;234;acc;102;aac;107;agc;97;;atc;194;acc;106;aac;117;agc;113
gtc;115;gcc;100;gac;118;ggc;132;;gtc;100;gcc;100;gac;156;ggc;100;;gtc;101;gcc;94;gac;144;ggc;127;;gtc;101;gcc;102;gac;120;ggc;111
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
tta;104;tca;100;taa;0;tga;10;;tta;100;tca;100;taa;0;tga;100;;tta;91;tca;97;taa;0.3;tga;9.0;;tta;83;tca;112;taa;2.4;tga;0
cta;101;cca;100;caa;107;cga;101;;cta;100;cca;100;caa;100;cga;106;;cta;99;cca;100;caa;106;cga;8.5;;cta;117;cca;117;caa;113;cga;2.4
ata;1.1;aca;108;aaa;107;aga;101;;ata;0;aca;100;aaa;156;aga;100;;ata;1.1;aca;100;aaa;100;aga;97;;ata;2.4;aca;116;aaa;117;aga;112
gta;101;gca;139;gaa;125;gga;103;;gta;106;gca;138;gaa;200;gga;106;;gta;101;gca;230;gaa;133;gga;99;;gta;108;gca;275;gaa;117;gga;110
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
ttg;89;tcg;83;tag;0.5;tgg;100;;ttg;0;tcg;0;tag;0;tgg;100;;ttg;84;tcg;76;tag;0;tgg;98;;ttg;110;tcg;105;tag;2.4;tgg;110
ctg;87;ccg;82;cag;90;cgg;76;;ctg;0;ccg;0;cag;0;cgg;0;;ctg;87;ccg;68;cag;62;cgg;101;;ctg;92;ccg;83;cag;13;cgg;100
atg;320;acg;92;aag;90;agg;90;;atg;350;acg;6.3;aag;0;agg;0;;atg;434;acg;86;aag;74;agg;71;;atg;318;acg;101;aag;37;agg;77
gtg;92;gcg;86;gag;87;ggg;84;;gtg;44;gcg;0;gag;0;ggg;0;;gtg;55;gcg;55;gag;50;ggg;66;;gtg;42;gcg;82;gag;8.4;ggg;76

Cinq eucaryotes à effectifs élevés[modifier | modifier le wikicode]

cmkf;différents;;;db,dif;;;10269;;cmkb;double;;db,dif;;;;3402
ttt;2;tct;13;tat;0;tgt;0;;ttt;0;tct;12;tat;0;tgt;0
ctt;13;cct;10;cat;0;cgt;4;;ctt;6;cct;1;cat;0;cgt;4
att;22;act;16;aat;1;agt;−;;att;8;act;7;aat;0;agt;0
gtt;15;gct;55;gat;5;ggt;1;;gtt;6;gct;19;gat;0;ggt;0
ttc;24;tcc;0;tac;28;tgc;9;;ttc;10;tcc;0;tac;7;tgc;5
ctc;1;ccc;5;cac;26;cgc;−;;ctc;0;ccc;0;cac;10;cgc;0
atc;−;acc;11;aac;31;agc;22;;atc;0;acc;0;aac;16;agc;10
gtc;15;gcc;164;gac;34;ggc;6;;gtc;0;gcc;3;gac;14;ggc;12
tta;11;tca;50;taa;0;tga;2;;tta;1;tca;3;taa;0;tga;0
cta;17;cca;43;caa;5;cga;21;;cta;2;cca;7;caa;1;cga;3
ata;18;aca;156;aaa;37;aga;13;;ata;4;aca;49;aaa;5;aga;0
gta;115;gca;3 008;gaa;58;gga;43;;gta;29;gca;2 889;gaa;7;gga;22
ttg;29;tcg;47;tag;3;tgg;19;;ttg;1;tcg;0;tag;0;tgg;10
ctg;19;ccg;40;cag;9;cgg;1;;ctg;5;ccg;0;cag;8;cgg;0
atg;73;acg;132;aag;24;agg;6;;atg;20;acg;4;aag;11;agg;5
gtg;1 502;gcg;3 757;gag;405;ggg;73;;gtg;37;gcg;100;gag;22;ggg;7
;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;
;;;;;;;7113;;;;;;;;;
bacuf;;différents;;;db,dif;;6717;;bacub;;double;;db,dif;;;342
ttt;−;tct;6;tat;−;tgt;1;;ttt;0;tct;3;tat;0;tgt;0
ctt;1;cct;1;cat;−;cgt;5;;ctt;4;cct;5;cat;0;cgt;3
att;5;act;8;aat;−;agt;−;;att;6;act;4;aat;0;agt;0
gtt;8;gct;17;gat;18;ggt;10;;gtt;5;gct;2;gat;1;ggt;1
ttc;8;tcc;0;tac;13;tgc;18;;ttc;4;tcc;0;tac;0;tgc;5
ctc;−;ccc;−;cac;3;cgc;−;;ctc;0;ccc;0;cac;7;cgc;0
atc;0;acc;−;aac;6;agc;9;;atc;0;acc;0;aac;17;agc;3
gtc;0;gcc;−;gac;37;ggc;50;;gtc;0;gcc;0;gac;7;ggc;13
tta;11;tca;4;taa;23;tga;16;;tta;1;tca;0;taa;0;tga;0
cta;3;cca;2;caa;7;cga;7;;cta;0;cca;2;caa;2;cga;1
ata;7;aca;6;aaa;81;aga;54;;ata;0;aca;1;aaa;4;aga;0
gta;17;gca;41;gaa;2 320;gga;961;;gta;0;gca;0;gaa;47;gga;25
ttg;7;tcg;3;tag;8;tgg;242;;ttg;0;tcg;0;tag;0;tgg;13
ctg;3;ccg;1;cag;15;cgg;19;;ctg;3;ccg;2;cag;4;cgg;1
atg;12;acg;3;aag;23;agg;66;;atg;8;acg;0;aag;5;agg;0
gtg;23;gcg;18;gag;446;ggg;2 044;;gtg;8;gcg;1;gag;21;ggg;103
;;;;;;;;;;;;;;;;
;;;;;;;5873;;;;;;;;;
ttrf;;différents;;;db,dif;;5586;;ttrb;;double;;db,dif;;;231
ttt;−;tct;8;tat;0;tgt;4;;ttt;0;tct;3;tat;0;tgt;1
ctt;0;cct;2;cat;−;cgt;4;;ctt;5;cct;4;cat;0;cgt;2
att;5;act;6;aat;−;agt;−;;att;5;act;2;aat;0;agt;0
gtt;6;gct;13;gat;9;ggt;17;;gtt;1;gct;5;gat;0;ggt;1
ttc;7;tcc;−;tac;16;tgc;19;;ttc;4;tcc;0;tac;1;tgc;2
ctc;−;ccc;−;cac;4;cgc;0;;ctc;0;ccc;0;cac;4;cgc;0
atc;−;acc;0;aac;5;agc;7;;atc;0;acc;0;aac;7;agc;3
gtc;2;gcc;1;gac;43;ggc;36;;gtc;0;gcc;0;gac;5;ggc;6
tta;5;tca;5;taa;19;tga;20;;tta;0;tca;0;taa;0;tga;0
cta;3;cca;2;caa;11;cga;6;;cta;0;cca;2;caa;4;cga;0
ata;4;aca;4;aaa;69;aga;47;;ata;0;aca;1;aaa;4;aga;0
gta;15;gca;35;gaa;1 871;gga;813;;gta;0;gca;0;gaa;29;gga;19
ttg;6;tcg;3;tag;7;tgg;207;;ttg;0;tcg;0;tag;0;tgg;9
ctg;4;ccg;1;cag;7;cgg;11;;ctg;1;ccg;2;cag;7;cgg;0
atg;10;acg;2;aag;15;agg;52;;atg;6;acg;0;aag;3;agg;1
gtg;18;gcg;19;gag;386;ggg;1 695;;gtg;3;gcg;1;gag;8;ggg;70
;;;;;;;;;;;;;;;;
;;;;;;;4061;;;;;;;;;
btaf;;différents;;;db,dif;;3678;;btab;;double;;db,dif;;;320
ttt;5;tct;4;tat;10;tgt;133;;ttt;0;tct;8;tat;0;tgt;9
ctt;4;cct;1;cat;3;cgt;5;;ctt;6;cct;11;cat;0;cgt;7
att;3;act;9;aat;−;agt;3;;att;14;act;4;aat;0;agt;0
gtt;12;gct;18;gat;5;ggt;19;;gtt;7;gct;12;gat;0;ggt;0
ttc;17;tcc;27;tac;37;tgc;312;;ttc;12;tcc;4;tac;1;tgc;25
ctc;−;ccc;−;cac;4;cgc;6;;ctc;0;ccc;0;cac;14;cgc;0
atc;−;acc;0;aac;13;agc;10;;atc;0;acc;0;aac;16;agc;8
gtc;−;gcc;1;gac;32;ggc;54;;gtc;0;gcc;0;gac;9;ggc;8
tta;9;tca;6;taa;3;tga;28;;tta;0;tca;0;taa;0;tga;0
cta;4;cca;2;caa;17;cga;10;;cta;0;cca;6;caa;2;cga;1
ata;7;aca;7;aaa;67;aga;43;;ata;0;aca;2;aaa;10;aga;0
gta;18;gca;30;gaa;423;gga;384;;gta;2;gca;4;gaa;11;gga;6
ttg;13;tcg;6;tag;12;tgg;172;;ttg;0;tcg;0;tag;0;tgg;5
ctg;2;ccg;0;cag;31;cgg;12;;ctg;3;ccg;3;cag;8;cgg;3
atg;18;acg;6;aag;24;agg;113;;atg;16;acg;0;aag;15;agg;2
gtg;26;gcg;13;gag;160;ggg;1 265;;gtg;12;gcg;2;gag;3;ggg;29
;;;;;;;;;;;;;;;;
;;;;;;;3778;;;;;;;;;
fcaf;;différents;;;db,dif;;3561;;fcab;;double;;db,dif;;;158
ttt;0;tct;2;tat;−;tgt;0;;ttt;0;tct;5;tat;0;tgt;0
ctt;0;cct;1;cat;1;cgt;3;;ctt;5;cct;6;cat;0;cgt;5
att;1;act;5;aat;4;agt;1;;att;8;act;3;aat;0;agt;0
gtt;3;gct;13;gat;0;ggt;1;;gtt;4;gct;4;gat;0;ggt;0
ttc;7;tcc;0;tac;8;tgc;18;;ttc;4;tcc;0;tac;1;tgc;13
ctc;−;ccc;0;cac;7;cgc;8;;ctc;0;ccc;0;cac;8;cgc;0
atc;−;acc;−;aac;20;agc;7;;atc;0;acc;0;aac;7;agc;4
gtc;−;gcc;0;gac;1;ggc;2;;gtc;0;gcc;0;gac;7;ggc;7
tta;18;tca;12;taa;35;tga;17;;tta;0;tca;1;taa;1;tga;0
cta;32;cca;63;caa;776;cga;1 193;;cta;0;cca;4;caa;5;cga;7
ata;8;aca;11;aaa;44;aga;53;;ata;0;aca;1;aaa;5;aga;0
gta;5;gca;8;gaa;10;gga;45;;gta;0;gca;1;gaa;4;gga;2
ttg;7;tcg;4;tag;11;tgg;21;;ttg;0;tcg;0;tag;0;tgg;1
ctg;2;ccg;4;cag;44;cgg;23;;ctg;2;ccg;2;cag;2;cgg;0
atg;14;acg;8;aag;878;agg;51;;atg;9;acg;0;aag;8;agg;1
gtg;2;gcg;5;gag;40;ggg;4;;gtg;6;gcg;1;gag;3;ggg;1
;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;
;;;;;;;433;;;;;;;;;
hsa-18f;;dif,db;différents;;;;221;;hsa-18b;;dif,db;double;;;;164
ttt;−;tct;3;tat;0;tgt;−;;ttt;0;tct;5;tat;0;tgt;0
ctt;3;cct;1;cat;−;cgt;1;;ctt;5;cct;7;cat;0;cgt;5
att;9;act;5;aat;−;agt;−;;att;5;act;3;aat;0;agt;0
gtt;5;gct;15;gat;−;ggt;−;;gtt;4;gct;10;gat;0;ggt;0
ttc;4;tcc;−;tac;12;tgc;22;;ttc;5;tcc;0;tac;0;tgc;6
ctc;−;ccc;−;cac;0;cgc;−;;ctc;0;ccc;0;cac;8;cgc;0
atc;0;acc;−;aac;16;agc;5;;atc;2;acc;0;aac;8;agc;2
gtc;−;gcc;−;gac;2;ggc;4;;gtc;0;gcc;0;gac;10;ggc;9
tta;3;tca;3;taa;−;tga;1;;tta;0;tca;0;taa;0;tga;0
cta;2;cca;2;caa;3;cga;5;;cta;0;cca;4;caa;2;cga;0
ata;4;aca;5;aaa;7;aga;5;;ata;0;aca;0;aaa;4;aga;0
gta;3;gca;6;gaa;4;gga;3;;gta;1;gca;1;gaa;3;gga;5
ttg;6;tcg;3;tag;−;tgg;4;;ttg;0;tcg;0;tag;0;tgg;2
ctg;1;ccg;1;cag;6;cgg;1;;ctg;7;ccg;2;cag;6;cgg;2
atg;8;acg;4;aag;9;agg;4;;atg;11;acg;0;aag;5;agg;0
gtg;5;gcg;3;gag;1;ggg;2;;gtg;7;gcg;0;gag;6;ggg;2

Le processus des duplications excessives[modifier | modifier le wikicode]

Comparaison Zebrafisch, 121 Eucaryotes, Bactéries[modifier | modifier le wikicode]

IV 100;Nombres de tRNAs. 121 eucaryotes;;;;;55 830;;;;V 100;Danio rerio (Zebrafish) ;;;;12258;;;I 100;Nombres de tRNAs. 4032 bactéries ;;;;;235027;
ttt;57;tct;2,268;tat;64;tgt;57;;ttt;82;tct;2,741;tat;41;tgt;73;;ttt;4;tct;2;tat;2;tgt;1
c;2,617;c;68;c;2,900;c;3,690;;c;1,607;c;16;c;1,925;c;1,109;;c;2,598;c;1,923;c;2,732;c;1,903
a;1,146;a;1,281;a;;a;446;;a;596;a;1,705;a;;a;114;;a;2,021;a;2,255;a;−;a;560
g;1,422;g;987;g;;g;2,047;;g;1,966;g;653;g;;g;359;;g;1,702;g;1,116;g;−;g;1,858
ctt;1,797;cct;2,011;cat;48;cgt;2,065;;ctt;2,203;cct;2,570;cat;82;cgt;1,656;;ctt;157;cct;4;cat;2;cgt;3,182
c;39;c;30;c;2,219;c;34;;c;33;c;16;c;3,157;c;196;;c;1,638;c;1,167;c;2,006;c;142
a;1,005;a;2,228;a;2,137;a;1,256;;a;1,991;a;1,672;a;857;a;873;;a;2,102;a;2,320;a;2,718;a;377
g;1,440;g;853;g;2,234;g;767;;g;2,447;g;1,468;g;2,170;g;481;;g;2,207;g;929;g;1,016;g;1,427
att;3,032;act;2,572;aat;84;agt;52;;att;2,105;act;2,929;aat;196;agt;114;;att;2;act;44;aat;2;agt;0
c;73;c;50;c;3,328;c;2,266;;c;82;c;82;c;8,525;c;3,459;;c;3,916;c;1,920;c;3,729;c;1,881
a;1,209;a;1,567;a;3,367;a;2,038;;a;612;a;2,366;a;4,283;a;2,056;;a;23;a;2,501;a;3,874;a;2,044
g;4,267;g;987;g;3,928;g;1,693;;g;4,258;g;538;g;7,775;g;848;;g;7,670;g;1,174;g;1,033;g;1,469
gtt;2,531;gct;4,014;gat;73;ggt;48;;gtt;1,893;gct;751;gat;8;ggt;90;;gtt;4;gct;1;gat;0;ggt;0
c;95;c;63;c;3,817;c;3,613;;c;49;c;33;c;1,224;c;6,820;;c;1,885;c;1,773;c;3,839;c;3,946
a;1,189;a;2,286;a;2,606;a;2,409;;a;1,876;a;3,002;a;1,836;a;383;;a;3,769;a;4,334;a;4,118;a;2,347
g;1,940;g;1,261;g;3,190;g;1,137;;g;1,852;g;914;g;1,999;g;2,186;;g;559;g;521;g;591;g;964
;;;;;;;;;;;;;;;;;;;;;;;;;
IV100−V100;;;;;;;;;V100 − I100;;;;;;;;;IV100−I100. ;;% Processus E des 121 Eucaryotes.;;;;;
ttt;-30;tct;-17;tat;37;tgt;-22;;ttt;95;tct;30;tat;96;tgt;98;;ttt;93;tct;15;tat;97;tgt;98
c;39;c;76;c;34;c;70;;c;-38;c;87;c;-30;c;-42;;c;1;c;97;c;6;c;48
a;48;a;-25;a;;a;74;;a;-71;a;-24;a;;a;-80;;a;-43;a;-43;a;−;a;-20
g;-28;g;34;g;;g;82;;g;13;g;-42;g;;g;-81;;g;-16;g;-12;g;−;g;9
ctt;-18;cct;-22;cat;-41;cgt;20;;ctt;26;cct;55;cat;98;cgt;-48;;ctt;9;cct;42;cat;96;cgt;-35
c;17;c;46;c;-30;c;-83;;c;-79;c;74;c;36;c;28;;c;-75;c;86;c;10;c;-76
a;-50;a;25;a;60;a;30;;a;-5;a;-28;a;-68;a;57;;a;-52;a;-4;a;-21;a;70
g;-41;g;-42;g;3;g;37;;g;10;g;37;g;53;g;-66;;g;-35;g;-8;g;54;g;-46
att;31;act;-12;aat;-57;agt;-55;;att;-46;act;34;aat;99;agt;100;;att;-23;act;25;aat;97;agt;99
c;-10;c;-39;c;-61;c;-34;;c;97;c;46;c;56;c;46;;c;97;c;13;c;-11;c;17
a;49;a;-34;a;-21;a;-1;;a;96;a;-5;a;10;a;1;;a;98;a;-37;a;-13;a;0
g;0;g;45;g;-49;g;50;;g;-44;g;-54;g;87;g;-42;;g;-44;g;-16;g;74;g;13
gtt;25;gct;81;gat;89;ggt;-46;;gtt;0;gct;-58;gat;100;ggt;100;;gtt;26;gct;56;gat;100;ggt;99
c;48;c;48;c;68;c;-47;;c;92;c;97;c;-68;c;42;;c;96;c;99;c;-1;c;-8
a;-37;a;-24;a;30;a;84;;a;-50;a;-31;a;-55;a;-84;;a;-68;a;-47;a;-37;a;3
g;5;g;28;g;37;g;-48;;g;70;g;43;g;70;g;56;;g;71;g;59;g;81;g;15

Comparaison de Zebrafish aux eucaryotes à résonance[modifier | modifier le wikicode]

;fca;;&emsp ;;;bta;;&emsp ;;;ttr*;;&emsp ;;;bacu;;&emsp ;;;cmk;;&emsp ;;;zebra;
code;frq;rup;;code;frq;rup;;code;frq;rup;;code;frq;rup;;code;frq;rup;;code;frq;rup
tgc;32;3;;gac;42;5;;tgc;22;64;;gtg;32;31;;gga;66;14;;ctg;300;5
cta;33;33;;aga;44;43;;gca;36;19;;gca;42;7;;gct;75;8;;cct;315;7
gag;44;7;;ggc;63;24;;ggc;43;12;;gac;45;22;;ggg;81;16;;tct;336;7
cag;47;2;;aaa;78;49;;aga;48;2;;aga;55;16;;atg;94;46;;act;359;3
gga;48;4;;agg;116;23;;gac;49;10;;ggc;64;5;;acg;137;6;;gca;368;5
aaa;50;6;;tgt;143;15;;agg;54;37;;agg;67;28;;gta;145;16;;cac;387;10
agg;53;2;;gag;164;9;;aaa;74;193;;aaa;86;198;;gcc;168;23;;agc;424;23
aga;54;26;;tgg;178;90;;tgg;217;82;;tgg;256;83;;aca;206;108;;atg;522;1
cca;68;1050;;tgc;338;16;;gag;395;111;;gag;468;111;;gag;428;260;;aaa;525;59
caa;782;13;;gga;391;11;;gga;833;112;;gga;987;118;;gtg;1,540;151;;ggc;836;14
aag;887;35;;gaa;435;198;;ggg;1,766;8;;ggg;2,148;10;;gcg;3,858;53;;aag;953;10
cga;1,201;;;ggg;1,295;;;gaa;1,901;;;gaa;2,368;;;gca;5,898;;;aac;1,045;
&emsp ;;;;;;;;;;;;;;;;;;;;;;;
T;3729;;;;4040;;;;5845;;;;7080;;;;13727;;;;12258;
X;1201;;;;1295;;;;1901;;;;2368;;;;5898;;;;1045;
mpe;19;;;;23;;;;17;;;;20;;;;34;;;;221;
epe;17;;;;17;;;;16;;;;19;;;;21;;;;120;
% e/m;85;;;;74;;;;96;;;;96;;;;63;;;;55;
xpe;68;;;;78;;;;74;;;;86;;;;94;;;;525;
X/mpe;62;;;;57;;;;114;;;;119;;;;174;;;;5;
X/xpe;18;;;;17;;;;26;;;;28;;;;63;;;;2;
sre;2870;;;;3060;;;;5112;;;;6227;;;;12380;;;;2834;
spe;859;;;;980;;;;733;;;;853;;;;1347;;;;9424;
faibles;3;;;;10;;;;4;;;;3;;;;8;;;;0;
minpe;5;;;;4;;;;3;;;;4;;;;2;;;;44;

Zebrafish, distributions des tRNAs sur les chromosomes[modifier | modifier le wikicode]

max;;;11;25;58;920;108;12;29;50;56;8;5;51;15;4;46;11;28;40;3;201;357;187;2;18;21;;;;
;;;chr1;chr2;chr3;chr4;chr5;chr6;chr7;chr8;chr9;chr10;chr11;chr12;chr13;chr14;chr15;chr16;chr17;chr18;chr19;chr20;chr21;chr22;chr23;chr24;chr25;z8;scaffold;total;vides
6;ttt;PheAAA;;;;6;;;;;;;;;;;;;;;;1;1;;;;1;;1;10;
89;ttc;GAA;;6;58;89;4;2;;1;;;;;;;;;2;1;;2;;1;1;;21;4;5;197;
16;tta;LeuTAA;11;12;;10;;;;;;;;;;;;;16;1;;8;;;;;;14;1;73;
201;ttg;CAA;;;1;4;;;;;2;;;;;;1;;28;;;201;1;2;;;;1;;241;9
191;ctt;LeuAAG;;12;;191;;12;25;;5;1;;;;1;;;;;;;1;4;;;;2;16;270;
4;ctc;GAG;;;;4;;;;;;;;;;;;;;;;;;;;;;;;4;
178;cta;TAG;;6;;178;;10;22;;5;2;;2;;;;;;;;;1;2;;;;2;14;244;
265;ctg;CAG;;;;265;6;;;;;;;1;;;;;1;2;;3;7;2;;1;;;12;300;10
148;att;IleAAT;1;10;46;148;5;2;1;;;;;;;;2;;3;1;1;;1;2;;;21;2;12;258;
8;atc;GAT;;;;8;;;;;;;;;;;;;;;;;;;;;;0;2;10;
20;ata;TAT;;;;9;;;20;;3;;;1;;;;;1;;;3;;3;;;;35;;75;
196;atg;MetCAT;1;2;4;196;13;;;;56;;;2;;;;;3;2;1;3;11;187;;3;;23;15;522;7
172;gtt;ValAAC;;;;172;4;;1;28;;;4;1;4;;;;5;1;;;1;3;;;;1;7;232;
3;gtc;GAC;;;;2;;;;;;;;;;;;;3;;;;;;;;;1;;6;
163;gta;TAC;;;;163;7;;;39;;;;1;;1;;;10;;;;3;2;;;;;4;230;
169;gtg;CAC;;;;169;2;;;25;;;2;;4;;;;12;;;;1;3;;;;1;8;227;13
269;tct;SerAGA;;16;1;269;6;;;;4;;;;;;;1;2;;;15;7;;;;;4;11;336;
1;tcc;GGA;;;;1;;;;;;;;;;;;;;;;1;;;;;;0;;2;
141;tca;TGA;;8;;141;8;;1;;5;;;;;;;;1;;;16;5;;;;;3;20;208;
58;tcg;CGA;;7;;58;1;1;1;;1;;1;;;;;;3;;;2;;;;;;1;5;81;13
187;cct;ProAGG;2;8;;187;8;;;50;1;;;1;12;;1;;1;4;3;5;;8;;;;2;22;315;
1;ccc;GGG;;1;;1;;;;;;;;;;;;;;;;;;;;;;;;2;
101;cca;TGG;;14;;101;2;2;;47;2;;;1;15;;1;;;1;;1;;;;;;2;16;205;
135;ccg;CGG;;7;;135;5;1;;;;;;1;;;1;;;1;;3;;4;;;;2;20;180;10
243;act;ThrAGT;;22;;243;11;;2;;1;1;;43;;;1;;;;;;1;16;;1;2;1;14;359;
6;acc;GGT;;;;3;;;;;;;;6;;;;;;;;;;;;;;;1;10;
195;aca;TGT;;3;;195;10;1;;;3;;;29;;;;11;2;1;;1;;13;1;;;2;18;290;
51;acg;CGT;;;1;51;1;;;;;;;1;;;;1;2;1;;1;1;1;;;1;1;3;66;6
54;gct;AlaAGC;;;54;10;1;;;;;;;;;4;;;1;;;;5;;;1;15;1;;92;
4;gcc;GGC;;;;4;;;;;;;;;;;;;;;;;;;;;;;;4;
357;gca;TGC;3;;;3;;;;;;;;;;1;;;;1;;1;357;;;;;1;1;368;
106;gcg;CGC;;;;3;;;1;;;;;;;;;;;;;;106;;;;;;2;112;13
3;tat;TyrATA;;;;3;;;;;;;;;;;2;;;;;;;;;1;;;;6;
155;tac;GTA;;;;155;6;;;;;;;;;;46;1;;;;;1;;;;;8;18;235;
8;cat;HisATG;;;;8;;;;;;;;;;;1;;;;;;;;;;;;1;10;
314;cac;GTG;;21;;314;4;;;1;5;;;;1;;1;;2;1;;5;5;;1;;;2;24;387;
49;caa;GlnTTG;1;1;;32;1;1;;49;2;;;;12;;;;;;;;;1;;;1;3;1;105;
162;cag;CTG;2;8;55;162;7;;1;;2;;;2;;1;;1;3;2;1;;3;2;;;;3;11;266;2
23;aat;AsnATT;;;;23;;1;;;;;;;;;;;;;;;;;;;;;;24;
920;aac;GTT;;22;;920;21;6;10;;;;;31;1;;10;;1;;;;7;2;2;;;8;4;1045;
416;aaa;LysTTT;1;25;;416;11;1;1;;9;;;;;;1;;4;1;;2;13;;;;;4;36;525;
815;aag;CTT;1;21;;815;38;4;6;;;;;22;1;;13;1;;;1;;8;4;;;;6;12;953;7
1;gat;AspATC;;;;0;;;;;;;;;;;;;1;;;;;;;;;;;1;
108;gac;GTC;;;;25;108;;;;;;;;;;;;;;;;3;2;;;8;4;;150;
170;gaa;GluTTC;;;;170;5;1;;;;;;;;1;16;1;;;;;2;4;1;;;6;18;225;
156;gag;CTC;4;;;156;6;;;;;;;;;;44;5;;;;;1;2;1;;3;7;16;245;13
6;tgt;CysACA;;;;6;;;;;;;;;;;1;;;;;1;;;;;;1;;9;
82;tgc;GCA;;;5;2;2;;;;;;5;;;;;;;;;82;1;;1;;;38;;136;
7;tga;SeCTCA;3;;;7;;;;;;;;;;;1;;1;;;;;;;;;0;2;14;
29;tgg;TrpCCA;;1;2;0;;;29;;;;;;;;1;;;1;1;;1;;;3;;4;1;44;10
127;cgt;ArgACG;;;;127;6;;2;1;;;;;;;40;2;;;;;1;;;;3;6;15;203;
19;cgc;GCG;;2;;19;1;;;;;;;;;;;;;;;;;;;;;0;2;24;
65;cga;TCG;5;;;65;2;;19;;;;;2;;;;1;1;;;;1;;;;1;5;5;107;
42;cgg;CCG;8;;;42;1;1;;;;;;;;;;1;1;;;;;;;;;1;4;59;12
13;agt;SerACT;;;;13;;;1;;;;;;;;;;;;;;;;;;;0;;14;
327;agc;GCT;;4;;327;25;;12;;;1;5;;;;;;25;;;1;6;2;;;;2;14;424;
143;aga;ArgTCT;1;12;;143;8;;3;;3;;;51;;;1;;;1;;;;17;;1;;1;10;252;
67;agg;CCT;;;1;7;6;2;1;;13;;;2;;;;;;;;;1;67;;;;3;1;104;7
8;ggt;GlyACC;;;;8;;;;;;;;;;;;;;;;;;;;;;3;;11;
598;ggc;GCC;;14;;598;39;;;;;8;;;4;1;;;;40;;;4;2;;18;4;;12;744;
30;gga;TCC;;;;30;2;1;;;;;;;;;2;;2;;;;3;4;1;;;;;45;
188;ggg;CCC;;1;;188;22;;;;;;;;;;1;;;23;;;;;;2;;124;1;362;10
2;taa;SupTTA;;;;2;;;;;;;;;;;;;1;;;;;;;;;1;2;6;142
8;tag;CTA;;;;8;;;;;;;;;;;;;;1;;;;;;;;;;9;
;;Undet???;;;;15;1;;;;;;;;;;;;;;;;2;;;;;1;;19;
;;;44;266;228;7825;416;49;159;241;122;13;17;200;54;10;188;26;138;87;8;358;573;362;9;31;81;347;440;12292;
;2 rRNAs;;chr1;chr2;chr3;chr4;chr5;chr6;chr7;chr8;chr9;chr10;chr11;chr12;chr13;chr14;chr15;chr16;chr17;chr18;chr19;chr20;chr21;chr22;chr23;chr24;chr25;Zv8Na10776;scaffold;total;
;Mit;;;;;;1 rRNA;;;;;;;;;;;;;;;;;;;;;;;;
NCBI;22;tRNAs;31;76;346;5723;140;52;72;240;60;12;13;123;46;11;135;17;109;5;7;262;253;143;11;18;72;;1,385;9,362;
MB;0.02;longueur;59.58;59.64;62.63;78.09;72.5;60.27;74.28;54.3;56.46;45.42;45.48;49.18;52.19;52.66;48.04;55.27;53.46;51.02;48.45;55.2;45.93;39.13;46.22;42.17;37.5;;334;1,679;
;39.9;GC%;36.4;36.7;36.9;38.4;36.4;36.4;36.7;36.5;36.5;36.6;36.4;36.3;36.5;36.6;36.8;36.5;36.6;36.6;36.4;36.6;36.6;37;36.7;36.3;36.6;;37;37;
;13;Protein;2,176;2,229;2,436;2,450;2,713;2,123;2,531;1,986;1,832;1,779;1,596;1,679;1,805;1,481;1,814;1,996;1,703;1,541;1,762;1,890;1,948;1,674;1,755;1,365;1,453;;9,370;57,087;
;−;RNAs au;326;274;362;1252;395;250;322;272;226;186;166;157;230;170;193;308;190;179;185;192;237;293;204;138;129;;1,639;8,475;
;37;gene;1,444;1,464;1,992;7,909;1,679;1,238;1,641;1,452;1,060;1,076;952;1,091;1,046;945;1,229;1,255;1,111;915;1,038;1,376;1,374;1,288;1,015;823;978;;9,570;46,961;
;−;pseudo;22;8;23;70;6;16;14;6;9;14;4;5;6;6;14;11;9;9;7;3;8;8;5;10;4;;67;364;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
75 pb;tRNA/longueur;;0.55;3.35;2.73;75.15;4.30;0.61;1.61;3.33;1.62;0.21;0.28;3.05;0.78;0.14;2.94;0.35;1.94;1.28;0.12;4.86;9.36;6.94;0.15;0.55;1.62;;;;1/10 000

Zebrafish Taurus Catus[modifier | modifier le wikicode]

Felis_catus_;F$;Bos_taurus_;B$;Danio_rerio_;D$;;24.11.17 Paris;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
http://gtrnadb.ucsc.edu/genomes/eukaryota/Fcatu5/felCat5-tRNAs.fa;;;;;;http://gtrnadb.ucsc.edu/genomes/eukaryota/Btaur8/bosTau8-tRNAs.fa;;;;;;http://gtrnadb.ucsc.edu/genomes/eukaryota/Dreri_v8/danRer6-tRNAs.fa;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
F$chrB2;AlaAGC;;B$chr1;AlaAGC;;D$chr4.trna1-MetCAT;;;D$chr1.trna118-LysCTT;;;D$chr2.trna100-AsnGTT;;;D$chr3.trna100-GlnCTG;;;D$chr5.trna105-LysCTT;;;D$chr6.trna10-LysCTT;;;D$chr7.trna100-IleTAT;;;D$chr8.trna100-GlnTTG;;;D$chr9.trna132-GlnCTG;;;D$chr10.trna177-GlyGCC;;;D$chr12.trna1-ArgTCG;;;D$chr13.trna104-LysCTT;;;D$chr14.trna166-AlaTGC;;;D$chr15.trna100-ProCGG;;;D$chr16.trna128-GluCTC;;;D$chr17.trna11-ThrTGT;;;D$chr18.trna138-TrpCCA;;;D$chr19.trna137-ProAGG;;;D$chr20.trna101-CysGCA;;;D$chr21.trna103-AlaTGC;;;D$chr22.trna100-MetCAT;;;D$chr23.trna13-CysGCA;;;D$chr25.trna100-PheAAA;;;D$Zv8_NA10776.trna10-IleTAT;;;;D$Zv8_scaffold2976.trna1-MetCAT
F$chrA3;AlaAGC;;B$chr1;AlaCGC;;D$chr4.trna1000-GlyGCC;;;D$chr1.trna121-ProAGG;;;D$chr2.trna101-LysCTT;;;D$chr3.trna101-PheGAA;;;D$chr5.trna106-LysCTT;;;D$chr6.trna11-AsnGTT;;;D$chr7.trna101-IleTAT;;;D$chr8.trna102-ProTGG;;;D$chr9.trna133-ArgTCT;;;D$chr10.trna178-GlyGCC;;;D$chr12.trna100-LysCTT;;;D$chr13.trna105-AsnGTT;;;D$chr14.trna178-GlnCTG;;;D$chr15.trna102-GluCTC;;;D$chr16.trna129-SerAGA;;;D$chr17.trna110-LeuCAA;;;D$chr18.trna164-MetCAT;;;D$chr19.trna138-ProAGG;;;D$chr20.trna103-CysGCA;;;D$chr21.trna107-MetCAT;;;D$chr22.trna101-MetCAT;;;D$chr23.trna151-ThrTGT;;;D$chr25.trna101-GlnTTG;;;D$Zv8_NA10776.trna11-IleTAT;;;;D$Zv8_scaffold2976.trna2-MetCAT
F$chrB2;AlaAGC;;B$chr1;AlaCGC;;D$chr4.trna10002-AsnGTT;;;D$chr1.trna140-GluCTC;;;D$chr2.trna102-AsnGTT;;;D$chr3.trna102-GlnCTG;;;D$chr5.trna107-LysCTT;;;D$chr6.trna111-IleAAT;;;D$chr7.trna102-IleTAT;;;D$chr8.trna103-ProAGG;;;D$chr9.trna134-ThrTGT;;;D$chr10.trna180-GlyGCC;;;D$chr12.trna101-AsnGTT;;;D$chr13.trna138-HisGTG;;;D$chr14.trna193-ValTAC;;;D$chr15.trna103-GluCTC;;;D$chr16.trna175-GluCTC;;;D$chr17.trna111-LeuCAA;;;D$chr18.trna165-ThrCGT;;;D$chr19.trna154-GlnCTG;;;D$chr20.trna105-CysGCA;;;D$chr21.trna113-AlaTGC;;;D$chr22.trna102-MetCAT;;;D$chr23.trna16-GlyTCC;;;D$chr25.trna102-IleAAT;;;D$Zv8_NA10776.trna12-IleTAT;;;;D$Zv8_scaffold2976.trna3-MetCAT
F$chrB2;AlaAGC;;B$chr1;AlaTGC;;D$chr4.trna10005-LysCTT;;;D$chr1.trna146-LeuTAA;;;D$chr2.trna103-LysCTT;;;D$chr3.trna103-IleAAT;;;D$chr5.trna11-ProAGG;;;D$chr6.trna13-AsnGTT;;;D$chr7.trna103-IleTAT;;;D$chr8.trna104-GlnTTG;;;D$chr9.trna135-SerAGA;;;D$chr10.trna183-GlyGCC;;;D$chr12.trna102-LysCTT;;;D$chr13.trna144-ValAAC;;;D$chr14.trna199-GluTTC;;;D$chr15.trna104-GluCTC;;;D$chr16.trna176-GluCTC;;;D$chr17.trna112-LeuCAA;;;D$chr18.trna169-ValAAC;;;D$chr19.trna183-IleAAT;;;D$chr20.trna107-CysGCA;;;D$chr21.trna114-AlaTGC;;;D$chr22.trna103-MetCAT;;;D$chr23.trna194-HisGTG;;;D$chr25.trna107-ArgACG;;;D$Zv8_NA10776.trna13-IleTAT;;;;D$Zv8_scaffold2976.trna4-MetCAT
F$chrB2;AlaAGC;;B$chr1;ArgCCG;;D$chr4.trna10006-AsnGTT;;;D$chr1.trna147-LeuTAA;;;D$chr2.trna104-AsnGTT;;;D$chr3.trna104-PheGAA;;;D$chr5.trna114-ProAGG;;;D$chr6.trna14-AsnGTT;;;D$chr7.trna105-IleTAT;;;D$chr8.trna106-ProTGG;;;D$chr9.trna136-ArgTCT;;;D$chr10.trna184-GlyGCC;;;D$chr12.trna103-AsnGTT;;;D$chr13.trna145-ValCAC;;;D$chr14.trna23-AlaAGC;;;D$chr15.trna105-GluCTC;;;D$chr16.trna219-GluCTC;;;D$chr17.trna113-LeuCAA;;;D$chr18.trna170-HisGTG;;;D$chr19.trna257-MetCAT;;;D$chr20.trna109-CysGCA;;;D$chr21.trna115-AlaCGC;;;D$chr22.trna105-MetCAT;;;D$chr23.trna45-GluCTC;;;D$chr25.trna108-ArgACG;;;D$Zv8_NA10776.trna14-IleTAT;;;;D$Zv8_scaffold3042.trna1-IleGAT
F$chrB2;AlaAGC;;B$chr1;ArgCCT;;D$chr4.trna10008-AsnGTT;;;D$chr1.trna149-LeuTAA;;;D$chr2.trna105-LysCTT;;;D$chr3.trna106-IleAAT;;;D$chr5.trna12-ProCGG;;;D$chr6.trna149-GlnTTG;;;D$chr7.trna106-IleTAT;;;D$chr8.trna107-ProAGG;;;D$chr9.trna137-ThrTGT;;;D$chr10.trna187-GlyGCC;;;D$chr12.trna104-LysCTT;;;D$chr13.trna146-ValAAC;;;D$chr14.trna24-AlaAGC;;;D$chr15.trna106-GluCTC;;;D$chr16.trna253-GluCTC;;;D$chr17.trna114-LeuCAA;;;D$chr18.trna171-ProAGG;;;D$chr19.trna291-TrpCCA;;;D$chr20.trna111-CysGCA;;;D$chr21.trna116-AlaTGC;;;D$chr22.trna107-MetCAT;;;D$chr23.trna47-AsnGTT;;;D$chr25.trna115-AspGTC;;;D$Zv8_NA10776.trna3-IleTAT;;;;D$Zv8_scaffold3042.trna2-AlaTGC
F$chrB2;AlaAGC;;B$chr1;ArgCCT;;D$chr4.trna10009-AsnGTT;;;D$chr1.trna150-LeuTAA;;;D$chr2.trna107-AsnGTT;;;D$chr3.trna107-PheGAA;;;D$chr5.trna13-ProCGG;;;D$chr6.trna15-LysCTT;;;D$chr7.trna107-ValAAC;;;D$chr8.trna108-GlnTTG;;;D$chr9.trna138-ThrAGT;;;D$chr10.trna188-GlyGCC;;;D$chr12.trna105-ThrTGT;;;D$chr13.trna147-ValCAC;;;D$chr14.trna25-AlaAGC;;;D$chr15.trna107-GluCTC;;;D$chr16.trna254-LysCTT;;;D$chr17.trna115-LeuCAA;;;D$chr18.trna172-ProAGG;;;D$chr19.trna3-LysCTT;;;D$chr20.trna113-CysGCA;;;D$chr21.trna117-AlaCGC;;;D$chr22.trna108-MetCAT;;;D$chr23.trna48-AsnGTT;;;D$chr25.trna116-AspGTC;;;D$Zv8_NA10776.trna4-IleTAT;;;;D$Zv8_scaffold3042.trna3-MetCAT
F$chrB2;AlaAGC;;B$chr1;ArgCCT;;D$chr4.trna1001-GlyGCC;;;D$chr1.trna152-LeuTAA;;;D$chr2.trna108-LysCTT;;;D$chr3.trna108-GlnCTG;;;D$chr5.trna130-AspGTC;;;D$chr6.trna16-AsnGTT;;;D$chr7.trna119-LysCTT;;;D$chr8.trna110-ProTGG;;;D$chr9.trna139-ArgTCT;;;D$chr10.trna191-GlyGCC;;;D$chr12.trna123-LeuTAG;;;D$chr13.trna148-ValAAC;;;D$chr14.trna26-AlaAGC;;;D$chr15.trna108-GluCTC;;;D$chr16.trna255-ArgTCG;;;D$chr17.trna116-LeuCAA;;;D$chr18.trna173-ProTGG;;;D$chr19.trna55-ProAGG;;;D$chr20.trna115-CysGCA;;;D$chr21.trna118-AlaTGC;;;D$chr22.trna109-ArgCCT;;;D$chr23.trna49-PheGAA;;;D$chr25.trna117-AspGTC;;;D$Zv8_NA10776.trna5-IleTAT;;;;D$Zv8_scaffold3058.trna1-GluTTC
F$chrB2;AlaAGC;;B$chr1;ArgCCT;;D$chr4.trna10010-LysCTT;;;D$chr1.trna153-LeuTAA;;;D$chr2.trna110-AsnGTT;;;D$chr3.trna109-IleAAT;;;D$chr5.trna131-AspGTC;;;D$chr6.trna217-GluTTC;;;D$chr7.trna131-ThrAGT;;;D$chr8.trna111-ProAGG;;;D$chr9.trna140-ThrTGT;;;D$chr10.trna256-LeuTAG;;;D$chr12.trna124-LeuTAG;;;D$chr13.trna149-ValCAC;;;D$chr14.trna290-GlyGCC;;;D$chr15.trna109-GluCTC;;;D$chr16.trna257-GlnCTG;;;D$chr17.trna117-LeuCAA;;;D$chr18.trna174-ProCGG;;;;;;D$chr20.trna117-CysGCA;;;D$chr21.trna119-AlaTGC;;;D$chr22.trna110-MetCAT;;;D$chr23.trna50-GluTTC;;;D$chr25.trna118-GlyGCC;;;D$Zv8_NA10776.trna6-IleTAT;;;;D$Zv8_scaffold3058.trna10-HisGTG
F$chrB2;AlaAGC;;B$chr1;ArgGCG;;D$chr4.trna10011-AsnGTT;;;D$chr1.trna154-LeuTAA;;;D$chr2.trna111-LysCTT;;;D$chr3.trna110-PheGAA;;;D$chr5.trna132-AspGTC;;;D$chr6.trna292-PheGAA;;;D$chr7.trna189-ThrAGT;;;D$chr8.trna112-GlnTTG;;;D$chr9.trna141-LeuAAG;;;D$chr10.trna257-LeuAAG;;;D$chr12.trna139-ArgCCT;;;D$chr13.trna150-ValAAC;;;D$chr14.trna302-LeuAAG;;;D$chr15.trna110-GluCTC;;;D$chr16.trna259-ArgCCG;;;D$chr17.trna118-LeuCAA;;;D$chr18.trna175-ProAGG;;;;;;D$chr20.trna119-CysGCA;;;D$chr21.trna120-AlaCGC;;;D$chr22.trna111-ArgCCT;;;;;;D$chr25.trna151-ThrAGT;;;D$Zv8_NA10776.trna7-IleTAT;;;;D$Zv8_scaffold3058.trna100-ValCAC
F$chrB2;AlaAGC;;B$chr1;ArgTCG;;D$chr4.trna10013-LysCTT;;;D$chr1.trna155-LeuTAA;;;D$chr2.trna112-AsnGTT;;;D$chr3.trna111-GlnCTG;;;D$chr5.trna134-AspGTC;;;D$chr6.trna307-LeuTAG;;;D$chr7.trna266-ArgTCG;;;D$chr8.trna114-ProTGG;;;D$chr9.trna142-LeuTAG;;;D$chr10.trna64-SerGCT;;;D$chr12.trna16-LeuCAG;;;D$chr13.trna151-ValCAC;;;;;;D$chr15.trna111-GluCTC;;;D$chr16.trna260-ThrCGT;;;D$chr17.trna119-LeuCAA;;;D$chr18.trna177-ProAGG;;;;;;D$chr20.trna121-CysGCA;;;D$chr21.trna121-AlaTGC;;;D$chr22.trna112-MetCAT;;;D$chr24.trna119-GlyCCC;;;D$chr25.trna152-ThrAGT;;;D$Zv8_NA10776.trna9-ValAAC;;;;D$Zv8_scaffold3058.trna103-GlnCTG
F$chrB2;AlaAGC;;B$chr1;ArgTCT;;D$chr4.trna10015-LysCTT;;;D$chr1.trna156-LeuTAA;;;D$chr2.trna113-LysCTT;;;D$chr3.trna112-IleAAT;;;D$chr5.trna136-AspGTC;;;D$chr6.trna309-IleAAT;;;D$chr7.trna267-GlnCTG;;;D$chr8.trna115-ProAGG;;;D$chr9.trna143-LeuAAG;;;D$chr10.trna65-ThrAGT;;;D$chr12.trna18-ArgTCG;;;D$chr13.trna258-ProTGG;;;;;;D$chr15.trna112-GluCTC;;;D$chr16.trna269-ThrTGT;;;D$chr17.trna12-ThrCGT;;;D$chr18.trna181-ArgTCT;;;;;;D$chr20.trna123-CysGCA;;;D$chr21.trna122-AlaTGC;;;D$chr22.trna114-MetCAT;;;D$chr24.trna124-GlyGCC;;;D$chr25.trna155-GluCTC;;;D$Zv8_NA10976.trna1-LeuTAA;;;;D$Zv8_scaffold3058.trna104-IleAAT
F$chrB2;AlaAGC;;B$chr1;ArgTCT;;D$chr4.trna10016-AsnGTT;;;D$chr1.trna157-LeuTAA;;;D$chr2.trna114-AsnGTT;;;D$chr3.trna113-PheGAA;;;D$chr5.trna138-AspGTC;;;D$chr6.trna310-LeuAAG;;;D$chr7.trna269-ArgTCG;;;D$chr8.trna116-GlnTTG;;;D$chr9.trna144-LeuTAG;;;D$chr10.trna66-LeuTAG;;;D$chr12.trna2-MetCAT;;;D$chr13.trna259-ProAGG;;;;;;D$chr15.trna113-GluCTC;;;D$chr16.trna270-ThrTGT;;;D$chr17.trna120-LeuCAA;;;D$chr18.trna196-MetCAT;;;;;;D$chr20.trna125-CysGCA;;;D$chr21.trna123-AlaCGC;;;D$chr22.trna115-MetCAT;;;D$chr24.trna126-GlyGCC;;;D$chr25.trna156-GluCTC;;;D$Zv8_NA10976.trna2-LeuTAA;;;;D$Zv8_scaffold3058.trna105-PheGAA
F$chrB2;AlaAGC;;B$chr1;ArgTCT;;D$chr4.trna10018-GluTTC;;;D$chr1.trna159-LeuTAA;;;D$chr2.trna115-LysCTT;;;D$chr3.trna115-PheGAA;;;D$chr5.trna14-ProAGG;;;D$chr6.trna311-LeuTAG;;;D$chr7.trna271-LysCTT;;;D$chr8.trna118-ProTGG;;;D$chr9.trna145-LeuAAG;;;;;;D$chr12.trna20-GlnCTG;;;D$chr13.trna260-GlnTTG;;;;;;D$chr15.trna114-GluCTC;;;D$chr16.trna271-ThrTGT;;;D$chr17.trna121-LeuCAA;;;D$chr18.trna197-GlyGCC;;;;;;D$chr20.trna127-CysGCA;;;D$chr21.trna124-AlaTGC;;;D$chr22.trna117-MetCAT;;;D$chr24.trna127-GlyCCC;;;D$chr25.trna157-GluCTC;;;D$Zv8_NA10978.trna1-LeuTAA;;;;D$Zv8_scaffold3058.trna106-GlnCTG
F$chrC1;AlaAGC;;B$chr1;AspGTC;;D$chr4.trna10019-TyrGTA;;;D$chr1.trna199-AlaTGC;;;D$chr2.trna116-AsnGTT;;;D$chr3.trna116-GlnCTG;;;D$chr5.trna140-AspGTC;;;D$chr6.trna312-LeuAAG;;;D$chr7.trna272-AsnGTT;;;D$chr8.trna119-ProAGG;;;D$chr9.trna146-LeuTAG;;;D$chr11.trna133-SerTGA;;;D$chr12.trna220-ThrAGT;;;D$chr13.trna261-ProTGG;;;;;;D$chr15.trna115-GluCTC;;;D$chr16.trna272-ThrTGT;;;D$chr17.trna122-LeuCAA;;;D$chr18.trna201-GlyGCC;;;;;;D$chr20.trna129-CysGCA;;;D$chr21.trna125-AlaTGC;;;D$chr22.trna118-MetCAT;;;D$chr24.trna128-GlyGCC;;;D$chr25.trna165-GlyGCC;;;D$Zv8_NA11109.trna1-ArgTCG;;;;D$Zv8_scaffold3058.trna107-IleAAT
F$chrD1;AlaAGC;;B$chr1;AspGTC;;D$chr4.trna10020-ArgACG;;;D$chr1.trna200-AlaTGC;;;D$chr2.trna117-LysCTT;;;D$chr3.trna117-PheGAA;;;D$chr5.trna142-AspGTC;;;D$chr6.trna315-LeuAAG;;;D$chr7.trna273-LysCTT;;;D$chr8.trna120-GlnTTG;;;D$chr9.trna147-LeuAAG;;;D$chr11.trna204-ValAAC;;;D$chr12.trna221-ArgTCT;;;D$chr13.trna262-ProAGG;;;;;;D$chr15.trna116-GluCTC;;;D$chr16.trna273-ThrTGT;;;D$chr17.trna123-LeuCAA;;;D$chr18.trna206-GlyCCC;;;;;;D$chr20.trna131-CysGCA;;;D$chr21.trna126-AlaTGC;;;D$chr22.trna119-ArgCCT;;;D$chr24.trna129-GlyGCC;;;D$chr25.trna174-ArgACG;;;D$Zv8_NA11109.trna2-ArgTCG;;;;D$Zv8_scaffold3058.trna11-SupTTA
F$chrE3;AlaAGC;;B$chr1;CysACA;;D$chr4.trna10021-GluTTC;;;D$chr1.trna201-AlaTGC;;;D$chr2.trna118-AsnGTT;;;D$chr3.trna118-GlnCTG;;;D$chr5.trna144-AspGTC;;;D$chr6.trna316-LeuTAG;;;D$chr7.trna274-AsnGTT;;;D$chr8.trna122-ProTGG;;;D$chr9.trna148-LeuTAG;;;D$chr11.trna205-ValAAC;;;D$chr12.trna222-ThrTGT;;;D$chr13.trna263-GlnTTG;;;;;;D$chr15.trna117-GluCTC;;;D$chr16.trna274-ThrTGT;;;D$chr17.trna124-LeuCAA;;;D$chr18.trna207-GlyGCC;;;;;;D$chr20.trna133-CysGCA;;;D$chr21.trna127-AlaCGC;;;D$chr22.trna120-LeuCAA;;;D$chr24.trna130-GlyGCC;;;D$chr25.trna186-AlaAGC;;;D$Zv8_NA1201.trna1-CysGCA;;;;D$Zv8_scaffold3058.trna110-PheAAA
F$chrF2;AlaAGC;;B$chr1;CysACA;;D$chr4.trna10022-TyrGTA;;;D$chr1.trna224-GluCTC;;;D$chr2.trna119-LysCTT;;;D$chr3.trna119-PheGAA;;;D$chr5.trna146-AspGTC;;;D$chr6.trna317-LeuAAG;;;D$chr7.trna275-LysCTT;;;D$chr8.trna123-ProAGG;;;D$chr9.trna149-LeuAAG;;;D$chr11.trna206-ValAAC;;;D$chr12.trna223-ThrAGT;;;D$chr13.trna264-ProTGG;;;;;;D$chr15.trna118-GluCTC;;;D$chr16.trna275-ThrTGT;;;D$chr17.trna125-LeuCAA;;;D$chr18.trna208-GlyGCC;;;;;;D$chr20.trna135-CysGCA;;;D$chr21.trna128-AlaTGC;;;D$chr22.trna122-MetCAT;;;D$chr24.trna212-TrpCCA;;;D$chr25.trna187-AlaAGC;;;D$Zv8_NA1201.trna2-CysGCA;;;;D$Zv8_scaffold3058.trna111-GlnCTG
F$chrB2;AlaCGC;;B$chr1;CysACA;;D$chr4.trna10023-ArgACG;;;D$chr1.trna238-GluCTC;;;D$chr2.trna147-ProAGG;;;D$chr3.trna120-GlnCTG;;;D$chr5.trna148-AspGTC;;;D$chr6.trna318-LeuTAG;;;D$chr7.trna276-AsnGTT;;;D$chr8.trna126-ProTGG;;;D$chr9.trna150-LeuTAG;;;D$chr11.trna207-ValAAC;;;D$chr12.trna224-ArgTCT;;;D$chr13.trna265-ProAGG;;;;;;D$chr15.trna119-GluCTC;;;D$chr16.trna276-ThrTGT;;;D$chr17.trna126-LeuCAA;;;D$chr18.trna211-GlyCCC;;;;;;D$chr20.trna137-CysGCA;;;D$chr21.trna129-AlaTGC;;;D$chr22.trna124-MetCAT;;;D$chr24.trna213-TrpCCA;;;D$chr25.trna188-AlaAGC;;;D$Zv8_NA1201.trna3-CysGCA;;;;D$Zv8_scaffold3058.trna112-IleAAT
F$chrB2;AlaCGC;;B$chr1;CysACA;;D$chr4.trna10024-GluTTC;;;D$chr1.trna239-MetCAT;;;D$chr2.trna148-ProCGG;;;D$chr3.trna121-IleAAT;;;D$chr5.trna150-AspGTC;;;D$chr6.trna319-LeuAAG;;;D$chr7.trna277-ArgCCT;;;D$chr8.trna127-ProAGG;;;D$chr9.trna160-MetCAT;;;D$chr11.trna226-CysGCA;;;D$chr12.trna225-ThrTGT;;;D$chr13.trna266-GlnTTG;;;;;;D$chr15.trna120-GluCTC;;;D$chr16.trna74-ThrTGT;;;D$chr17.trna127-LeuCAA;;;D$chr18.trna212-GlyGCC;;;;;;D$chr20.trna139-CysGCA;;;D$chr21.trna130-AlaTGC;;;D$chr22.trna125-MetCAT;;;D$chr24.trna214-TrpCCA;;;D$chr25.trna189-AlaAGC;;;D$Zv8_NA1201.trna4-CysGCA;;;;D$Zv8_scaffold3058.trna113-PheGAA
F$chrB2;AlaCGC;;B$chr1;CysACA;;D$chr4.trna10025-TyrGTA;;;D$chr1.trna240-LysTTT;;;D$chr2.trna149-ProAGG;;;D$chr3.trna122-PheGAA;;;D$chr5.trna152-AspGTC;;;D$chr6.trna320-LeuAAG;;;D$chr7.trna278-AsnGTT;;;D$chr8.trna128-GlnTTG;;;D$chr9.trna161-MetCAT;;;D$chr11.trna227-CysGCA;;;D$chr12.trna226-ThrAGT;;;D$chr13.trna267-ProTGG;;;;;;D$chr15.trna121-GluCTC;;;D$chr16.trna75-ThrTGT;;;D$chr17.trna128-LeuCAA;;;D$chr18.trna213-GlyCCC;;;;;;D$chr20.trna141-CysGCA;;;D$chr21.trna131-AlaTGC;;;D$chr22.trna126-MetCAT;;;D$chr24.trna22-MetCAT;;;D$chr25.trna190-AlaAGC;;;D$Zv8_NA1201.trna5-CysGCA;;;;D$Zv8_scaffold3058.trna115-IleAAT
F$chrB2;AlaCGC;;B$chr1;CysACA;;D$chr4.trna10026-ArgACG;;;D$chr1.trna252-GluCTC;;;D$chr2.trna150-ProTGG;;;D$chr3.trna123-GlnCTG;;;D$chr5.trna153-AspGTC;;;D$chr6.trna321-LeuTAG;;;D$chr7.trna281-SerGCT;;;D$chr8.trna130-ProTGG;;;D$chr9.trna162-MetCAT;;;D$chr11.trna23-SerGCT;;;D$chr12.trna227-ArgTCT;;;D$chr13.trna268-ProAGG;;;;;;D$chr15.trna122-GluCTC;;;D$chr16.trna76-ThrTGT;;;D$chr17.trna129-LeuCAA;;;D$chr18.trna214-GlyGCC;;;;;;D$chr20.trna143-CysGCA;;;D$chr21.trna132-AlaTGC;;;D$chr22.trna128-MetCAT;;;D$chr24.trna23-MetCAT;;;D$chr25.trna191-AlaAGC;;;D$Zv8_NA1201.trna6-CysGCA;;;;D$Zv8_scaffold3058.trna116-PheGAA
F$chrB2;AlaCGC;;B$chr1;CysACA;;D$chr4.trna10027-GluTTC;;;D$chr1.trna267-ArgTCT;;;D$chr2.trna151-ProTGG;;;D$chr3.trna124-IleAAT;;;D$chr5.trna155-AspGTC;;;D$chr6.trna323-LeuAAG;;;D$chr7.trna282-SerGCT;;;D$chr8.trna131-ProAGG;;;D$chr9.trna164-MetCAT;;;D$chr11.trna24-SerGCT;;;D$chr12.trna228-ThrTGT;;;D$chr13.trna269-GlnTTG;;;;;;D$chr15.trna123-GluCTC;;;D$chr16.trna85-GluTTC;;;D$chr17.trna130-LeuCAA;;;D$chr18.trna215-GlyGCC;;;;;;D$chr20.trna145-CysGCA;;;D$chr21.trna133-AlaTGC;;;D$chr22.trna130-MetCAT;;;D$chr24.trna24-MetCAT;;;D$chr25.trna192-AlaAGC;;;D$Zv8_NA1201.trna7-CysGCA;;;;D$Zv8_scaffold3058.trna118-IleAAT
F$chrB4;AlaCGC;;B$chr1;CysACA;;D$chr4.trna10028-TyrGTA;;;D$chr1.trna282-SeCTCA;;;D$chr2.trna152-ProCGG;;;D$chr3.trna125-PheGAA;;;D$chr5.trna157-AspGTC;;;D$chr6.trna324-LeuTAG;;;D$chr7.trna283-SerGCT;;;D$chr8.trna132-GlnTTG;;;D$chr9.trna165-MetCAT;;;D$chr11.trna247-CysGCA;;;D$chr12.trna23-LysCTT;;;D$chr13.trna270-ProTGG;;;;;;D$chr15.trna124-GluCTC;;;D$chr16.trna86-TyrGTA;;;D$chr17.trna131-LeuCAA;;;D$chr18.trna216-GlyCCC;;;;;;D$chr20.trna147-CysGCA;;;D$chr21.trna134-AlaTGC;;;D$chr22.trna131-ArgCCT;;;D$chr24.trna260-TyrGTA;;;D$chr25.trna193-AlaAGC;;;D$Zv8_NA1267.trna1-ProAGG;;;;D$Zv8_scaffold3058.trna12-SerAGA
F$chrC1;AlaCGC;;B$chr1;CysGCA;;D$chr4.trna10029-ArgACG;;;D$chr1.trna284-ArgCCG;;;D$chr2.trna153-ProAGG;;;D$chr3.trna126-GlnCTG;;;D$chr5.trna159-AspGTC;;;D$chr6.trna325-LeuAAG;;;D$chr7.trna285-SerGCT;;;D$chr8.trna134-ProTGG;;;D$chr9.trna166-MetCAT;;;D$chr11.trna248-CysGCA;;;D$chr12.trna230-ThrAGT;;;D$chr13.trna271-ProAGG;;;;;;D$chr15.trna125-GluCTC;;;D$chr16.trna87-ArgACG;;;D$chr17.trna132-LeuCAA;;;D$chr18.trna217-GlyGCC;;;;;;D$chr20.trna149-CysGCA;;;D$chr21.trna135-AlaCGC;;;D$chr22.trna132-MetCAT;;;D$chr24.trna286-ThrAGT;;;D$chr25.trna194-AlaAGC;;;D$Zv8_NA1389.trna2-TrpCCA;;;;D$Zv8_scaffold3058.trna121-IleAAT
F$chrC1;AlaGGC;;B$chr1;CysGCA;;D$chr4.trna1003-GlyGCC;;;D$chr1.trna285-SeCTCA;;;D$chr2.trna154-SerTGA;;;D$chr3.trna127-IleAAT;;;D$chr5.trna16-ProAGG;;;D$chr6.trna326-LeuTAG;;;D$chr7.trna286-SerGCT;;;D$chr8.trna135-ProAGG;;;D$chr9.trna167-MetCAT;;;D$chr11.trna249-CysGCA;;;D$chr12.trna231-ArgTCT;;;D$chr13.trna272-GlnTTG;;;;;;D$chr15.trna126-GluCTC;;;D$chr16.trna89-ArgACG;;;D$chr17.trna133-LeuCAA;;;D$chr18.trna218-GlyGCC;;;;;;D$chr20.trna15-SerTGA;;;D$chr21.trna136-AlaTGC;;;D$chr22.trna133-ArgCCT;;;D$chr24.trna300-LeuCAG;;;D$chr25.trna195-AlaAGC;;;D$Zv8_NA1770.trna1-LysCTT;;;;D$Zv8_scaffold3058.trna123-GlnCTG
F$chrA1;AlaTGC;;B$chr1;CysGCA;;D$chr4.trna10030-GluTTC;;;D$chr1.trna287-GlnCTG;;;D$chr2.trna155-ProAGG;;;D$chr3.trna128-PheGAA;;;D$chr5.trna160-AspGTC;;;D$chr6.trna327-LeuAAG;;;D$chr7.trna288-SerGCT;;;D$chr8.trna136-GlnTTG;;;D$chr9.trna168-MetCAT;;;D$chr11.trna25-SerGCT;;;D$chr12.trna232-ThrAGT;;;D$chr13.trna273-ProTGG;;;;;;D$chr15.trna127-GluCTC;;;;;;D$chr17.trna134-LeuCAA;;;D$chr18.trna221-GlyGCC;;;;;;D$chr20.trna151-CysGCA;;;D$chr21.trna137-AlaTGC;;;D$chr22.trna134-ArgCCT;;;D$chr24.trna31-GlyGCC;;;D$chr25.trna196-AlaAGC;;;D$Zv8_NA1770.trna2-AsnGTT;;;;D$Zv8_scaffold3058.trna124-IleAAT
F$chrA1;AlaTGC;;B$chr1;CysGCA;;D$chr4.trna10031-TyrGTA;;;D$chr1.trna288-ArgTCG;;;D$chr2.trna156-LeuAAG;;;D$chr3.trna129-GlnCTG;;;D$chr5.trna162-AspGTC;;;D$chr6.trna328-LeuTAG;;;D$chr7.trna289-SerGCT;;;D$chr8.trna138-ProTGG;;;D$chr9.trna169-MetCAT;;;D$chr11.trna26-SerGCT;;;D$chr12.trna233-ArgTCT;;;D$chr13.trna274-ProAGG;;;;;;D$chr15.trna128-GluCTC;;;;;;D$chr17.trna135-LeuCAA;;;D$chr18.trna222-GlyGCC;;;;;;D$chr20.trna153-CysGCA;;;D$chr21.trna138-AlaTGC;;;D$chr22.trna136-ArgCCT;;;D$chr24.trna34-GlyGCC;;;D$chr25.trna197-AlaAGC;;;D$Zv8_NA1770.trna3-LysCTT;;;;D$Zv8_scaffold3058.trna125-PheGAA
F$chrA1;AlaTGC;;B$chr1;CysGCA;;D$chr4.trna10032-ArgACG;;;D$chr1.trna290-ArgCCG;;;D$chr2.trna157-LeuAAG;;;D$chr3.trna130-PheGAA;;;D$chr5.trna163-AspGTC;;;D$chr6.trna330-LeuAAG;;;D$chr7.trna29-LysCTT;;;D$chr8.trna139-ProAGG;;;D$chr9.trna170-MetCAT;;;D$chr11.trna52-ValCAC;;;D$chr12.trna234-ThrAGT;;;D$chr13.trna275-GlnTTG;;;;;;D$chr15.trna129-GluCTC;;;;;;D$chr17.trna136-LeuCAA;;;D$chr18.trna223-GlyGCC;;;;;;D$chr20.trna155-CysGCA;;;D$chr21.trna139-AlaCGC;;;D$chr22.trna137-MetCAT;;;D$chr24.trna35-GlyCCC;;;D$chr25.trna218-AspGTC;;;D$Zv8_NA1770.trna4-AsnGTT;;;;D$Zv8_scaffold3058.trna126-ThrTGT
F$chrB2;AlaTGC;;B$chr1;CysGCA;;D$chr4.trna10033-GluTTC;;;D$chr1.trna291-ArgTCG;;;D$chr2.trna158-LeuTAG;;;D$chr3.trna131-GlnCTG;;;D$chr5.trna165-AspGTC;;;D$chr6.trna331-LeuTAG;;;D$chr7.trna290-SerGCT;;;D$chr8.trna140-GlnTTG;;;D$chr9.trna171-IleTAT;;;D$chr11.trna54-ValCAC;;;D$chr12.trna235-ArgTCT;;;D$chr13.trna276-ProTGG;;;;;;D$chr15.trna130-GluCTC;;;;;;D$chr17.trna137-LeuCAA;;;D$chr18.trna225-GlyCCC;;;;;;D$chr20.trna157-CysGCA;;;D$chr21.trna140-AlaTGC;;;D$chr22.trna138-MetCAT;;;D$chr24.trna37-GlyGCC;;;D$chr25.trna219-AspGTC;;;D$Zv8_NA1836.trna1-AsnGTT;;;;D$Zv8_scaffold3058.trna127-ThrAGT
F$chrB2;AlaTGC;;B$chr1;CysGCA;;D$chr4.trna10034-TyrGTA;;;D$chr1.trna293-ArgCCG;;;D$chr2.trna159-LeuAAG;;;D$chr3.trna132-PheGAA;;;D$chr5.trna167-AspGTC;;;D$chr6.trna332-LeuAAG;;;D$chr7.trna291-SerGCT;;;D$chr8.trna142-ProTGG;;;D$chr9.trna172-MetCAT;;;D$chr11.trna95-SerGCT;;;D$chr12.trna236-ThrTGT;;;D$chr13.trna277-ProAGG;;;;;;D$chr15.trna197-IleAAT;;;;;;D$chr17.trna16-LysTTT;;;D$chr18.trna226-GlyGCC;;;;;;D$chr20.trna159-CysGCA;;;D$chr21.trna141-AlaTGC;;;D$chr22.trna139-MetCAT;;;D$chr24.trna38-GlyCCC;;;D$chr25.trna220-AspGTC;;;D$Zv8_NA1927.trna1-MetCAT;;;;D$Zv8_scaffold3058.trna128-IleAAT
F$chrB2;AlaTGC;;B$chr1;CysGCA;;D$chr4.trna10035-ArgACG;;;D$chr1.trna294-GlnTTG;;;D$chr2.trna160-LeuAAG;;;D$chr3.trna133-GlnCTG;;;D$chr5.trna169-AspGTC;;;D$chr6.trna333-LeuTAG;;;D$chr7.trna292-SerGCT;;;D$chr8.trna143-ProAGG;;;D$chr9.trna173-MetCAT;;;;;;D$chr12.trna237-ArgTCT;;;D$chr13.trna278-GlnTTG;;;;;;D$chr15.trna198-IleAAT;;;;;;D$chr17.trna17-SerAGA;;;D$chr18.trna227-GlyGCC;;;;;;D$chr20.trna16-HisGTG;;;D$chr21.trna142-AlaCGC;;;D$chr22.trna141-MetCAT;;;D$chr24.trna40-GlyGCC;;;D$chr25.trna221-AspGTC;;;D$Zv8_NA1927.trna10-ValCAC;;;;D$Zv8_scaffold3058.trna129-ThrTGT
F$chrB2;AlaTGC;;B$chr1;CysGCA;;D$chr4.trna10036-GluTTC;;;D$chr1.trna297-ArgCCG;;;D$chr2.trna161-LeuAAG;;;D$chr3.trna134-PheGAA;;;D$chr5.trna17-ProTGG;;;D$chr6.trna335-LeuAAG;;;D$chr7.trna293-LeuAAG;;;D$chr8.trna144-GlnTTG;;;D$chr9.trna174-MetCAT;;;;;;D$chr12.trna238-ThrTGT;;;D$chr13.trna279-ProTGG;;;;;;D$chr15.trna199-TrpCCA;;;;;;D$chr17.trna18-HisGTG;;;D$chr18.trna229-GlyCCC;;;;;;D$chr20.trna161-CysGCA;;;D$chr21.trna143-AlaTGC;;;D$chr22.trna142-MetCAT;;;D$chr24.trna43-GlyGCC;;;D$chr25.trna222-AspGTC;;;D$Zv8_NA1927.trna11-MetCAT;;;;D$Zv8_scaffold3058.trna13-HisGTG
F$chrD3;AlaTGC;;B$chr1;CysGCA;;D$chr4.trna10037-TyrGTA;;;D$chr1.trna298-ArgTCG;;;D$chr2.trna162-LeuAAG;;;D$chr3.trna135-GlnCTG;;;D$chr5.trna171-AspGTC;;;D$chr6.trna358-PheGAA;;;D$chr7.trna294-LeuTAG;;;D$chr8.trna145-ProTGG;;;D$chr9.trna175-MetCAT;;;;;;D$chr12.trna24-ThrGGT;;;D$chr13.trna280-ProAGG;;;;;;D$chr15.trna200-GlyTCC;;;;;;D$chr17.trna20-LeuCAG;;;D$chr18.trna230-GlyGCC;;;;;;D$chr20.trna163-CysGCA;;;D$chr21.trna144-AlaTGC;;;D$chr22.trna144-MetCAT;;;D$chr24.trna48-GlyGCC;;;D$chr25.trna223-GlyGCC;;;D$Zv8_NA1927.trna12-MetCAT;;;;D$Zv8_scaffold3058.trna130-ThrAGT
F$chrD3;AlaTGC;;B$chr1;CysGCA;;D$chr4.trna10038-ArgACG;;;D$chr1.trna300-GlnCTG;;;D$chr2.trna163-LeuAAG;;;D$chr3.trna136-PheGAA;;;D$chr5.trna173-AspGTC;;;D$chr6.trna359-ProCGG;;;D$chr7.trna295-LeuAAG;;;D$chr8.trna146-ProAGG;;;D$chr9.trna176-MetCAT;;;;;;D$chr12.trna240-ThrAGT;;;D$chr13.trna281-GlnTTG;;;;;;D$chr15.trna217-GlyTCC;;;;;;D$chr17.trna21-SerTGA;;;D$chr18.trna231-GlyGCC;;;;;;D$chr20.trna165-CysGCA;;;D$chr21.trna145-AlaTGC;;;D$chr22.trna150-ArgCCT;;;D$chr24.trna49-GlyCCC;;;D$chr25.trna247-PheGAA;;;D$Zv8_NA1927.trna13-MetCAT;;;;D$Zv8_scaffold3058.trna131-ArgTCT
F$chrD3;AlaTGC;;B$chr1;CysGCA;;D$chr4.trna10039-GluTTC;;;D$chr1.trna301-ArgTCG;;;D$chr2.trna164-LeuTAG;;;D$chr3.trna137-GlnCTG;;;D$chr5.trna175-AspGTC;;;D$chr6.trna360-ProTGG;;;D$chr7.trna296-LeuTAG;;;D$chr8.trna147-GlnTTG;;;D$chr9.trna177-MetCAT;;;;;;D$chr12.trna241-ArgTCT;;;D$chr13.trna282-ProTGG;;;;;;D$chr15.trna245-ProAGG;;;;;;D$chr17.trna23-IleTAT;;;D$chr18.trna232-GlyCCC;;;;;;D$chr20.trna167-CysGCA;;;D$chr21.trna146-AlaCGC;;;D$chr22.trna151-MetCAT;;;D$chr24.trna52-GlyGCC;;;D$chr25.trna248-IleAAT;;;D$Zv8_NA1927.trna14-MetCAT;;;;D$Zv8_scaffold3058.trna132-ThrTGT
F$chrA2;ArgACG;;B$chr1;CysGCA;;D$chr4.trna10040-TyrGTA;;;D$chr1.trna303-ArgCCG;;;D$chr2.trna165-LeuAAG;;;D$chr3.trna138-PheGAA;;;D$chr5.trna177-AspGTC;;;D$chr6.trna363-ProTGG;;;D$chr7.trna297-LeuAAG;;;D$chr8.trna149-ProTGG;;;D$chr9.trna178-MetCAT;;;;;;D$chr12.trna242-ThrAGT;;;D$chr13.trna283-ProAGG;;;;;;D$chr15.trna246-ProTGG;;;;;;D$chr17.trna24-SerCGA;;;D$chr18.trna233-GlyGCC;;;;;;D$chr20.trna169-CysGCA;;;D$chr21.trna147-AlaTGC;;;D$chr22.trna152-ArgCCT;;;D$chr24.trna53-GlyCCC;;;D$chr25.trna249-PheGAA;;;D$Zv8_NA1927.trna15-MetCAT;;;;D$Zv8_scaffold3058.trna133-ThrAGT
F$chrB2;ArgACG;;B$chr1;GlnCTG;;D$chr4.trna10041-ArgACG;;;D$chr1.trna304-SeCTCA;;;D$chr2.trna166-LeuTAG;;;D$chr3.trna146-IleAAT;;;D$chr5.trna178-AspGTC;;;D$chr6.trna364-GlyTCC;;;D$chr7.trna298-LeuTAG;;;D$chr8.trna150-ProAGG;;;D$chr9.trna179-MetCAT;;;;;;D$chr12.trna243-ArgTCT;;;D$chr13.trna284-GlnTTG;;;;;;D$chr15.trna28-LeuCAA;;;;;;D$chr17.trna240-SerAGA;;;D$chr18.trna234-GlyGCC;;;;;;D$chr20.trna17-SerCGA;;;D$chr21.trna148-AlaTGC;;;D$chr22.trna153-MetCAT;;;D$chr24.trna54-GlyCCC;;;D$chr25.trna250-IleAAT;;;D$Zv8_NA1927.trna18-MetCAT;;;;D$Zv8_scaffold3058.trna134-ArgTCT
F$chrB2;ArgACG;;B$chr1;GlnCTG;;D$chr4.trna10042-GluTTC;;;D$chr1.trna306-ArgCCG;;;D$chr2.trna167-LeuAAG;;;D$chr3.trna147-PheGAA;;;D$chr5.trna180-AspGTC;;;D$chr6.trna366-LysCTT;;;D$chr7.trna299-LeuAAG;;;D$chr8.trna151-GlnTTG;;;D$chr9.trna180-MetCAT;;;;;;D$chr12.trna244-ThrTGT;;;D$chr13.trna285-ProTGG;;;;;;D$chr15.trna3-LysTTT;;;;;;D$chr17.trna26-LysTTT;;;D$chr18.trna236-GlyCCC;;;;;;D$chr20.trna171-CysGCA;;;D$chr21.trna149-AlaTGC;;;D$chr22.trna154-ArgCCT;;;D$chr24.trna55-GlyGCC;;;D$chr25.trna251-PheGAA;;;D$Zv8_NA1927.trna19-MetCAT;;;;D$Zv8_scaffold3058.trna135-ThrTGT
F$chrB2;ArgACG;;B$chr1;GlnTTG;;D$chr4.trna10043-TyrGTA;;;D$chr1.trna307-ArgCCG;;;D$chr2.trna168-LeuTAG;;;D$chr3.trna148-GlnCTG;;;D$chr5.trna182-AspGTC;;;D$chr6.trna371-ThrTGT;;;D$chr7.trna3-ArgTCT;;;D$chr8.trna153-ProTGG;;;D$chr9.trna181-MetCAT;;;;;;D$chr12.trna245-ArgTCT;;;D$chr13.trna286-ProAGG;;;;;;D$chr15.trna302-TyrGTA;;;;;;D$chr17.trna27-SerCGA;;;D$chr18.trna238-GlyCCC;;;;;;D$chr20.trna173-CysGCA;;;D$chr21.trna150-AlaTGC;;;D$chr22.trna155-MetCAT;;;D$chr24.trna94-ArgTCT;;;D$chr25.trna252-IleAAT;;;D$Zv8_NA1927.trna2-MetCAT;;;;D$Zv8_scaffold3058.trna136-ThrAGT
F$chrB2;ArgACG;;B$chr1;GluCTC;;D$chr4.trna10044-ArgACG;;;D$chr1.trna308-ArgTCG;;;D$chr2.trna169-LeuAAG;;;D$chr3.trna149-PheGAA;;;D$chr5.trna184-AspGTC;;;D$chr6.trna387-ArgCCG;;;D$chr7.trna30-AsnGTT;;;D$chr8.trna154-ProAGG;;;D$chr9.trna182-MetCAT;;;;;;D$chr12.trna246-ThrAGT;;;D$chr13.trna287-GlnTTG;;;;;;D$chr15.trna303-ArgACG;;;;;;D$chr17.trna278-ValAAC;;;D$chr18.trna239-GlyGCC;;;;;;D$chr20.trna175-CysGCA;;;D$chr21.trna151-AlaTGC;;;D$chr22.trna156-ArgCCT;;;D$chr24.trna97-AlaAGC;;;D$chr25.trna253-PheGAA;;;D$Zv8_NA1927.trna20-MetCAT;;;;D$Zv8_scaffold3058.trna137-ArgTCT
F$chrB2;ArgACG;;B$chr1;GluCTC;;D$chr4.trna10045-GluTTC;;;D$chr1.trna310-ArgCCG;;;D$chr2.trna170-LeuTAG;;;D$chr3.trna150-GlnCTG;;;D$chr5.trna186-AspGTC;;;D$chr6.trna418-LysTTT;;;D$chr7.trna300-LeuTAG;;;D$chr8.trna155-GlnTTG;;;D$chr9.trna183-MetCAT;;;;;;D$chr12.trna247-ArgTCT;;;D$chr13.trna288-ProTGG;;;;;;D$chr15.trna304-TyrGTA;;;;;;D$chr17.trna279-ValTAC;;;D$chr18.trna240-GlyCCC;;;;;;D$chr20.trna177-CysGCA;;;D$chr21.trna152-AlaTGC;;;D$chr22.trna157-MetCAT;;;;;;D$chr25.trna266-ArgTCG;;;D$Zv8_NA1927.trna3-MetCAT;;;;D$Zv8_scaffold3058.trna138-ThrTGT
F$chrB3;ArgACG;;B$chr1;GluCTC;;D$chr4.trna10046-TyrGTA;;;D$chr1.trna333-IleAAT;;;D$chr2.trna172-LeuAAG;;;D$chr3.trna151-IleAAT;;;D$chr5.trna188-AspGTC;;;D$chr6.trna433-SerCGA;;;D$chr7.trna301-LeuAAG;;;D$chr8.trna156-ProTGG;;;D$chr9.trna184-MetCAT;;;;;;D$chr12.trna248-ThrTGT;;;D$chr13.trna289-ProAGG;;;;;;D$chr15.trna305-ArgACG;;;;;;D$chr17.trna28-HisGTG;;;D$chr18.trna241-GlyGCC;;;;;;D$chr20.trna179-CysGCA;;;D$chr21.trna153-AlaTGC;;;D$chr22.trna160-ArgCCT;;;;;;D$chr25.trna39-AlaAGC;;;D$Zv8_NA1927.trna4-MetCAT;;;;D$Zv8_scaffold3058.trna139-ThrAGT
F$chrB4;ArgACG;;B$chr1;GluCTC;;D$chr4.trna10047-ArgACG;;;D$chr1.trna60-ProAGG;;;D$chr2.trna174-LeuAAG;;;D$chr3.trna152-PheGAA;;;D$chr5.trna19-Undet???;;;D$chr6.trna52-ArgCCT;;;D$chr7.trna302-LeuTAG;;;D$chr8.trna157-ProAGG;;;D$chr9.trna185-MetCAT;;;;;;D$chr12.trna249-ArgTCT;;;D$chr13.trna290-GlnTTG;;;;;;D$chr15.trna306-TyrGTA;;;;;;D$chr17.trna280-ValAAC;;;D$chr18.trna242-GlyGCC;;;;;;D$chr20.trna18-HisGTG;;;D$chr21.trna154-AlaTGC;;;D$chr22.trna161-MetCAT;;;;;;D$chr25.trna40-AlaAGC;;;D$Zv8_NA1927.trna5-MetCAT;;;;D$Zv8_scaffold3058.trna14-LysTTT
F$chrF2;ArgACG;;B$chr1;GluCTC;;D$chr4.trna10048-GluTTC;;;;;;D$chr2.trna175-SerGCT;;;D$chr3.trna154-GlnCTG;;;D$chr5.trna190-AspGTC;;;D$chr6.trna53-ArgCCT;;;D$chr7.trna303-LeuAAG;;;D$chr8.trna158-GlnTTG;;;D$chr9.trna186-MetCAT;;;;;;D$chr12.trna250-ThrAGT;;;D$chr13.trna291-ProTGG;;;;;;D$chr15.trna307-ArgACG;;;;;;D$chr17.trna281-ValCAC;;;D$chr18.trna244-GlyCCC;;;;;;D$chr20.trna181-CysGCA;;;D$chr21.trna155-AlaTGC;;;D$chr22.trna162-ArgCCT;;;;;;D$chr25.trna41-AlaAGC;;;D$Zv8_NA1927.trna6-MetCAT;;;;D$Zv8_scaffold3058.trna140-ArgTCT
F$chrA3;ArgCCG;;B$chr1;GluCTC;;D$chr4.trna10049-TyrGTA;;;;;;D$chr2.trna176-SerGCT;;;D$chr3.trna155-IleAAT;;;D$chr5.trna192-AspGTC;;;D$chr6.trna6-AsnGTT;;;D$chr7.trna304-LeuTAG;;;D$chr8.trna160-ProTGG;;;D$chr9.trna187-MetCAT;;;;;;D$chr12.trna251-ArgTCT;;;D$chr13.trna336-GlyGCC;;;;;;D$chr15.trna308-TyrGTA;;;;;;D$chr17.trna284-ValCAC;;;D$chr18.trna245-GlyGCC;;;;;;D$chr20.trna183-CysGCA;;;D$chr21.trna156-AlaTGC;;;D$chr22.trna163-MetCAT;;;;;;D$chr25.trna48-ThrCGT;;;D$Zv8_NA1927.trna7-MetCAT;;;;D$Zv8_scaffold3058.trna141-ThrTGT
F$chrB1;ArgCCG;;B$chr1;GluCTC;;D$chr4.trna1005-GlyGCC;;;;;;D$chr2.trna177-SerGCT;;;D$chr3.trna156-PheGAA;;;D$chr5.trna194-AspGTC;;;D$chr6.trna7-AsnATT;;;D$chr7.trna305-LeuAAG;;;D$chr8.trna161-ProAGG;;;D$chr9.trna188-MetCAT;;;;;;D$chr12.trna252-ThrTGT;;;D$chr13.trna52-GlyGCC;;;;;;D$chr15.trna309-ArgACG;;;;;;D$chr17.trna285-ValGAC;;;D$chr18.trna246-GlyGCC;;;;;;D$chr20.trna185-CysGCA;;;D$chr21.trna157-AlaTGC;;;D$chr22.trna164-ArgCCT;;;;;;D$chr25.trna57-GlyGCC;;;D$Zv8_NA1927.trna8-MetCAT;;;;D$Zv8_scaffold3058.trna142-ThrAGT
F$chrB2;ArgCCG;;B$chr1;GluTTC;;D$chr4.trna10050-ArgACG;;;;;;D$chr2.trna179-SerGCT;;;D$chr3.trna158-GlnCTG;;;D$chr5.trna196-AspGTC;;;D$chr6.trna8-LysCTT;;;D$chr7.trna306-LeuTAG;;;D$chr8.trna162-GlnTTG;;;D$chr9.trna189-MetCAT;;;;;;D$chr12.trna253-ArgTCT;;;D$chr13.trna53-GlyGCC;;;;;;D$chr15.trna310-TyrGTA;;;;;;D$chr17.trna286-ValCAC;;;D$chr18.trna248-GlyGCC;;;;;;D$chr20.trna187-CysGCA;;;D$chr21.trna158-AlaTGC;;;D$chr22.trna165-MetCAT;;;;;;D$chr25.trna66-IleAAT;;;D$Zv8_NA1927.trna9-Undet???;;;;D$Zv8_scaffold3058.trna143-ArgTCT
F$chrB2;ArgCCG;;B$chr1;GluTTC;;D$chr4.trna10051-GluTTC;;;;;;D$chr2.trna182-LysCTT;;;D$chr3.trna159-IleAAT;;;D$chr5.trna198-AspGTC;;;D$chr6.trna9-AsnGTT;;;D$chr7.trna307-LeuAAG;;;D$chr8.trna163-ProAGG;;;D$chr9.trna190-MetCAT;;;;;;D$chr12.trna254-ThrAGT;;;D$chr13.trna54-GlyGCC;;;;;;D$chr15.trna311-ArgACG;;;;;;D$chr17.trna287-ValTAC;;;D$chr18.trna250-GlyGCC;;;;;;D$chr20.trna189-CysGCA;;;D$chr21.trna159-AlaCGC;;;D$chr22.trna166-ArgCCT;;;;;;D$chr25.trna67-PheGAA;;;D$Zv8_NA2021.trna1-AsnGTT;;;;D$Zv8_scaffold3058.trna144-ThrTGT
F$chrB3;ArgCCG;;B$chr1;GluTTC;;D$chr4.trna10052-TyrGTA;;;;;;D$chr2.trna185-AsnGTT;;;D$chr3.trna160-PheGAA;;;D$chr5.trna20-ProCGG;;;;;;D$chr7.trna308-LeuTAG;;;D$chr8.trna164-GlnTTG;;;D$chr9.trna191-MetCAT;;;;;;D$chr12.trna255-ArgTCT;;;D$chr13.trna77-ProTGG;;;;;;D$chr15.trna312-TyrGTA;;;;;;D$chr17.trna289-MetCAT;;;D$chr18.trna251-GlyGCC;;;;;;D$chr20.trna19-SerCGA;;;D$chr21.trna160-AlaTGC;;;D$chr22.trna167-MetCAT;;;;;;D$chr25.trna68-IleAAT;;;D$Zv8_NA2021.trna2-LysCTT;;;;D$Zv8_scaffold3058.trna145-ThrAGT
F$chrC2;ArgCCG;;B$chr1;GluTTC;;D$chr4.trna10053-ArgACG;;;;;;D$chr2.trna189-GlnCTG;;;D$chr3.trna162-GlnCTG;;;D$chr5.trna202-AspGTC;;;;;;D$chr7.trna309-LeuAAG;;;D$chr8.trna166-ProTGG;;;D$chr9.trna192-MetCAT;;;;;;D$chr12.trna256-ThrTGT;;;D$chr13.trna78-ProAGG;;;;;;D$chr15.trna313-ArgACG;;;;;;D$chr17.trna29-ThrCGT;;;D$chr18.trna252-GlyCCC;;;;;;D$chr20.trna191-CysGCA;;;D$chr21.trna161-AlaTGC;;;D$chr22.trna168-ArgCCT;;;;;;D$chr25.trna69-PheGAA;;;D$Zv8_NA2021.trna4-AsnGTT;;;;D$Zv8_scaffold3058.trna146-ArgTCT
F$chrC2;ArgCCG;;B$chr1;GluTTC;;D$chr4.trna10054-GluTTC;;;;;;D$chr2.trna190-IleAAT;;;D$chr3.trna163-IleAAT;;;D$chr5.trna204-AspGTC;;;;;;D$chr7.trna31-AsnGTT;;;D$chr8.trna167-ProAGG;;;D$chr9.trna193-IleTAT;;;;;;D$chr12.trna257-ArgTCT;;;D$chr13.trna79-GlnTTG;;;;;;D$chr15.trna314-TyrGTA;;;;;;D$chr17.trna290-ValTAC;;;D$chr18.trna254-GlyCCC;;;;;;D$chr20.trna193-CysGCA;;;D$chr21.trna162-AlaTGC;;;D$chr22.trna169-MetCAT;;;;;;D$chr25.trna70-IleAAT;;;D$Zv8_NA232.trna2-ArgTCG;;;;D$Zv8_scaffold3058.trna149-LysTTT
F$chrD2;ArgCCG;;B$chr1;GluTTC;;D$chr4.trna10055-TyrGTA;;;;;;D$chr2.trna191-PheGAA;;;D$chr3.trna164-PheGAA;;;D$chr5.trna205-AspGTC;;;;;;D$chr7.trna310-LeuTAG;;;D$chr8.trna168-GlnTTG;;;D$chr9.trna194-MetCAT;;;;;;D$chr12.trna258-ThrAGT;;;D$chr13.trna80-ProTGG;;;;;;D$chr15.trna315-ArgACG;;;;;;D$chr17.trna293-ValTAC;;;D$chr18.trna256-GlyGCC;;;;;;D$chr20.trna195-CysGCA;;;D$chr21.trna163-AlaTGC;;;D$chr22.trna170-ArgCCT;;;;;;D$chr25.trna71-PheGAA;;;D$Zv8_NA232.trna4-GlnCTG;;;;D$Zv8_scaffold3058.trna15-SerTGA
F$chrD2;ArgCCG;;B$chr1;GluTTC;;D$chr4.trna10056-ArgACG;;;;;;D$chr2.trna192-GlnCTG;;;D$chr3.trna166-GlnCTG;;;D$chr5.trna207-AspGTC;;;;;;D$chr7.trna311-LeuAAG;;;D$chr8.trna170-ProTGG;;;D$chr9.trna195-MetCAT;;;;;;D$chr12.trna259-ArgTCT;;;D$chr13.trna81-ProTGG;;;;;;D$chr15.trna316-TyrGTA;;;;;;D$chr17.trna295-ValCAC;;;D$chr18.trna257-GlyGCC;;;;;;D$chr20.trna197-CysGCA;;;D$chr21.trna164-AlaTGC;;;D$chr22.trna171-MetCAT;;;;;;D$chr25.trna72-IleAAT;;;D$Zv8_NA232.trna5-ArgCCG;;;;D$Zv8_scaffold3058.trna150-SerAGA
F$chrD3;ArgCCG;;B$chr1;GluTTC;;D$chr4.trna10057-GluTTC;;;;;;D$chr2.trna193-IleAAT;;;D$chr3.trna167-IleAAT;;;D$chr5.trna209-AspGTC;;;;;;D$chr7.trna312-LeuTAG;;;D$chr8.trna171-ProAGG;;;D$chr9.trna196-MetCAT;;;;;;D$chr12.trna26-AsnGTT;;;;;;;;;D$chr15.trna317-ArgACG;;;;;;D$chr17.trna296-ValTAC;;;D$chr18.trna258-GlyCCC;;;;;;D$chr20.trna199-CysGCA;;;D$chr21.trna165-AlaCGC;;;D$chr22.trna172-ArgCCT;;;;;;D$chr25.trna73-PheGAA;;;D$Zv8_NA2419.trna1-LysTTT;;;;D$Zv8_scaffold3058.trna151-HisGTG
F$chrD4;ArgCCG;;B$chr1;GluTTC;;D$chr4.trna10058-TyrGTA;;;;;;D$chr2.trna194-PheGAA;;;D$chr3.trna168-PheGAA;;;D$chr5.trna21-ProCGG;;;;;;D$chr7.trna313-LeuAAG;;;D$chr8.trna172-GlnTTG;;;D$chr9.trna197-MetCAT;;;;;;D$chr12.trna260-ThrAGT;;;;;;;;;D$chr15.trna318-TyrGTA;;;;;;D$chr17.trna299-ValGAC;;;D$chr18.trna260-GlyCCC;;;;;;D$chr20.trna20-LysTTT;;;D$chr21.trna166-AlaTGC;;;D$chr22.trna173-MetCAT;;;;;;D$chr25.trna74-PheGAA;;;D$Zv8_NA2419.trna2-SerAGA;;;;D$Zv8_scaffold3058.trna152-LysTTT
F$chrD4;ArgCCG;;B$chr1;GluTTC;;D$chr4.trna10059-ArgACG;;;;;;D$chr2.trna195-GlnCTG;;;D$chr3.trna170-GlnCTG;;;D$chr5.trna211-AspGTC;;;;;;D$chr7.trna314-LeuTAG;;;D$chr8.trna174-ProTGG;;;D$chr9.trna198-MetCAT;;;;;;D$chr12.trna262-ThrAGT;;;;;;;;;D$chr15.trna319-ArgACG;;;;;;D$chr17.trna300-ValCAC;;;D$chr18.trna261-GlyGCC;;;;;;D$chr20.trna201-CysGCA;;;D$chr21.trna167-AlaTGC;;;D$chr22.trna174-ArgCCT;;;;;;D$chr25.trna75-IleAAT;;;D$Zv8_NA2419.trna3-SerCGA;;;;D$Zv8_scaffold3058.trna153-SerAGA
F$chrE1;ArgCCG;;B$chr1;GluTTC;;D$chr4.trna1006-GlyCCC;;;;;;D$chr2.trna196-IleAAT;;;D$chr3.trna171-IleAAT;;;D$chr5.trna213-AspGTC;;;;;;D$chr7.trna315-LeuAAG;;;D$chr8.trna175-ProAGG;;;D$chr9.trna199-MetCAT;;;;;;D$chr12.trna263-ArgTCT;;;;;;;;;D$chr15.trna32-AsnGTT;;;;;;D$chr17.trna301-ValTAC;;;D$chr18.trna262-GlyCCC;;;;;;D$chr20.trna203-CysGCA;;;D$chr21.trna168-AlaTGC;;;D$chr22.trna175-MetCAT;;;;;;D$chr25.trna76-PheGAA;;;D$Zv8_NA2419.trna4-TyrGTA;;;;D$Zv8_scaffold3058.trna154-HisGTG
F$chrE1;ArgCCG;;B$chr1;GluTTC;;D$chr4.trna10060-GluTTC;;;;;;D$chr2.trna198-GlnCTG;;;D$chr3.trna172-PheGAA;;;D$chr5.trna215-AspGTC;;;;;;D$chr7.trna316-LeuTAG;;;D$chr8.trna176-GlnTTG;;;D$chr9.trna200-MetCAT;;;;;;D$chr12.trna264-ThrAGT;;;;;;;;;D$chr15.trna320-TyrGTA;;;;;;D$chr17.trna303-ValCAC;;;D$chr18.trna263-GlyGCC;;;;;;D$chr20.trna205-CysGCA;;;D$chr21.trna169-AlaCGC;;;D$chr22.trna176-ArgCCT;;;;;;D$chr25.trna77-IleAAT;;;D$Zv8_NA2548.trna2-LeuAAG;;;;D$Zv8_scaffold3058.trna155-LysTTT
F$chrE1;ArgCCG;;B$chr1;GluTTC;;D$chr4.trna10061-TyrGTA;;;;;;D$chr2.trna199-IleAAT;;;D$chr3.trna174-GlnCTG;;;D$chr5.trna217-AspGTC;;;;;;D$chr7.trna317-LeuAAG;;;D$chr8.trna178-ProTGG;;;D$chr9.trna201-MetCAT;;;;;;D$chr12.trna266-ThrAGT;;;;;;;;;D$chr15.trna321-ArgACG;;;;;;D$chr17.trna304-ValTAC;;;D$chr18.trna264-GlyGCC;;;;;;D$chr20.trna207-CysGCA;;;D$chr21.trna170-AlaTGC;;;D$chr22.trna177-IleTAT;;;;;;D$chr25.trna78-IleAAT;;;D$Zv8_NA2662.trna1-MetCAT;;;;D$Zv8_scaffold3058.trna156-LeuCAG
F$chrE2;ArgCCG;;B$chr1;GluTTC;;D$chr4.trna10062-ArgACG;;;;;;D$chr2.trna202-IleAAT;;;D$chr3.trna175-IleAAT;;;D$chr5.trna219-AspGTC;;;;;;D$chr7.trna318-LeuTAG;;;D$chr8.trna179-ProAGG;;;D$chr9.trna202-MetCAT;;;;;;D$chr12.trna267-ArgTCT;;;;;;;;;D$chr15.trna322-TyrGTA;;;;;;D$chr17.trna307-ValGAC;;;D$chr18.trna266-GlyGCC;;;;;;D$chr20.trna209-CysGCA;;;D$chr21.trna171-AlaTGC;;;D$chr22.trna178-ArgCCT;;;;;;D$chr25.trna79-PheGAA;;;D$Zv8_NA2662.trna10-GluTTC;;;;D$Zv8_scaffold3058.trna157-LeuCAG
F$chrE3;ArgCCG;;B$chr1;GlyCCC;;D$chr4.trna10063-GluTTC;;;;;;D$chr2.trna205-IleAAT;;;D$chr3.trna176-PheGAA;;;D$chr5.trna22-ProAGG;;;;;;D$chr7.trna319-LeuAAG;;;D$chr8.trna180-GlnTTG;;;D$chr9.trna203-MetCAT;;;;;;D$chr12.trna268-ThrAGT;;;;;;;;;D$chr15.trna323-ArgACG;;;;;;D$chr17.trna308-ValCAC;;;D$chr18.trna267-GlyGCC;;;;;;D$chr20.trna211-CysGCA;;;D$chr21.trna172-AlaTGC;;;D$chr22.trna179-IleTAT;;;;;;D$chr25.trna80-IleAAT;;;D$Zv8_NA2662.trna11-TyrGTA;;;;D$Zv8_scaffold3058.trna158-LeuCAG
F$chrE3;ArgCCG;;B$chr1;GlyCCC;;D$chr4.trna10064-TyrGTA;;;;;;D$chr2.trna207-GlnCTG;;;D$chr3.trna178-GlnCTG;;;D$chr5.trna220-AspGTC;;;;;;D$chr7.trna320-LeuTAG;;;D$chr8.trna182-ProTGG;;;D$chr9.trna204-IleTAT;;;;;;D$chr12.trna269-ArgTCT;;;;;;;;;D$chr15.trna324-TyrGTA;;;;;;D$chr17.trna309-ValTAC;;;D$chr18.trna268-GlyCCC;;;;;;D$chr20.trna213-CysGCA;;;D$chr21.trna173-AlaTGC;;;D$chr22.trna180-ArgCCT;;;;;;D$chr25.trna81-PheGAA;;;D$Zv8_NA2662.trna12-ArgACG;;;;D$Zv8_scaffold3058.trna159-LeuCAG
F$chrE3;ArgCCG;;B$chr1;GlyCCC;;D$chr4.trna10065-ArgACG;;;;;;D$chr2.trna208-IleAAT;;;D$chr3.trna179-IleAAT;;;D$chr5.trna222-AspGTC;;;;;;D$chr7.trna321-LeuAAG;;;D$chr8.trna183-ProAGG;;;D$chr9.trna205-MetCAT;;;;;;D$chr12.trna27-LysCTT;;;;;;;;;D$chr15.trna325-ArgACG;;;;;;D$chr17.trna310-ValAAC;;;D$chr18.trna269-GlyGCC;;;;;;D$chr20.trna215-CysGCA;;;D$chr21.trna174-AlaTGC;;;D$chr22.trna181-MetCAT;;;;;;D$chr25.trna82-IleAAT;;;D$Zv8_NA2662.trna2-MetCAT;;;;D$Zv8_scaffold3058.trna16-ValAAC
F$chrF1;ArgCCG;;B$chr1;GlyCCC;;D$chr4.trna10066-LeuCAG;;;;;;D$chr2.trna209-PheGAA;;;D$chr3.trna180-PheGAA;;;D$chr5.trna224-AspGTC;;;;;;D$chr7.trna322-LeuTAG;;;D$chr8.trna184-GlnTTG;;;D$chr9.trna206-MetCAT;;;;;;D$chr12.trna270-ThrAGT;;;;;;;;;D$chr15.trna326-TyrGTA;;;;;;D$chr17.trna311-ValCAC;;;D$chr18.trna270-GlyGCC;;;;;;D$chr20.trna217-CysGCA;;;D$chr21.trna175-AlaCGC;;;D$chr22.trna182-ArgCCT;;;;;;D$chr25.trna83-PheGAA;;;D$Zv8_NA2662.trna3-MetCAT;;;;D$Zv8_scaffold3058.trna160-LeuCAG
F$chrF1;ArgCCG;;B$chr1;GlyCCC;;D$chr4.trna10067-LeuCAG;;;;;;D$chr2.trna210-GlnCTG;;;D$chr3.trna182-GlnCTG;;;D$chr5.trna226-AspGTC;;;;;;D$chr7.trna323-LeuAAG;;;D$chr8.trna186-ProTGG;;;D$chr9.trna207-MetCAT;;;;;;D$chr12.trna271-ArgTCT;;;;;;;;;D$chr15.trna327-ArgACG;;;;;;D$chr17.trna312-MetCAT;;;D$chr18.trna273-GlyCCC;;;;;;D$chr20.trna219-CysGCA;;;D$chr21.trna176-AlaTGC;;;D$chr22.trna183-MetCAT;;;;;;D$chr25.trna84-IleAAT;;;D$Zv8_NA2662.trna4-MetCAT;;;;D$Zv8_scaffold3058.trna161-LeuCAG
F$chrX;ArgCCG;;B$chr1;GlyCCC;;D$chr4.trna10068-LeuCAG;;;;;;D$chr2.trna211-IleAAT;;;D$chr3.trna183-IleAAT;;;D$chr5.trna228-AspGTC;;;;;;D$chr7.trna324-LeuTAG;;;D$chr8.trna187-ProAGG;;;D$chr9.trna208-MetCAT;;;;;;D$chr12.trna272-ThrTGT;;;;;;;;;D$chr15.trna328-TyrGTA;;;;;;D$chr17.trna313-AspATC;;;D$chr18.trna274-GlyGCC;;;;;;D$chr20.trna221-CysGCA;;;D$chr21.trna177-AlaTGC;;;D$chr22.trna184-ArgCCT;;;;;;D$chr25.trna85-PheGAA;;;D$Zv8_NA2662.trna5-GluCTC;;;;D$Zv8_scaffold3058.trna162-LeuCAG
F$chrX;ArgCCG;;B$chr1;GlyCCC;;D$chr4.trna10069-LeuCAG;;;;;;D$chr2.trna212-PheGAA;;;D$chr3.trna184-PheGAA;;;D$chr5.trna23-ProAGG;;;;;;D$chr7.trna325-LeuAAG;;;D$chr8.trna188-GlnTTG;;;D$chr9.trna209-MetCAT;;;;;;D$chr12.trna274-ThrAGT;;;;;;;;;D$chr15.trna329-ArgACG;;;;;;D$chr17.trna314-MetCAT;;;D$chr18.trna275-GlyGCC;;;;;;D$chr20.trna223-CysGCA;;;D$chr21.trna178-AlaTGC;;;D$chr22.trna185-MetCAT;;;;;;D$chr25.trna86-IleAAT;;;D$Zv8_NA2662.trna6-GluCTC;;;;D$Zv8_scaffold3058.trna164-LeuCAG
F$chrX;ArgCCG;;B$chr1;GlyCCC;;D$chr4.trna1007-GlyGCC;;;;;;D$chr2.trna213-GlnCTG;;;D$chr3.trna186-GlnCTG;;;D$chr5.trna230-AspGTC;;;;;;D$chr7.trna326-LeuTAG;;;D$chr8.trna190-ProTGG;;;D$chr9.trna210-MetCAT;;;;;;D$chr12.trna275-ArgTCT;;;;;;;;;D$chr15.trna330-TyrGTA;;;;;;D$chr17.trna317-ValTAC;;;D$chr18.trna279-GlyCCC;;;;;;D$chr20.trna225-CysGCA;;;D$chr21.trna179-AlaTGC;;;D$chr22.trna186-ArgCCT;;;;;;D$chr25.trna87-PheGAA;;;D$Zv8_NA2662.trna7-GluTTC;;;;D$Zv8_scaffold3058.trna165-LeuCAG
F$chrA1;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10070-LeuCAG;;;;;;D$chr2.trna214-IleAAT;;;D$chr3.trna187-IleAAT;;;D$chr5.trna232-AspGTC;;;;;;D$chr7.trna327-LeuAAG;;;D$chr8.trna191-ProAGG;;;D$chr9.trna211-MetCAT;;;;;;D$chr12.trna276-ThrAGT;;;;;;;;;D$chr15.trna331-ArgACG;;;;;;D$chr17.trna318-ValAAC;;;D$chr18.trna281-GlyGCC;;;;;;D$chr20.trna227-CysGCA;;;D$chr21.trna180-AlaTGC;;;D$chr22.trna187-MetCAT;;;;;;D$chr25.trna88-IleAAT;;;D$Zv8_NA2662.trna8-TyrGTA;;;;D$Zv8_scaffold3058.trna166-LeuCAG
F$chrA1;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10071-LeuCAG;;;;;;D$chr2.trna215-PheGAA;;;D$chr3.trna188-PheGAA;;;D$chr5.trna234-AspGTC;;;;;;D$chr7.trna329-LeuAAG;;;D$chr8.trna192-GlnTTG;;;D$chr9.trna212-MetCAT;;;;;;D$chr12.trna277-ArgTCT;;;;;;;;;D$chr15.trna332-TyrGTA;;;;;;D$chr17.trna321-ValCAC;;;D$chr18.trna282-GlyCCC;;;;;;D$chr20.trna229-CysGCA;;;D$chr21.trna181-AlaCGC;;;D$chr22.trna190-MetCAT;;;;;;D$chr25.trna89-PheGAA;;;D$Zv8_NA2662.trna9-ArgACG;;;;D$Zv8_scaffold3058.trna167-LeuCAG
F$chrA2;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10072-LeuCAG;;;;;;D$chr2.trna216-GlnCTG;;;D$chr3.trna190-GlnCTG;;;D$chr5.trna236-AspGTC;;;;;;D$chr7.trna330-LeuTAG;;;D$chr8.trna195-ProAGG;;;D$chr9.trna213-MetCAT;;;;;;D$chr12.trna278-ThrTGT;;;;;;;;;D$chr15.trna333-ArgACG;;;;;;D$chr17.trna325-ValTAC;;;D$chr18.trna283-GlyGCC;;;;;;D$chr20.trna231-CysGCA;;;D$chr21.trna182-AlaTGC;;;D$chr22.trna191-MetCAT;;;;;;D$chr25.trna90-IleAAT;;;D$Zv8_NA2737.trna1-HisGTG;;;;D$Zv8_scaffold3058.trna168-GlnCTG
F$chrA2;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10073-LeuCAG;;;;;;D$chr2.trna218-PheGAA;;;D$chr3.trna191-IleAAT;;;D$chr5.trna238-AspGTC;;;;;;D$chr7.trna331-LeuAAG;;;D$chr8.trna196-GlnTTG;;;D$chr9.trna214-MetCAT;;;;;;D$chr12.trna279-ArgTCT;;;;;;;;;D$chr15.trna334-TyrGTA;;;;;;D$chr17.trna327-ValCAC;;;D$chr18.trna284-GlyCCC;;;;;;D$chr20.trna232-CysGCA;;;D$chr21.trna183-AlaCGC;;;D$chr22.trna194-MetCAT;;;;;;D$chr25.trna91-PheGAA;;;D$Zv8_NA2737.trna2-LysTTT;;;;D$Zv8_scaffold3058.trna169-IleAAT
F$chrA2;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10074-GluTTC;;;;;;D$chr2.trna219-ThrAGT;;;D$chr3.trna192-PheGAA;;;D$chr5.trna24-ProCGG;;;;;;D$chr7.trna332-LeuTAG;;;D$chr8.trna198-ProTGG;;;D$chr9.trna215-MetCAT;;;;;;D$chr12.trna28-AsnGTT;;;;;;;;;D$chr15.trna335-ArgACG;;;;;;D$chr17.trna33-ProAGG;;;D$chr18.trna285-GlyCCC;;;;;;D$chr20.trna233-CysGCA;;;D$chr21.trna184-AlaTGC;;;D$chr22.trna195-LysCTT;;;;;;D$chr25.trna92-IleAAT;;;D$Zv8_NA2737.trna3-SerTGA;;;;D$Zv8_scaffold3058.trna17-ValCAC
F$chrA2;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10077-LysTTT;;;;;;D$chr2.trna220-ArgTCT;;;D$chr3.trna194-GlnCTG;;;D$chr5.trna240-AspGTC;;;;;;D$chr7.trna333-LeuAAG;;;D$chr8.trna199-ProAGG;;;D$chr9.trna216-MetCAT;;;;;;D$chr12.trna280-ThrTGT;;;;;;;;;D$chr15.trna336-TyrGTA;;;;;;D$chr17.trna34-LysTTT;;;D$chr18.trna286-GlyCCC;;;;;;D$chr20.trna234-PheGAA;;;D$chr21.trna185-AlaTGC;;;D$chr22.trna197-MetCAT;;;;;;D$chr25.trna93-PheGAA;;;D$Zv8_NA2779.trna1-CysGCA;;;;D$Zv8_scaffold3058.trna170-AsnGTT
F$chrA2;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10078-SerAGA;;;;;;D$chr2.trna221-ThrTGT;;;D$chr3.trna195-IleAAT;;;D$chr5.trna242-AspGTC;;;;;;D$chr7.trna335-SerGCT;;;D$chr8.trna200-GlnTTG;;;D$chr9.trna218-MetCAT;;;;;;D$chr12.trna281-ArgTCT;;;;;;;;;D$chr15.trna338-TyrGTA;;;;;;D$chr17.trna35-SerCGA;;;D$chr18.trna287-GlyGCC;;;;;;D$chr20.trna237-CysGCA;;;D$chr21.trna186-AlaTGC;;;D$chr22.trna198-MetCAT;;;;;;D$chr25.trna94-IleAAT;;;D$Zv8_NA2779.trna2-CysGCA;;;;D$Zv8_scaffold3058.trna171-LysCTT
F$chrA3;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10079-HisGTG;;;;;;D$chr2.trna222-ThrAGT;;;D$chr3.trna196-PheGAA;;;D$chr5.trna244-AspGTC;;;;;;D$chr7.trna44-ArgACG;;;D$chr8.trna202-ProTGG;;;D$chr9.trna219-MetCAT;;;;;;D$chr12.trna282-ThrTGT;;;;;;;;;D$chr15.trna34-LysCTT;;;;;;D$chr17.trna356-SerGCT;;;D$chr18.trna289-ThrTGT;;;;;;D$chr20.trna240-CysGCA;;;D$chr21.trna187-AlaCGC;;;D$chr22.trna214-LeuAAG;;;;;;D$chr25.trna95-PheGAA;;;D$Zv8_NA2809.trna1-GlyGCC;;;;D$Zv8_scaffold3058.trna172-IleGAT
F$chrB1;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna1008-GlyGCC;;;;;;D$chr2.trna223-LysTTT;;;D$chr3.trna198-GlnCTG;;;D$chr5.trna246-AspGTC;;;;;;D$chr7.trna445-LysTTT;;;D$chr8.trna203-ProAGG;;;D$chr9.trna257-ArgCCT;;;;;;D$chr12.trna284-ThrAGT;;;;;;;;;D$chr15.trna340-TyrGTA;;;;;;D$chr17.trna361-SerGCT;;;D$chr18.trna290-LysTTT;;;;;;D$chr20.trna244-LeuCAA;;;D$chr21.trna188-AlaTGC;;;D$chr22.trna215-LeuTAG;;;;;;D$chr25.trna96-IleAAT;;;D$Zv8_NA2809.trna10-GlyCCC;;;;D$Zv8_scaffold3058.trna173-LysCTT
F$chrB1;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10081-SerTGA;;;;;;D$chr2.trna224-ThrTGT;;;D$chr3.trna199-IleAAT;;;D$chr5.trna248-AspGTC;;;;;;D$chr7.trna446-SerCGA;;;D$chr8.trna204-GlnTTG;;;D$chr9.trna258-ArgCCT;;;;;;D$chr12.trna285-ArgTCT;;;;;;;;;D$chr15.trna342-TyrGTA;;;;;;D$chr17.trna366-SerGCT;;;D$chr18.trna291-LeuTAA;;;;;;D$chr20.trna246-PheAAA;;;D$chr21.trna189-AlaTGC;;;D$chr22.trna216-LeuAAG;;;;;;D$chr25.trna97-PheGAA;;;D$Zv8_NA2809.trna2-GlyGCC;;;;D$Zv8_scaffold3058.trna174-LysCTT
F$chrB2;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10082-HisGTG;;;;;;D$chr2.trna225-ThrAGT;;;D$chr3.trna200-PheGAA;;;D$chr5.trna25-ProAGG;;;;;;D$chr7.trna448-AsnGTT;;;D$chr8.trna206-ProTGG;;;D$chr9.trna259-ArgCCT;;;;;;D$chr12.trna286-ThrAGT;;;;;;;;;D$chr15.trna344-TyrGTA;;;;;;D$chr17.trna371-SerGCT;;;D$chr18.trna292-PheGAA;;;;;;D$chr20.trna247-LeuCAA;;;D$chr21.trna190-AlaTGC;;;D$chr22.trna217-LeuTAG;;;;;;D$chr25.trna98-IleAAT;;;D$Zv8_NA2809.trna3-GlyGCC;;;;D$Zv8_scaffold3058.trna175-AsnGTT
F$chrB2;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10085-ValAAC;;;;;;D$chr2.trna226-ArgTCT;;;D$chr3.trna202-GlnCTG;;;D$chr5.trna250-AspGTC;;;;;;D$chr7.trna449-LysCTT;;;D$chr8.trna207-ProAGG;;;D$chr9.trna260-ArgCCT;;;;;;D$chr12.trna287-ArgTCT;;;;;;;;;D$chr15.trna345-HisATG;;;;;;D$chr17.trna376-SerGCT;;;D$chr18.trna293-SupCTA;;;;;;D$chr20.trna249-LeuCAA;;;D$chr21.trna191-AlaCGC;;;D$chr22.trna218-GluCTC;;;;;;D$chr25.trna99-PheGAA;;;D$Zv8_NA2809.trna4-ArgCCT;;;;D$Zv8_scaffold3058.trna176-LysCTT
F$chrB3;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10086-ValCAC;;;;;;D$chr2.trna232-ArgGCG;;;D$chr3.trna203-IleAAT;;;D$chr5.trna252-AspGTC;;;;;;D$chr7.trna45-ArgACG;;;D$chr8.trna208-GlnTTG;;;D$chr9.trna261-ArgCCT;;;;;;D$chr12.trna288-ThrAGT;;;;;;;;;D$chr15.trna346-TyrGTA;;;;;;D$chr17.trna381-SerGCT;;;D$chr18.trna294-IleAAT;;;;;;D$chr20.trna250-LeuCAA;;;D$chr21.trna192-AlaCGC;;;D$chr22.trna221-ValAAC;;;;;;;;;D$Zv8_NA2809.trna7-GlyCCC;;;;D$Zv8_scaffold3058.trna177-LysCTT
F$chrB3;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10088-SerGCT;;;;;;D$chr2.trna233-GlyGCC;;;D$chr3.trna204-PheGAA;;;D$chr5.trna254-AspGTC;;;;;;D$chr7.trna450-AsnGTT;;;D$chr8.trna210-ProTGG;;;D$chr9.trna262-ArgCCT;;;;;;D$chr12.trna289-ArgTCT;;;;;;;;;D$chr15.trna347-ArgACG;;;;;;D$chr17.trna386-SerGCT;;;D$chr18.trna295-GlnCTG;;;;;;D$chr20.trna251-LeuCAA;;;D$chr21.trna193-AlaTGC;;;D$chr22.trna228-ArgTCT;;;;;;;;;D$Zv8_NA2809.trna9-GlyGCC;;;;D$Zv8_scaffold3058.trna178-AsnGTT
F$chrB3;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna1009-GlyGCC;;;;;;D$chr2.trna236-GlyGCC;;;D$chr3.trna206-GlnCTG;;;D$chr5.trna256-AspGTC;;;;;;D$chr7.trna453-LeuAAG;;;D$chr8.trna211-ProAGG;;;D$chr9.trna263-ArgCCT;;;;;;D$chr12.trna29-LysCTT;;;;;;;;;D$chr15.trna348-TyrGTA;;;;;;D$chr17.trna39-LeuTAA;;;D$chr18.trna298-LeuCAG;;;;;;D$chr20.trna253-LeuCAA;;;D$chr21.trna194-AlaTGC;;;D$chr22.trna229-ThrTGT;;;;;;;;;D$Zv8_NA3022.trna3-LeuTAA;;;;D$Zv8_scaffold3058.trna179-LysCTT
F$chrB3;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10091-LeuCAG;;;;;;D$chr2.trna237-GlyGCC;;;D$chr3.trna207-IleAAT;;;D$chr5.trna258-AspGTC;;;;;;D$chr7.trna454-LeuTAG;;;D$chr8.trna212-GlnTTG;;;D$chr9.trna264-ArgCCT;;;;;;D$chr12.trna290-ThrAGT;;;;;;;;;D$chr15.trna349-ArgACG;;;;;;D$chr17.trna391-SerGCT;;;D$chr18.trna322-AlaTGC;;;;;;D$chr20.trna255-LeuCAA;;;D$chr21.trna195-AlaCGC;;;D$chr22.trna230-ThrAGT;;;;;;;;;D$Zv8_NA3122.trna1-LeuTAA;;;;D$Zv8_scaffold3058.trna18-ValTAC
F$chrB4;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10092-LeuCAG;;;;;;D$chr2.trna242-ArgGCG;;;D$chr3.trna208-PheGAA;;;D$chr5.trna260-AspGTC;;;;;;D$chr7.trna455-LeuAAG;;;D$chr8.trna213-ProAGG;;;D$chr9.trna265-ArgCCT;;;;;;D$chr12.trna291-ArgTCT;;;;;;;;;D$chr15.trna35-LysCTT;;;;;;D$chr17.trna396-SerGCT;;;D$chr18.trna387-GlnCTG;;;;;;D$chr20.trna256-LeuCAA;;;D$chr21.trna196-AlaTGC;;;D$chr22.trna231-ArgTCT;;;;;;;;;D$Zv8_NA3269.trna1-CysGCA;;;;D$Zv8_scaffold3058.trna182-LysCTT
F$chrB4;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10093-LeuCAG;;;;;;D$chr2.trna244-GlyGCC;;;D$chr3.trna210-GlnCTG;;;D$chr5.trna264-AspGTC;;;;;;D$chr7.trna456-LeuTAG;;;D$chr8.trna216-ProTGG;;;D$chr9.trna267-ArgCCT;;;;;;D$chr12.trna292-ThrTGT;;;;;;;;;D$chr15.trna350-TyrGTA;;;;;;D$chr17.trna40-LeuTAA;;;D$chr18.trna85-LeuCAG;;;;;;D$chr20.trna257-LeuCAA;;;D$chr21.trna197-AlaTGC;;;D$chr22.trna232-ThrTGT;;;;;;;;;D$Zv8_NA3269.trna10-CysGCA;;;;D$Zv8_scaffold3058.trna184-ArgCCT
F$chrB4;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10094-ThrAGT;;;;;;D$chr2.trna246-GlyGCC;;;D$chr3.trna211-IleAAT;;;D$chr5.trna266-AspGTC;;;;;;D$chr7.trna457-LeuAAG;;;D$chr8.trna217-ProAGG;;;D$chr9.trna268-ArgCCT;;;;;;D$chr12.trna294-ThrAGT;;;;;;;;;D$chr15.trna351-ArgACG;;;;;;D$chr17.trna401-SerGCT;;;;;;;;;D$chr20.trna258-LeuCAA;;;D$chr21.trna198-AlaTGC;;;D$chr22.trna233-ThrAGT;;;;;;;;;D$Zv8_NA3269.trna11-CysGCA;;;;D$Zv8_scaffold3058.trna185-LysCTT
F$chrB4;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10095-ThrAGT;;;;;;D$chr2.trna247-GlyGCC;;;D$chr3.trna212-PheGAA;;;D$chr5.trna268-AspGTC;;;;;;D$chr7.trna458-LeuTAG;;;D$chr8.trna218-GlnTTG;;;D$chr9.trna269-ArgCCT;;;;;;D$chr12.trna295-ArgTCT;;;;;;;;;D$chr15.trna352-TyrGTA;;;;;;D$chr17.trna406-SerGCT;;;;;;;;;D$chr20.trna260-LeuCAA;;;D$chr21.trna199-AlaCGC;;;D$chr22.trna234-ArgTCT;;;;;;;;;D$Zv8_NA3269.trna12-CysGCA;;;;D$Zv8_scaffold3058.trna186-AsnGTT
F$chrC1;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10096-ArgACG;;;;;;D$chr2.trna251-GlyGCC;;;D$chr3.trna214-GlnCTG;;;D$chr5.trna270-AspGTC;;;;;;D$chr7.trna46-ArgTCG;;;D$chr8.trna220-ProTGG;;;D$chr9.trna270-ArgCCT;;;;;;D$chr12.trna296-ThrTGT;;;;;;;;;D$chr15.trna353-ArgACG;;;;;;D$chr17.trna41-LeuTAA;;;;;;;;;D$chr20.trna261-LeuCAA;;;D$chr21.trna200-AlaTGC;;;D$chr22.trna235-ThrTGT;;;;;;;;;D$Zv8_NA3269.trna13-CysGCA;;;;D$Zv8_scaffold3058.trna187-LysCTT
F$chrC1;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10097-GluTTC;;;;;;D$chr2.trna253-GlyGCC;;;D$chr3.trna215-IleAAT;;;D$chr5.trna272-AspGTC;;;;;;D$chr7.trna47-ArgTCG;;;D$chr8.trna221-ProAGG;;;D$chr9.trna295-LysTTT;;;;;;D$chr12.trna298-ThrAGT;;;;;;;;;D$chr15.trna354-TyrGTA;;;;;;D$chr17.trna410-SerGCT;;;;;;;;;D$chr20.trna262-LeuCAA;;;D$chr21.trna201-AlaTGC;;;D$chr22.trna236-ThrAGT;;;;;;;;;D$Zv8_NA3269.trna14-CysGCA;;;;D$Zv8_scaffold3058.trna19-ValAAC
F$chrC1;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10098-TyrGTA;;;;;;D$chr2.trna254-GlyGCC;;;D$chr3.trna216-PheGAA;;;D$chr5.trna274-AspGTC;;;;;;D$chr7.trna48-ArgTCG;;;D$chr8.trna222-GlnTTG;;;D$chr9.trna296-SerTGA;;;;;;D$chr12.trna299-ArgTCT;;;;;;;;;D$chr15.trna356-TyrGTA;;;;;;D$chr17.trna415-SerGCT;;;;;;;;;D$chr20.trna263-IleTAT;;;D$chr21.trna202-AlaTGC;;;D$chr22.trna237-ArgTCT;;;;;;;;;D$Zv8_NA3269.trna16-CysGCA;;;;D$Zv8_scaffold3058.trna20-AlaCGC
F$chrC1;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10099-SerACT;;;;;;D$chr2.trna255-GlyGCC;;;D$chr3.trna218-GlnCTG;;;D$chr5.trna276-AspGTC;;;;;;D$chr7.trna51-ArgTCG;;;D$chr8.trna224-ProTGG;;;D$chr9.trna297-HisGTG;;;;;;D$chr12.trna30-AsnGTT;;;;;;;;;D$chr15.trna357-ArgACG;;;;;;D$chr17.trna419-SerGCT;;;;;;;;;D$chr20.trna264-LeuCAA;;;D$chr21.trna203-AlaTGC;;;D$chr22.trna238-ThrTGT;;;;;;;;;D$Zv8_NA3269.trna17-CysGCA;;;;D$Zv8_scaffold3058.trna22-ValAAC
F$chrC1;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna1010-GlyCCC;;;;;;D$chr2.trna257-GlyGCC;;;D$chr3.trna219-IleAAT;;;D$chr5.trna278-AspGTC;;;;;;D$chr7.trna52-ArgTCG;;;D$chr8.trna225-ProAGG;;;D$chr9.trna298-LysTTT;;;;;;D$chr12.trna300-ThrAGT;;;;;;;;;D$chr15.trna358-TyrGTA;;;;;;D$chr17.trna42-LeuTAA;;;;;;;;;D$chr20.trna266-LeuCAA;;;D$chr21.trna204-AlaTGC;;;D$chr22.trna239-ThrAGT;;;;;;;;;D$Zv8_NA3269.trna18-CysGCA;;;;D$Zv8_scaffold3058.trna23-ValCAC
F$chrC1;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10100-GluTTC;;;;;;D$chr2.trna258-GlyGCC;;;D$chr3.trna220-PheGAA;;;D$chr5.trna281-AspGTC;;;;;;D$chr7.trna523-TrpCCA;;;D$chr8.trna226-GlnTTG;;;D$chr9.trna299-SerTGA;;;;;;D$chr12.trna301-ArgTCT;;;;;;;;;D$chr15.trna359-ArgACG;;;;;;D$chr17.trna424-SerGCT;;;;;;;;;D$chr20.trna267-LeuCAA;;;D$chr21.trna205-AlaCGC;;;D$chr22.trna240-ArgTCT;;;;;;;;;D$Zv8_NA3269.trna19-CysGCA;;;;D$Zv8_scaffold3058.trna24-ValTAC
F$chrC2;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10101-TyrGTA;;;;;;D$chr2.trna261-GlyGCC;;;D$chr3.trna222-GlnCTG;;;D$chr5.trna282-AspGTC;;;;;;D$chr7.trna524-TrpCCA;;;D$chr8.trna228-ProTGG;;;D$chr9.trna30-ProTGG;;;;;;D$chr12.trna302-ThrAGT;;;;;;;;;D$chr15.trna36-AsnGTT;;;;;;D$chr17.trna429-SerGCT;;;;;;;;;D$chr20.trna268-LeuCAA;;;D$chr21.trna206-AlaTGC;;;D$chr22.trna241-ThrTGT;;;;;;;;;D$Zv8_NA3269.trna2-CysGCA;;;;D$Zv8_scaffold3058.trna25-ValAAC
F$chrC2;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10102-GluTTC;;;;;;D$chr2.trna262-GlyGCC;;;D$chr3.trna223-IleAAT;;;D$chr5.trna284-AspGTC;;;;;;D$chr7.trna526-TrpCCA;;;D$chr8.trna229-ProAGG;;;D$chr9.trna300-HisGTG;;;;;;D$chr12.trna303-ArgTCT;;;;;;;;;D$chr15.trna360-TyrGTA;;;;;;D$chr17.trna43-LeuTAA;;;;;;;;;D$chr20.trna269-LeuCAA;;;D$chr21.trna207-AlaTGC;;;D$chr22.trna242-ThrAGT;;;;;;;;;D$Zv8_NA3269.trna20-CysGCA;;;;D$Zv8_scaffold3058.trna26-AlaCGC
F$chrC2;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10103-TyrGTA;;;;;;D$chr2.trna265-ArgTCT;;;D$chr3.trna224-PheGAA;;;D$chr5.trna286-AspGTC;;;;;;D$chr7.trna527-TrpCCA;;;D$chr8.trna230-GlnTTG;;;D$chr9.trna301-LysTTT;;;;;;D$chr12.trna304-ThrAGT;;;;;;;;;D$chr15.trna361-ArgACG;;;;;;D$chr17.trna434-SerGCT;;;;;;;;;D$chr20.trna270-LeuCAA;;;D$chr21.trna208-AlaTGC;;;D$chr22.trna243-ArgTCT;;;;;;;;;D$Zv8_NA3269.trna21-CysGCA;;;;D$Zv8_scaffold3058.trna28-ValAAC
F$chrC2;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10104-SerACT;;;;;;D$chr2.trna283-MetCAT;;;D$chr3.trna226-GlnCTG;;;D$chr5.trna288-AspGTC;;;;;;D$chr7.trna528-TrpCCA;;;D$chr8.trna231-ProAGG;;;D$chr9.trna302-SerTGA;;;;;;D$chr12.trna305-ArgTCT;;;;;;;;;D$chr15.trna362-TyrGTA;;;;;;D$chr17.trna439-SerGCT;;;;;;;;;D$chr20.trna271-LeuCAA;;;D$chr21.trna209-AlaTGC;;;D$chr22.trna244-ThrTGT;;;;;;;;;D$Zv8_NA3269.trna22-CysGCA;;;;D$Zv8_scaffold3058.trna29-ValCAC
F$chrC2;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10106-GlyGCC;;;;;;D$chr2.trna291-TrpCCA;;;D$chr3.trna227-IleAAT;;;D$chr5.trna290-AspGTC;;;;;;D$chr7.trna529-TrpCCA;;;D$chr8.trna232-GlnTTG;;;D$chr9.trna303-HisGTG;;;;;;D$chr12.trna306-ThrTGT;;;;;;;;;D$chr15.trna364-TyrGTA;;;;;;D$chr17.trna445-SerGCT;;;;;;;;;D$chr20.trna272-LeuCAA;;;D$chr21.trna210-AlaCGC;;;D$chr22.trna245-ThrAGT;;;;;;;;;D$Zv8_NA3269.trna23-CysGCA;;;;D$Zv8_scaffold3058.trna30-MetCAT
F$chrD1;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10107-GlyCCC;;;;;;D$chr2.trna307-LeuTAA;;;D$chr3.trna228-PheGAA;;;D$chr5.trna292-AspGTC;;;;;;D$chr7.trna53-ArgTCG;;;D$chr8.trna234-ProTGG;;;D$chr9.trna304-LysTTT;;;;;;D$chr12.trna308-ThrAGT;;;;;;;;;D$chr15.trna365-ArgACG;;;;;;D$chr17.trna45-LeuTAA;;;;;;;;;D$chr20.trna275-LeuCAA;;;D$chr21.trna211-AlaTGC;;;D$chr22.trna246-ArgTCT;;;;;;;;;D$Zv8_NA3269.trna24-CysGCA;;;;D$Zv8_scaffold3058.trna31-MetCAT
F$chrD1;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10108-GlyCCC;;;;;;D$chr2.trna308-LeuTAA;;;D$chr3.trna230-GlnCTG;;;D$chr5.trna293-AspGTC;;;;;;D$chr7.trna530-TrpCCA;;;D$chr8.trna235-ProAGG;;;D$chr9.trna305-SerTGA;;;;;;D$chr12.trna309-ArgTCT;;;;;;;;;D$chr15.trna375-SeC(e)TCA;;;;;;D$chr17.trna450-SerGCT;;;;;;;;;D$chr20.trna276-LeuCAA;;;D$chr21.trna212-AlaTGC;;;D$chr22.trna247-ThrTGT;;;;;;;;;D$Zv8_NA3269.trna25-CysGCA;;;;D$Zv8_scaffold3058.trna32-MetCAT
F$chrD2;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10109-GlyGCC;;;;;;D$chr2.trna309-LeuTAA;;;D$chr3.trna231-IleAAT;;;D$chr5.trna294-AspGTC;;;;;;D$chr7.trna531-TrpCCA;;;D$chr8.trna236-GlnTTG;;;D$chr9.trna306-LysTTT;;;;;;D$chr12.trna31-AsnGTT;;;;;;;;;D$chr15.trna378-GluTTC;;;;;;D$chr17.trna455-SerGCT;;;;;;;;;D$chr20.trna278-LeuCAA;;;D$chr21.trna213-AlaCGC;;;D$chr22.trna248-ThrAGT;;;;;;;;;D$Zv8_NA3269.trna26-CysGCA;;;;D$Zv8_scaffold3058.trna33-MetCAT
F$chrD4;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna1011-GlyGCC;;;;;;D$chr2.trna310-LeuTAA;;;D$chr3.trna232-PheGAA;;;D$chr5.trna296-AspGTC;;;;;;D$chr7.trna532-TrpCCA;;;D$chr8.trna238-ProTGG;;;D$chr9.trna307-SerAGA;;;;;;D$chr12.trna310-ThrTGT;;;;;;;;;D$chr15.trna379-TyrGTA;;;;;;D$chr17.trna459-SerGCT;;;;;;;;;D$chr20.trna279-IleTAT;;;D$chr21.trna214-AlaTGC;;;D$chr22.trna249-ArgTCT;;;;;;;;;D$Zv8_NA3269.trna27-CysGCA;;;;D$Zv8_scaffold3058.trna34-MetCAT
F$chrE1;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10110-GlyGCC;;;;;;D$chr2.trna312-LeuTAA;;;D$chr3.trna234-GlnCTG;;;D$chr5.trna297-AspGTC;;;;;;D$chr7.trna533-TrpCCA;;;D$chr8.trna239-ProAGG;;;D$chr9.trna308-HisGTG;;;;;;D$chr12.trna312-ThrAGT;;;;;;;;;D$chr15.trna38-LysCTT;;;;;;D$chr17.trna46-SupTTA;;;;;;;;;D$chr20.trna280-LeuCAA;;;D$chr21.trna215-AlaTGC;;;D$chr22.trna250-ThrTGT;;;;;;;;;D$Zv8_NA3269.trna3-CysGCA;;;;D$Zv8_scaffold3058.trna35-MetCAT
F$chrE1;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10117-GlyCCC;;;;;;D$chr2.trna313-LeuTAA;;;D$chr3.trna235-IleAAT;;;D$chr5.trna299-AspGTC;;;;;;D$chr7.trna534-TrpCCA;;;D$chr8.trna240-GlnTTG;;;D$chr9.trna309-LysTTT;;;;;;D$chr12.trna313-ArgTCT;;;;;;;;;D$chr15.trna380-ArgACG;;;;;;D$chr17.trna464-SerGCT;;;;;;;;;D$chr20.trna281-LeuCAA;;;D$chr21.trna216-AlaTGC;;;D$chr22.trna251-ThrAGT;;;;;;;;;D$Zv8_NA3269.trna30-CysGCA;;;;D$Zv8_scaffold3058.trna36-MetCAT
F$chrE1;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10118-GlyGCC;;;;;;D$chr2.trna315-ThrAGT;;;D$chr3.trna236-PheGAA;;;D$chr5.trna301-AspGTC;;;;;;D$chr7.trna535-TrpCCA;;;D$chr8.trna242-ProTGG;;;D$chr9.trna310-SerTGA;;;;;;D$chr12.trna314-ThrAGT;;;;;;;;;D$chr15.trna381-GluTTC;;;;;;D$chr17.trna471-SerGCT;;;;;;;;;D$chr20.trna282-LeuCAA;;;D$chr21.trna217-AlaCGC;;;D$chr22.trna252-ArgTCT;;;;;;;;;D$Zv8_NA3269.trna31-CysGCA;;;;D$Zv8_scaffold3058.trna37-MetCAT
F$chrE1;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna1012-GlyCCC;;;;;;D$chr2.trna316-ArgTCT;;;D$chr3.trna238-GlnCTG;;;D$chr5.trna303-AspGTC;;;;;;D$chr7.trna536-TrpCCA;;;D$chr8.trna243-ProAGG;;;D$chr9.trna311-LysTTT;;;;;;D$chr12.trna315-ArgTCT;;;;;;;;;D$chr15.trna382-TyrGTA;;;;;;D$chr17.trna5-GlyTCC;;;;;;;;;D$chr20.trna283-LeuCAA;;;D$chr21.trna218-AlaTGC;;;D$chr22.trna254-ValAAC;;;;;;;;;D$Zv8_NA3269.trna32-CysGCA;;;;D$Zv8_scaffold3058.trna38-MetCAT
F$chrE1;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10120-GlyGCC;;;;;;D$chr2.trna317-ThrAGT;;;D$chr3.trna239-IleAAT;;;D$chr5.trna304-AspGTC;;;;;;D$chr7.trna537-TrpCCA;;;D$chr8.trna244-GlnTTG;;;D$chr9.trna312-SerAGA;;;;;;D$chr12.trna316-ThrTGT;;;;;;;;;D$chr15.trna383-ArgACG;;;;;;D$chr17.trna506-LeuTAA;;;;;;;;;D$chr20.trna284-LeuCAA;;;D$chr21.trna219-AlaTGC;;;D$chr22.trna255-ValCAC;;;;;;;;;D$Zv8_NA3269.trna4-CysGCA;;;;D$Zv8_scaffold3058.trna39-ThrTGT
F$chrE2;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10124-GlyGCC;;;;;;D$chr2.trna318-ThrAGT;;;D$chr3.trna240-PheGAA;;;D$chr5.trna306-AspGTC;;;;;;D$chr7.trna538-TrpCCA;;;D$chr8.trna246-ProTGG;;;D$chr9.trna313-HisGTG;;;;;;D$chr12.trna318-ThrAGT;;;;;;;;;D$chr15.trna384-GluTTC;;;;;;D$chr17.trna509-LeuTAA;;;;;;;;;D$chr20.trna285-LeuCAA;;;D$chr21.trna220-AlaTGC;;;D$chr22.trna257-ValCAC;;;;;;;;;D$Zv8_NA3269.trna5-CysGCA;;;;D$Zv8_scaffold3058.trna4-HisGTG
F$chrE2;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10125-GlyGCC;;;;;;D$chr2.trna319-ThrAGT;;;D$chr3.trna242-GlnCTG;;;D$chr5.trna308-AspGTC;;;;;;D$chr7.trna54-ArgTCG;;;D$chr8.trna247-ProAGG;;;D$chr9.trna314-LysTTT;;;;;;D$chr12.trna319-ArgTCT;;;;;;;;;D$chr15.trna385-TyrGTA;;;;;;D$chr17.trna510-LeuTAA;;;;;;;;;D$chr20.trna288-LeuCAA;;;D$chr21.trna221-AlaTGC;;;D$chr22.trna258-ValTAC;;;;;;;;;D$Zv8_NA3269.trna6-CysGCA;;;;D$Zv8_scaffold3058.trna40-ThrTGT
F$chrE3;ArgCCT;;B$chr1;GlyCCC;;D$chr4.trna10129-GlyGCC;;;;;;D$chr2.trna320-LeuTAG;;;D$chr3.trna243-IleAAT;;;D$chr5.trna312-AspGTC;;;;;;D$chr7.trna540-TrpCCA;;;D$chr8.trna248-GlnTTG;;;D$chr9.trna315-SerAGA;;;;;;D$chr12.trna320-ThrAGT;;;;;;;;;D$chr15.trna386-ArgACG;;;;;;D$chr17.trna511-LeuTAA;;;;;;;;;D$chr20.trna289-LeuCAA;;;D$chr21.trna222-AlaTGC;;;D$chr22.trna259-ValAAC;;;;;;;;;D$Zv8_NA3269.trna7-CysGCA;;;;D$Zv8_scaffold3058.trna41-ThrCGT
F$chrE3;ArgCCT;;B$chr1;GlyGCC;;D$chr4.trna1013-GlyGCC;;;;;;D$chr2.trna321-ThrAGT;;;D$chr3.trna244-PheGAA;;;D$chr5.trna313-AspGTC;;;;;;D$chr7.trna542-TrpCCA;;;D$chr8.trna250-ProTGG;;;D$chr9.trna377-SerCGA;;;;;;D$chr12.trna321-ArgTCT;;;;;;;;;D$chr15.trna387-GluTTC;;;;;;D$chr17.trna513-LeuTAA;;;;;;;;;D$chr20.trna290-LeuCAA;;;D$chr21.trna223-AlaTGC;;;D$chr22.trna260-ValCAC;;;;;;;;;D$Zv8_NA3269.trna8-CysGCA;;;;D$Zv8_scaffold3058.trna42-ThrAGT
F$chrE3;ArgCCT;;B$chr1;GlyGCC;;D$chr4.trna10130-HisGTG;;;;;;D$chr2.trna322-ThrAGT;;;D$chr3.trna246-GlnCTG;;;D$chr5.trna315-AspGTC;;;;;;D$chr7.trna543-TrpCCA;;;D$chr8.trna251-ProAGG;;;D$chr9.trna379-LeuCAA;;;;;;D$chr12.trna322-ThrAGT;;;;;;;;;D$chr15.trna388-TyrGTA;;;;;;D$chr17.trna514-LeuTAA;;;;;;;;;D$chr20.trna291-LeuCAA;;;D$chr21.trna224-AlaTGC;;;D$chr22.trna261-ValTAC;;;;;;;;;D$Zv8_NA3269.trna9-CysGCA;;;;D$Zv8_scaffold3058.trna43-ArgTCT
F$chrE3;ArgCCT;;B$chr1;GlyGCC;;D$chr4.trna10132-GluTTC;;;;;;D$chr2.trna323-ThrAGT;;;D$chr3.trna247-IleAAT;;;D$chr5.trna316-AspGTC;;;;;;D$chr7.trna544-TrpCCA;;;D$chr8.trna252-GlnTTG;;;D$chr9.trna42-LysTTT;;;;;;D$chr12.trna323-ArgTCT;;;;;;;;;D$chr15.trna389-ArgACG;;;;;;D$chr17.trna515-LeuTAA;;;;;;;;;D$chr20.trna292-IleTAT;;;D$chr21.trna225-AlaCGC;;;D$chr22.trna288-GlyTCC;;;;;;;;;D$Zv8_NA3307.trna1-AlaAGC;;;;D$Zv8_scaffold3058.trna44-ThrTGT
F$chrF1;ArgCCT;;B$chr1;GlyTCC;;D$chr4.trna10133-TyrGTA;;;;;;D$chr2.trna324-ArgTCT;;;D$chr3.trna248-PheGAA;;;D$chr5.trna317-AspGTC;;;;;;D$chr7.trna545-TrpCCA;;;D$chr8.trna254-ProTGG;;;D$chr9.trna441-MetCAT;;;;;;D$chr12.trna324-ThrTGT;;;;;;;;;D$chr15.trna39-AsnGTT;;;;;;D$chr17.trna516-LeuTAA;;;;;;;;;D$chr20.trna293-LeuCAA;;;D$chr21.trna226-AlaTGC;;;D$chr22.trna289-GlyTCC;;;;;;;;;D$Zv8_NA3358.trna1-GlyTCC;;;;D$Zv8_scaffold3058.trna45-MetCAT
F$chrF1;ArgCCT;;B$chr1;GlyTCC;;D$chr4.trna10134-ArgACG;;;;;;D$chr2.trna325-ThrAGT;;;D$chr3.trna25-CysGCA;;;D$chr5.trna319-AspGTC;;;;;;D$chr7.trna546-TrpCCA;;;D$chr8.trna255-ProAGG;;;D$chr9.trna46-ProTGG;;;;;;D$chr12.trna325-ArgTCT;;;;;;;;;D$chr15.trna390-GluTTC;;;;;;D$chr17.trna517-LeuTAA;;;;;;;;;D$chr20.trna294-LeuCAA;;;D$chr21.trna227-AlaTGC;;;D$chr22.trna290-GlyTCC;;;;;;;;;D$Zv8_NA3556.trna1-GlyGCC;;;;D$Zv8_scaffold3058.trna47-LeuTAG
F$chrF1;ArgCCT;;B$chr1;GlyTCC;;D$chr4.trna10135-AlaTGC;;;;;;D$chr2.trna326-ThrAGT;;;D$chr3.trna250-GlnCTG;;;D$chr5.trna320-AspGTC;;;;;;D$chr7.trna547-TrpCCA;;;D$chr8.trna256-GlnTTG;;;D$chr9.trna47-GlnCTG;;;;;;D$chr12.trna326-ThrAGT;;;;;;;;;D$chr15.trna391-TyrGTA;;;;;;D$chr17.trna545-SerGCT;;;;;;;;;D$chr20.trna295-LeuCAA;;;D$chr21.trna228-AlaTGC;;;D$chr22.trna293-GluCTC;;;;;;;;;D$Zv8_NA3563.trna1-LysTTT;;;;D$Zv8_scaffold3058.trna48-LeuAAG
F$chrF1;ArgCCT;;B$chr1;GlyTCC;;D$chr4.trna10136-TyrGTA;;;;;;D$chr2.trna327-ThrAGT;;;D$chr3.trna251-IleAAT;;;D$chr5.trna322-AspGTC;;;;;;D$chr7.trna548-TrpCCA;;;D$chr8.trna258-ProTGG;;;D$chr9.trna48-GlnTTG;;;;;;D$chr12.trna327-ArgTCT;;;;;;;;;D$chr15.trna392-ArgACG;;;;;;D$chr17.trna547-ArgCCG;;;;;;;;;D$chr20.trna296-LeuCAA;;;D$chr21.trna229-AlaTGC;;;D$chr22.trna297-LysCTT;;;;;;;;;D$Zv8_NA3563.trna10-ProTGG;;;;D$Zv8_scaffold3058.trna49-LeuTAG
F$chrX;ArgCCT;;B$chr1;GlyTCC;;D$chr4.trna10137-ArgACG;;;;;;D$chr2.trna328-ArgTCT;;;D$chr3.trna252-PheGAA;;;D$chr5.trna324-AspGTC;;;;;;D$chr7.trna549-TrpCCA;;;D$chr8.trna259-ProAGG;;;D$chr9.trna49-ProAGG;;;;;;D$chr12.trna328-ThrTGT;;;;;;;;;D$chr15.trna393-GluTTC;;;;;;D$chr17.trna548-SeCTCA;;;;;;;;;D$chr20.trna297-LeuCAA;;;D$chr21.trna230-AlaCGC;;;D$chr22.trna298-LysCTT;;;;;;;;;D$Zv8_NA3563.trna2-SerAGA;;;;D$Zv8_scaffold3058.trna5-LysTTT
F$chrX;ArgCCT;;B$chr1;GlyTCC;;D$chr4.trna10138-GluTTC;;;;;;D$chr2.trna329-ThrAGT;;;D$chr3.trna254-GlnCTG;;;D$chr5.trna326-AspGTC;;;;;;D$chr7.trna55-ArgTCG;;;D$chr8.trna260-GlnTTG;;;D$chr9.trna50-GlnTTG;;;;;;D$chr12.trna33-AsnGTT;;;;;;;;;D$chr15.trna394-TyrGTA;;;;;;D$chr17.trna549-ArgTCG;;;;;;;;;D$chr20.trna298-LeuCAA;;;D$chr21.trna231-AlaTGC;;;D$chr22.trna299-AsnGTT;;;;;;;;;D$Zv8_NA3563.trna4-SupTTA;;;;D$Zv8_scaffold3058.trna50-LeuAAG
F$chrX;ArgCCT;;B$chr1;GlyTCC;;D$chr4.trna10139-TyrGTA;;;;;;D$chr2.trna330-ThrAGT;;;D$chr3.trna255-IleAAT;;;D$chr5.trna328-AspGTC;;;;;;D$chr7.trna550-TrpCCA;;;D$chr8.trna262-ProTGG;;;D$chr9.trna78-LeuCAA;;;;;;D$chr12.trna330-ThrTGT;;;;;;;;;D$chr15.trna395-ArgACG;;;;;;D$chr17.trna552-AlaAGC;;;;;;;;;D$chr20.trna299-LeuCAA;;;D$chr21.trna232-AlaCGC;;;D$chr22.trna301-AsnGTT;;;;;;;;;D$Zv8_NA3688.trna1-IleAAT;;;;D$Zv8_scaffold3058.trna51-LeuTAG
F$chrA3;ArgGCG;;B$chr1;GlyTCC;;D$chr4.trna1014-GlyGCC;;;;;;D$chr2.trna331-ThrAGT;;;D$chr3.trna256-PheGAA;;;D$chr5.trna329-AspGTC;;;;;;D$chr7.trna551-SerACT;;;D$chr8.trna263-ProAGG;;;;;;;;;D$chr12.trna332-ThrAGT;;;;;;;;;D$chr15.trna396-GluTTC;;;;;;D$chr17.trna553-ValCAC;;;;;;;;;D$chr20.trna300-LeuCAA;;;D$chr21.trna233-AlaTGC;;;D$chr22.trna302-LysCTT;;;;;;;;;D$Zv8_NA3688.trna2-PheGAA;;;;D$Zv8_scaffold3058.trna52-LeuAAG
F$chrB1;ArgGCG;;B$chr1;GlyTCC;;D$chr4.trna10140-ArgACG;;;;;;D$chr2.trna332-ArgTCT;;;D$chr3.trna258-GlnCTG;;;D$chr5.trna330-AspGTC;;;;;;D$chr7.trna552-TrpCCA;;;D$chr8.trna264-GlnTTG;;;;;;;;;D$chr12.trna333-ArgTCT;;;;;;;;;D$chr15.trna397-TyrGTA;;;;;;D$chr17.trna555-ValAAC;;;;;;;;;D$chr20.trna302-LeuCAA;;;D$chr21.trna234-AlaTGC;;;D$chr22.trna305-GlyTCC;;;;;;;;;D$Zv8_NA3745.trna1-TrpCCA;;;;D$Zv8_scaffold3058.trna54-SerCGA
F$chrB3;ArgGCG;;B$chr1;GlyTCC;;D$chr4.trna10141-GluTTC;;;;;;D$chr2.trna333-ThrAGT;;;D$chr3.trna259-IleAAT;;;D$chr5.trna338-GluTTC;;;;;;D$chr7.trna553-TrpCCA;;;D$chr8.trna266-ProTGG;;;;;;;;;D$chr12.trna334-ThrAGT;;;;;;;;;D$chr15.trna398-ArgACG;;;;;;D$chr17.trna556-ValCAC;;;;;;;;;D$chr20.trna303-LeuCAA;;;D$chr21.trna235-AlaTGC;;;D$chr22.trna306-ThrTGT;;;;;;;;;D$Zv8_NA3745.trna2-TrpCCA;;;;D$Zv8_scaffold3058.trna55-ProTGG
F$chrD1;ArgGCG;;B$chr1;GlyTCC;;D$chr4.trna10142-TyrGTA;;;;;;D$chr2.trna334-ArgTCT;;;D$chr3.trna26-CysGCA;;;D$chr5.trna360-SerTGA;;;;;;D$chr7.trna554-TrpCCA;;;D$chr8.trna267-GlnTTG;;;;;;;;;D$chr12.trna335-A

Archives exemples NCBI[modifier | modifier le wikicode]

 http://www.genome.jp/kegg/genome.html;;;;;;24.11.17 Paris ;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
KEGG;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
uma;Ustilago maydis 521;;;;*;uma;;ecartt;3;moy;5;%;69;;ttt;;ecartt;13;moy;26;%;48;;;zro;;;ecartt;12;moy;39;%;32;;;;;;;;;;;;;;
cal;Candida albicans WO-1;;;;*;Type ;Name ;Size;GC% ;Protein ;rRNA ;tRNA ;Gene ;;Type ;Name ;Size ;GC% ;Protein ;tRNA ;Gene ;Pseudo ;;;Type ;Name ;Size ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;;;;;;;;;;;;;;
ttt;Thielavia terrestris NRRL 8126;;;;*;;;19.64;54;6783;34;111;6910;;;6;36.9;54.9;9802;156;9958;4;;;;7;9.76;39.2;4991;9;272;51;5323;;;;;;;;;;;;;;
cgr;Candida glabrata CBS 138;;;;*;Chr;1;2.48;53.9;877;5;11;892;;Chr;1;10.1;54.2;2650;39;2689;-;;;Chr;A;1.11;39.2;580;-;33;5;618;;;;;;;;;;;;;;
zro;Zygosaccharomyces rouxii CBS 732;;;;*;Chr;2;1.88;53.9;652;4;14;668;;Chr;2;9.48;55.1;2573;44;2617;4;;;Chr;B;1.39;38.8;706;-;39;8;753;;;;;;;;;;;;;;
sce;Saccharomyces cerevisiae (S288c Apr 2011);;;;*;Chr;3;1.64;53.7;632;3;6;639;;Chr;3;4.79;52.6;1180;23;1203;-;;;Chr;C;1.46;39;774;-;47;8;829;;;;;;;;;;;;;;
dme;Drosophila melanogaster (D. melanogaster Aug. 2014 BDGP Release 6 + ISO1 MT/dm6);;;;*;Chr;4;0.88;54.4;273;3;5;280;;Chr;4;4.58;55.2;1205;20;1225;-;;;Chr;D;1.5;39.1;768;-;28;7;803;;;;;;;;;;;;;;
tbl;Tetrapisispora blattae CBS 6284;;;;*;Chr;5;1.39;53.8;504;1;7;510;;Chr;5;4.4;55.7;1202;16;1218;-;;;Chr;E;0.88;39.4;416;9;32;10;467;;;;;;;;;;;;;;
ncr;Neurospora crassa OR74A;;;;*;Chr;6;1.03;54.1;335;3;7;344;;Chr;6;3.57;56.3;992;14;1006;-;;;Chr;F;1.55;39.3;806;-;30;3;839;;;;;;;;;;;;;;
mcc;Macaca mulatta (Rhesus Oct. 2010 BGI CR_1.0/rheMac3);;;;*;Chr;7;0.96;54.1;331;2;8;341;;Max Min Total;;;44;14;156;;;;;Chr;G;1.87;39.3;941;-;63;10;1014;;;;;;;;;;;;;;
mmu;Mus musculus (mm10 Dec 2011);;;;*;Chr;8;0.81;54.1;275;1;4;278;;;;;;;;;;;;Max Min Total;;;;63;28;272;;;;;;;;;;;;;;;;
ptr;Pan troglodytes (Chimp Feb. 2011 CSAC 2.1.4/panTro4);;;;*;Chr;9;0.73;53.9;259;1;3;263;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
cpic;Chrysemys picta (western painted turtle);;;;*;Chr;10;0.69;54.2;237;-;3;239;;cgr;;;ecartt;6;moy;16;%;39;;sce;;;ecartt;8;moy;17;%;47;;;;;;;;;;;;;;
cel;Caenorhabditis elegans (WS220 Oct 2010);;;;*;Chr;11;0.69;54.1;239;1;3;242;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;;;;;;;;;;;;
has;Homo sapiens (hg38 - GRCh38 Dec 2013);;;;*;Chr;12;0.65;54;221;-;0;221;;;13;12.32;38.8;5202;4;207;9;5421;;;16;12.07;38.4;5983;12;275;111;6399;18;;;;;;;;;;;;;
bdi;Brachypodium distachyon (JGI v1.0 8X);;;;*;Chr;13;0.61;54;207;-;3;209;;Chr;A;0.49;40.1;200;-;9;-;209;;Chr;I;0.23;39.3;94;-;4;2;101;1;;;;;;;;;;;;;
ath;Arabidopsis thaliana (TAIR10 Feb 2011);;;;*;Chr;14;0.61;54.1;185;1;7;193;;Chr;B;0.5;38.9;212;-;9;1;222;;Chr;II;0.81;38.3;415;-;13;4;432;-;;;;;;;;;;;;;
osa;Oryza sativa;;;;*;Chr;15;0.58;54.5;185;1;3;189;;Chr;C;0.56;39.7;230;-;7;-;237;;Chr;III;0.32;38.5;168;-;10;4;184;2;;;;;;;;;;;;;
cbr;Caenorhabditis briggsae (C. briggsae Jan. 2007 WUGSC 1.0/cb3);;;;*;Chr;16;0.55;54.1;185;-;6;191;;Chr;D;0.65;39.1;283;-;18;-;301;;Chr;IV;1.53;37.9;766;-;28;4;799;1;;;;;;;;;;;;;
ssc;Sus scrofa (Pig Aug. 2011 SGSC Sscrofa10.2/susScr3);;;;*;Chr;17;0.58;54;200;1;7;208;;Chr;E;0.69;39;278;-;9;-;287;;Chr;V;0.58;38.5;287;-;20;9;317;1;;;;;;;;;;;;;
oaa;Ornithorhynchus anatinus (platypus) (WUGSC 5.0.1 Mar 2007);;;;*;Chr;18;0.56;54.3;186;-;1;187;;Chr;F;0.93;38.1;383;-;15;-;398;;Chr;VI;0.27;38.7;128;-;10;4;143;1;;;;;;;;;;;;;
cfa;Canis familiaris (dog) (CanFam3.1 Sept 2011);;;;*;Chr;19;0.57;53.8;200;3;5;207;;Chr;G;0.99;38.6;434;-;18;-;451;;Chr;VII;1.09;38.1;539;-;36;10;585;-;;;;;;;;;;;;;
oas;Ovis aries (sheep) (Feb 2010);;;;*;Chr;20;0.52;53.9;190;2;1;193;;Chr;H;1.05;38.1;460;-;14;-;474;;Chr;VIII;0.56;38.5;290;-;11;4;305;-;;;;;;;;;;;;;
zma;Zea mays (Version 5b.60);;;;*;Chr;21;0.47;54.2;166;1;1;166;;Chr;I;1.1;38.6;462;-;26;1;489;;Chr;IX;0.44;38.9;213;-;10;3;232;6;;;;;;;;;;;;;
;;;;;;Chr;22;0.4;54.5;123;1;4;128;;Chr;J;1.2;38.9;514;-;17;2;533;;Chr;X;0.75;38.4;362;-;24;6;392;-;;;;;;;;;;;;;
;;;;;;Chr;23;0.34;54;114;-;2;115;;Chr;K;1.3;38.2;556;-;22;3;581;;Chr;XI;0.67;38.1;317;-;16;5;338;-;;;;;;;;;;;;;
;;;;;;Un;-;0.02;52.8;7;-;-;;;Chr;L;1.46;38.5;575;4;25;1;605;;Chr;XII;1.08;38.5;519;12;21;18;572;2;;;;;;;;;;;;;
;;;;;;Max Min Total;;;;14;0;111;;;Chr;M;1.4;38.5;615;-;18;1;634;;Chr;XIII;0.92;38.2;469;-;21;15;505;-;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;MT;0.02;17.6;11;2;23;1;37;;Chr;XIV;0.78;38.6;398;-;14;6;418;-;;;;;;;;;;;;;
;;;;;;;;;;;;;;;Max Min Total;;;;26;7;230;;;;Chr;XV;1.09;38.2;546;-;20;11;579;2;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;Chr;XVI;0.95;38.1;472;-;17;6;497;2;;;;;;;;;;;;;
https://www.ncbi.nlm.nih.gov/genome/?term=txid9606[orgn];;;;;;;;;;;;;;;;;;;;;;;;;;MT;0.09;17.1;19;2;24;1;46;-;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;Max Min Total;;;;36;4;299;;;;;;;;;;;;;;;;
;NCBI;;;ncr;;;ecartt;16;moy;59;%;27;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
uma;5270;;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;mmu;;;ecartt;25;moy;19;%;130;;;;ptr;;;ecartt;29;moy;15;%;194;;;;;;;;;;;;
cal;5476;;;;;41;48.3;10785;212;415;176;10533;16;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;;;;;;;;;;
ttt;35720;;;group;I;9.8;48.8;2637;6;72;52;2477;2;;;;2725.52;41.9;75959;33;403;32389;45765;9469;;;;;2981.5;40.7;75780;0;367;18258;36235;6329;;;;;;;;;;;
cgr;5478;;;group;II;4.48;48.2;1134;22;36;14;1100;-;;Chr;1;195.47;41.3;4731;-;37;2031;2687;579;;;Chr;1;228.57;41.9;7522;-;49;1568;3407;570;;;;;;;;;;;
zro;4956;;;group;III;5.27;48.8;1399;9;39;23;1325;1;;Chr;2;182.11;42.2;6282;-;8;2783;3491;609;;;Chr;2A;111.5;41.3;2525;-;4;749;1210;183;;;;;;;;;;;
sce;4932;;;group;IV;6.00;48.5;1620;14;76;19;1594;8;;Chr;3;160.04;40.7;3507;-;40;1663;2225;480;;;Chr;2B;133.22;39.8;2975;-;4;666;1225;236;;;;;;;;;;;
dme;7227;;;group;V;6.44;48.9;1754;17;64;33;1694;2;;Chr;4;156.51;42.5;4710;-;8;1991;2622;497;;;Chr;3;202.62;39.9;4687;-;4;1133;2032;381;;;;;;;;;;;
tbl;1071379;;;group;VI;4.22;48.3;1076;5;56;19;1068;1;;Chr;5;151.84;42.7;4634;-;10;1952;2507;413;;;Chr;4;194.5;38.5;3064;-;1;956;1630;324;;;;;;;;;;;
ncr;5141;;;group;VII;4.26;47.7;1164;4;72;16;1139;2;;Chr;6;149.74;41.6;3844;1;53;1572;2597;555;;;Chr;5;181.91;39.7;3116;-;14;940;1749;345;;;;;;;;;;;
mcc;9544;;;;MT;0.06;36.1;28;-;28;-;58;2;;Chr;7;145.44;43.2;6336;-;10;2087;3798;935;;;Chr;6;175.4;39.8;3784;-;139;1086;2115;391;;;;;;;;;;;
mmu;10090;;;Un;-;0.57;28.1;-;-;-;-;-;-;;Chr;8;129.4;42.6;3653;32;7;1673;2177;376;;;Chr;7;166.21;41;3696;-;12;1148;1994;396;;;;;;;;;;;
ptr;9598;;;Max Min Total;;;;76;36;443;;;;;Chr;9;124.6;42.9;4406;-;7;1698;2276;374;;;Chr;8;147.91;40.4;2537;-;6;788;1370;256;;;;;;;;;;;
cpic;8479;;;;;;;;;;;;;;Chr;10;130.7;41.6;3546;-;11;1546;2086;391;;;Chr;9;116.77;41.8;3061;-;3;704;1393;253;;;;;;;;;;;
cel;6239;;;cpic;;;ecartt;4;moy;2;%;173;;;Chr;11;122.08;44;5650;-;47;2097;2852;381;;;Chr;10;135.93;41.8;3510;-;3;728;1415;248;;;;;;;;;;;
has;9606;;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;Chr;12;120.13;42;2621;-;3;1593;2002;516;;;Chr;11;135.75;41.8;4745;-;13;774;2128;349;;cal;;;ecartt;11;moy;16;%;68;
bdi;15368;;;;;461.75;45.8;7543;0;44;3644;24356;597;;Chr;13;120.42;41.9;2536;-;105;1513;2127;476;;;Chr;12;137.16;41.1;4112;-;10;927;1832;321;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo
ath;3702;;;Chr;1;77.39;43.4;1179;-;16;121;616;17;;Chr;14;124.9;41.4;3007;-;12;1538;2111;455;;;Chr;13;100.45;39;1345;-;4;543;827;171;;;;14.28;33.5;6030;4;126;85;6263;18
osa;4530;;;Chr;2;68.45;42.8;949;-;9;115;496;15;;Chr;15;104.04;42.2;2872;-;4;1349;1620;282;;;Chr;14;91.97;41.2;2375;-;19;667;1226;197;;Chr;1;3.19;33.3;1353;-;23;22;1403;5
cbr;6238;;;Chr;3;75.88;42.9;1132;-;4;108;537;8;;Chr;16;98.21;41.2;2486;-;2;1081;1367;257;;;Chr;15;83.23;42.5;2435;-;8;744;1137;200;;Chr;2;2.23;33.5;997;-;24;15;1038;2
ssc;9823;;;Chr;4;49.33;43.4;998;-;7;86;453;4;;Chr;17;94.99;42.9;3610;-;12;1373;2005;427;;;Chr;16;81.59;44.9;2949;-;30;567;1330;158;;Chr;3;1.8;33.5;739;-;21;4;765;1
oaa;9258;;;Chr;5;4.92;43.8;52;-;0;1;25;-;;Chr;18;90.7;41.7;1855;-;0;966;1218;264;;;Chr;17;83.18;45.7;4213;-;33;742;1806;206;;Chr;4;1.6;33.4;654;-;17;12;685;2
cfa;9612;;;Chr;6;62.6;42.6;1047;-;1;84;456;8;;Chr;19;61.43;43.1;2328;-;10;831;1283;205;;;Chr;18;78.22;40.2;1241;-;1;401;601;113;;Chr;5;1.19;33.3;507;-;6;5;519;1
oas;9940;;;Chr;7;7.28;45.9;55;-;2;5;30;1;;Chr;X;171.03;39.7;3010;-;17;933;2291;912;;;Chr;19;61.31;48.4;4611;-;7;703;1966;210;;Chr;6;1.03;33.6;425;-;4;4;435;2
zma;4577;;;Chr;8;51.56;44.2;878;-;0;79;445;7;;Chr;Y;91.74;39.3;335;-;0;119;423;85;;;Chr;20;66.53;44.3;2063;-;0;484;936;137;;Chr;7;0.95;33.5;393;-;1;3;398;1
;;;;Chr;10;7.27;48.4;156;-;1;17;65;-;;;MT;0.02;36.7;13;2;22;-;37;-;;;Chr;21;33.45;41.2;736;-;1;269;426;63;;Chr;R;2.29;33.8;962;4;30;20;1020;4
;;;;Chr;11;5;44.3;116;-;0;9;52;-;;Un;-;93.44;43.6;2471;2;10;1126;2899;501;;;Chr;22;37.82;48.1;1690;-;0;397;749;85;;Max Min Total;;;;30;1;126;;;
;;;;Chr;13;1.22;50;1;-;0;1;2;-;;Max Min Total;;;;105;0;435;;;;;;Chr;X;155.55;39.8;2653;-;2;515;1470;391;;;;;;;;;;;
;;;;Chr;15;19.09;42.3;321;-;1;50;162;2;;;;;;;;;;;;;;Chr;Y;26.35;40.6;135;-;0;59;261;145;;;;;;;;;;;
;;;;Chr;17;4.55;48.5;97;-;0;13;54;-;;has;;;ecartt;33;moy;18;%;187;;;;;MT;0.02;43.7;13;2;22;-;13;-;;dme;;;ecartt;38;moy;42;%;90;
;;;;Chr;19;9.08;48;171;-;1;10;98;1;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;;Un;-;264.05;39.9;4163;-;29;804;2678;425;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo
;;;;Chr;21;1.37;50.9;14;-;0;-;9;-;;;;3088.3;42.1;108596;17;421;46261;53816;15820;;;Max Min Total;;;;139;0;418;;;;;;;137.55;41.0;30463;117;297;3816;17640;305
;;;;Chr;22;2.51;46.4;22;-;1;5;12;-;;Chr;1;248.96;42.3;11046;17;90;4350;5078;1372;;;ath;;;ecartt;65;moy;125;%;52;;;Chr;X;23.54;42.5;5368;16;26;553;2669;69
;;;;Chr;24;13.19;46.3;354;-;1;27;191;2;;Chr;2;242.19;40.3;8054;-;8;3638;3862;1166;;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;Chr;2L;23.51;41.8;5683;-;41;917;3490;48
;;;;Chr;25;1.06;49.9;1;-;0;3;3;-;;Chr;3;198.3;39.7;6790;-;4;2723;2971;887;;;;;119.16;36.0;48148;4;625;7203;37898;4843;;Chr;2R;25.29;42.6;6039;101;100;677;3618;45
;;;;;MT;0.02;39;13;2;22;-;13;-;;Chr;4;190.22;38.3;4374;-;1;2209;2441;799;;;Chr;1;30.43;35.9;12654;-;238;1969;9701;930;;Chr;3L;28.11;41.7;5867;-;50;750;3454;37
;;;;Un;-;1904;44.8;35002;-;311;2910;20637;532;;Chr;5;181.54;39.5;4599;-;17;2225;2578;766;;;Chr;2;19.7;35.9;7599;2;95;1341;6312;1047;;Chr;4;1.35;35.4;295;-;0;37;111;6
;;;;;;;;;;;;;;;Chr;6;170.81;39.6;5338;-;144;2408;3000;876;;;Chr;3;23.46;36.3;9474;2;92;1411;7624;1080;;Chr;3R;32.08;42.6;7186;-;80;854;4185;38
;;;;;;;;;;;;;;;Chr;7;159.35;40.7;4843;-;21;2232;2774;896;;;Chr;4;18.59;36.2;7426;-;77;1072;5842;835;;Chr;Y;3.67;40.2;25;-;0;28;113;62
;;;;cel;;;ecartt;89;moy;137;%;65;;;Chr;8;145.14;40.2;3962;-;5;1975;2152;661;;;Chr;5;26.98;35.9;10995;-;123;1410;8419;951;;;MT;0.02;17.8;13;2;22;-;37;-
;;;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;Chr;9;138.4;42.3;4572;-;3;2135;2262;702;;;MT;;0.37;44.8;117;3;21;-;131;-;;Un;-;6.16;41.1;6;-;-;-;5;-
;;;;;;100.26;35.5;28155;21;821;25266;46721;1885;;Chr;10;133.8;41.6;5237;-;3;2053;2174;631;;;Pltd;;0.15;36.3;85;7;37;-;129;-;;Max Min Total;;;;100;0;319;;;
;;;;Chr;I;15.07;35.7;4133;6;76;1221;4187;160;;Chr;11;135.09;41.6;6187;-;13;2267;2920;835;;;Max Min Total;;;;238;77;683;;;;;;;;;;;;;;
;;;;Chr;II;15.28;36.2;4703;-;80;1564;5193;262;;Chr;12;133.28;40.8;5648;-;9;2313;2521;680;;;;;;;;;;;;;;;;;;;;;;;
;;;;Chr;III;13.78;35.7;3691;-;97;1060;3827;130;;Chr;13;114.36;40.2;1946;-;4;1235;1381;477;;;osa;;;ecartt;18;moy;51;%;35;;;tbl;;ecartt;21;moy;33;%;66;;
;;;;Chr;IV;17.49;34.6;5158;-;94;16207;19687;374;;Chr;14;107.04;42.2;3252;-;18;1704;2055;583;;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ;Gene ;;
;;;;Chr;V;20.92;35.4;6677;15;169;2210;7836;845;;Chr;15;101.99;43.4;3436;-;9;1778;1814;555;;;;;373.24;43.6;40881;0;615;8932;32915;1655;;;;14.05;31.8;5388;10;327;5725;;
;;;;Chr;X;17.72;35.2;3793;-;305;3004;5991;114;;Chr;16;90.34;45.1;4453;-;27;1700;1920;451;;;Chr;1;43.27;43.8;5673;-;84;1132;4485;171;;Chr;1;2.7;31.8;1042;-;53;1095;;
;;;;;MT;0.01;23.8;12;2;22;-;12;-;;Chr;17;83.26;45.3;6004;-;33;2131;2432;541;;;Chr;2;35.94;43.3;4668;-;69;1131;3626;141;;Chr;2;2.45;31.4;978;-;74;1052;;
;;;;Max Min Total;;;;305;76;843;;;;;Chr;18;80.37;39.8;1812;-;1;1013;988;295;;;Chr;3;36.41;43.7;5036;-;73;818;3848;133;;Chr;3;1.78;31.5;689;-;53;742;;
;;;;;;;;;;;;;;;Chr;19;58.62;47.9;6452;-;6;1750;2481;514;;;Chr;4;35.5;44.3;3570;-;63;737;2894;155;;Chr;4;1.45;32.2;550;5;32;587;;
;;;;bdi;;;ecartt;40;moy;105;%;38;;;Chr;20;64.44;43.9;2794;-;0;1276;1349;329;;;Chr;5;29.96;44;3277;-;55;615;2612;133;;Chr;5;1.32;31.6;481;5;31;517;;
;;;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;Chr;21;46.71;42.2;1240;-;1;687;756;202;;;Chr;6;31.25;43.6;3336;-;33;715;2683;140;;Chr;6;1.05;32;408;-;25;433;;
;;;;;;271.77;46.4;33844;0;525;6415;28911;1506;;Chr;22;50.82;47.7;2493;-;0;965;1172;348;;;Chr;7;29.7;43.5;3165;-;35;675;2581;134;;Chr;7;0.99;31.9;343;-;24;367;;
;;;;Chr;1;75.12;46.3;10003;-;155;1714;8388;385;;Chr;X;156.04;39.6;3739;-;4;1196;2158;859;;;Chr;8;28.44;43.4;2752;-;44;610;2269;129;;Chr;8;0.96;31.1;370;-;21;391;;
;;;;Chr;2;59.38;46.5;7674;-;121;1264;6483;274;;Chr;Y;57.23;45.4;325;-;0;298;577;395;;;Chr;9;23.01;43.5;2201;-;32;556;1843;92;;Chr;9;0.86;32.6;336;-;5;341;;
;;;;Chr;3;59.94;46.4;7537;-;111;1373;6429;311;;;MT;0.02;44.4;13;2;22;-;37;-;;;Chr;10;23.21;43.6;2102;-;47;607;1890;118;;Chr;10;0.49;31.8;191;-;9;200;;
;;;;Chr;4;48.77;46.3;5464;-;93;1251;4821;368;;Un;-;165.56;44.4;5810;17;186;3064;6445;1957;;;Chr;11;29.02;42.9;2643;-;28;709;2216;182;;Max Min Total;;;;74;5;327;;;
;;;;Chr;5;28.56;47;3166;-;45;813;2790;168;;Max Min Total;;;;144;0;629;;;;;;Chr;12;27.53;43;2458;-;52;627;1968;127;;;;;;;;;;;
;;;;Pltd;-;0.14;38.6;81;8;38;-;133;4;;;;;;;;;;;;;;Pltd;;0.13;39;108;8;38;-;159;5;;;;;;;;;;;
;;;;Un;-;0.22;47.2;19;-;-;1;13;3;;;;;;;;;;;;;;MT;;0.49;43.9;53;3;22;-;81;6;;;;;;;;;;;
;;;;Max Min Total;;;;155;45;563;;;;;;;;;;;;;;;;;Plsm;B1;0;44.2;2;-;-;-;-;-;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;Un;-;0.55;45.9;26;-;-;10;30;3;;;;;;;;;;;
;;;;cbr;;ecartt;27;moy;127;%;22;;;;;;;;;;;;;;;;Max Min Total;;;;84;28;675;;;;;;;;;;;;;;
;;;;Type ;Name ;Size  ;GC% ;Protein ;tRNA ; RNA ;Gene ;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;105.2;;21237;759;28;21999;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;Chr;I;15.46;38;3096;118;4;3212;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;Chr;II;16.63;37.8;3351;98;5;3448;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;Chr;III;14.58;37.8;2909;108;4;3016;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;Chr;IV;17.49;37.4;3292;124;3;3414;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;Chr;V;19.5;37.7;4821;135;6;4962;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;Chr;X;21.54;37.7;3768;176;6;3947;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;Un;-;3.2;36.8;722;15;-;737;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;Max Min Total;;;176;98;774;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;cfa;;;ecartt;17;moy;10;%;169;;;ssc;;;ecartt;33;moy;22;%;148;;;oas;;;ecartt;47;moy;58;%;81;;;;mcc;;;ecartt;30;moy;18;%;170
;;;;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene 
;;;;;;;2327.62;41.3;58270;0;395;24029;36322;5040;;;;2435.26;41.9;61823;0;448;14074;28224;2365;;;;2584.84;42.4;42387;0;1567;6690;28381;3084;;;;;2835.96;41.6;54294;0;394;11124;32128
;;;;;Chr;1;122.68;41.6;3540;-;8;1312;2078;257;;Chr;1;274.33;40.2;5392;-;21;1255;2423;260;;Chr;1;275.41;40.9;4492;-;200;593;2813;331;;;Chr;1;225.59;42;5515;-;63;1008;3150
;;;;;Chr;2;85.43;42.8;2231;-;6;986;1384;152;;Chr;2;151.94;42.5;5641;-;29;988;2683;257;;Chr;2;248.97;41;3655;-;111;555;2139;264;;;Chr;2;204.79;39.9;3417;-;7;667;1857
;;;;;Chr;3;91.89;40.3;1491;-;5;918;1076;177;;Chr;3;132.85;44.2;4054;-;36;941;1805;109;;Chr;3;224;42.4;4287;-;127;550;2739;295;;;Chr;3;185.82;41;3036;-;20;686;1966
;;;;;Chr;4;88.28;40.4;1579;-;3;892;1142;183;;Chr;4;130.91;41.6;3628;-;70;868;1650;104;;Chr;4;119.22;40.6;1372;-;51;287;975;121;;;Chr;4;172.59;40;2775;-;136;652;1906
;;;;;Chr;5;88.92;44.2;3124;-;26;1036;1652;147;;Chr;5;104.53;42.2;3219;-;12;653;1458;103;;Chr;5;107.84;42;2204;-;65;285;1616;174;;;Chr;5;190.43;38.6;2208;-;2;549;1378
;;;;;Chr;6;77.57;42.6;2651;-;26;898;1514;155;;Chr;6;170.84;44.7;6262;-;16;1282;2724;167;;Chr;6;116.89;40;1361;-;52;206;823;120;;;Chr;6;180.05;39.8;2326;-;17;615;1561
;;;;;Chr;7;80.97;41.0;2101;-;7;919;1253;170;;Chr;7;121.84;43.1;3720;-;143;889;1978;133;;Chr;7;100.01;41.6;1972;-;66;268;1197;114;;;Chr;7;169.6;41.7;3418;-;31;940;2151
;;;;;Chr;8;74.33;40.6;1712;-;6;845;1227;198;;Chr;8;138.97;39.5;2216;-;2;644;1096;109;;Chr;8;90.62;40.2;1028;-;42;184;646;80;;;Chr;8;144.31;40.4;1947;-;6;411;1190
;;;;;Chr;9;61.07;46.0;3224;-;19;886;1651;106;;Chr;9;139.51;41.2;3659;-;8;893;1715;169;;Chr;9;94.58;41.1;1001;-;38;191;690;81;;;Chr;9;129.88;41.9;2479;-;3;487;1267
;;;;;Chr;10;69.33;42.7;1868;-;8;856;1190;153;;Chr;10;69.36;42.7;1455;-;5;428;664;54;;Chr;10;86.38;40.4;748;-;31;160;521;64;;;Chr;10;92.84;45.8;2563;-;0;480;1493
;;;;;Chr;11;74.39;40.2;1640;-;9;723;1024;145;;Chr;11;79.17;40.6;1156;-;5;406;559;43;;Chr;11;62.17;46.3;2083;-;77;264;1449;91;;;Chr;11;133.66;41.2;2961;-;8;517;1662
;;;;;Chr;12;72.5;39.0;1705;-;3;593;1024;165;;Chr;12;61.6;47.7;3151;-;44;708;1468;58;;Chr;12;79.03;42.8;1240;-;37;221;872;85;;;Chr;12;125.51;40.1;1976;-;4;409;1040
;;;;;Chr;13;63.24;40.0;1164;-;3;620;794;126;;Chr;13;208.34;39.9;4724;-;4;918;1841;200;;Chr;13;82.95;43.8;1572;-;34;252;967;80;;;Chr;13;108.98;41.3;1779;-;4;451;1116
;;;;;Chr;14;60.97;38.8;1099;-;5;566;799;141;;Chr;14;141.76;43.2;4088;-;11;811;1667;132;;Chr;14;62.57;45.8;1955;-;45;302;1446;106;;;Chr;14;127.89;41.9;3526;-;10;529;1885
;;;;;Chr;15;64.19;40.2;1534;-;12;788;968;122;;Chr;15;140.41;39.9;2727;-;7;561;1106;115;;Chr;15;80.78;42;1682;-;40;176;1212;153;;;Chr;15;111.34;41.8;2223;-;4;429;1218
;;;;;Chr;16;59.63;41.0;1305;-;16;556;870;119;;Chr;16;79.94;40.3;940;-;5;390;588;50;;Chr;16;71.69;41.1;631;-;20;139;464;68;;;Chr;16;77.22;45.9;2915;-;33;450;1605
;;;;;Chr;17;64.29;41.7;1766;-;31;804;1129;123;;Chr;17;63.49;44.7;1823;-;5;459;821;46;;Chr;17;72.25;42.4;1080;-;42;184;739;72;;;Chr;17;95.68;38.9;981;-;4;350;676
;;;;;Chr;18;55.84;42.8;1988;-;10;595;1214;125;;Chr;18;55.98;43.1;1368;-;17;400;659;41;;Chr;18;68.49;43.1;955;-;34;410;747;81;;;Chr;18;70.24;40;786;-;0;243;488
;;;;;Chr;19;53.74;38.4;568;-;2;457;469;99;;Chr;X;125.94;40.4;2482;-;8;523;1172;170;;Chr;19;60.45;43.6;1206;-;20;307;685;39;;;Chr;19;53.67;49;3293;-;8;474;1819
;;;;;Chr;20;58.13;44.3;2673;-;6;604;1377;123;;Chr;Y;43.55;47.5;118;-;0;57;147;45;;Chr;20;51.05;43.6;1203;-;184;186;1022;75;;;Chr;20;74.97;45;2017;-;28;304;1143
;;;;;Chr;21;50.86;40.2;1367;-;3;439;871;170;;;MT;0.02;39.5;13;2;22;-;13;-;;Chr;21;49.99;44.3;1027;-;22;161;824;87;;;Chr;X;149.15;39.7;2067;-;6;442;1465
;;;;;Chr;22;61.44;37.9;712;-;4;556;591;117;;Un;-;66.63;43.3;1741;2;62;331;1936;59;;Chr;22;50.78;42.9;841;-;19;96;473;42;;;Chr;Y;11.75;40.1;86;-;0;31;92
;;;;;Chr;23;52.29;39.9;1006;-;3;512;667;124;;Max Min Total;;;;143;0;532;;;;;Chr;23;62.28;41.9;689;-;26;134;423;42;;;;MT;0.02;43.2;13;2;22;-;13
;;;;;Chr;24;47.7;44.5;1550;-;2;560;890;74;;;;;;;;;;;;;Chr;24;41.98;47.3;1133;-;69;133;891;50;;;Un;-;400.24;41.3;1059;-;2;87;1077
;;;;;Chr;25;51.63;41.4;1305;-;4;574;798;109;;zma;;;ecartt;30;moy;86;%;35;;;Chr;25;45.22;42.4;744;-;20;124;456;73;;;Max Min Total;;;;136;0;418;;
;;;;;Chr;26;38.96;45.4;1478;-;10;466;794;76;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;Chr;26;44.05;41.8;461;-;20;102;324;33;;;;;;;;;;;
;;;;;Chr;27;45.88;40.1;1662;-;3;464;858;128;;;;2106.33;46.0;57505;1;859;12070;47001;3591;;Chr;X;135.19;40.5;1765;-;75;220;1228;263;;;;;;;;;;;
;;;;;Chr;28;41.18;43.5;1194;-;0;461;642;70;;Chr;1;307.04;47;8611;-;116;1779;6948;468;;;MT;0.02;38.9;13;2;22;-;13;-;;;;;;;;;;;
;;;;;Chr;29;41.85;38.2;538;-;5;366;474;91;;Chr;2;244.44;47;6964;-;140;1438;5780;447;;Un;-;30.68;45.8;646;-;2;62;716;37;;;;;;;;;;;
;;;;;Chr;30;40.21;41.4;1210;-;5;441;681;86;;Chr;3;235.67;46.9;6181;-;79;1254;4945;368;;Max Min Total;;;;200;19;1591;;;;;;;;;;;;;;
;;;;;Chr;31;39.9;39.5;644;-;0;357;486;71;;Chr;4;247;46.6;6047;-;109;1326;5118;390;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;32;38.81;36.9;706;-;0;302;464;121;;Chr;5;223.9;46.9;6655;-;101;1319;5293;408;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;33;31.38;39.2;694;-;2;330;414;57;;Chr;6;174.03;47.1;4897;1;78;1037;4049;326;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;34;42.12;40.4;627;-;2;380;471;57;;Chr;7;182.38;46.8;4778;-;59;928;3762;284;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;35;26.53;41.4;528;-;102;272;529;66;;Chr;8;181.12;47;5048;-;75;1217;4263;305;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;36;30.81;38.6;551;-;2;342;376;57;;Chr;9;159.77;47;4274;-;53;987;3590;307;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;37;30.9;40.2;712;-;3;438;453;45;;Chr;10;150.98;46.9;4050;-;49;785;3253;288;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;38;23.91;41.0;485;-;28;296;442;63;;;MT;0.57;43.9;163;4;29;-;213;26;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;X;123.87;40.3;2338;-;6;619;1586;472;;;Pltd;0.14;38.5;111;8;38;-;158;1;;;;;;;;;;;;;;;;;;;;;;
;;;;;;MT;0.02;39.7;13;2;22;-;13;-;;Un;-;28.03;46.7;512;1;19;108;428;24;;;;;;;;;;;;;;;;;;;;;;
;;;;;Un;-;83.33;47.2;493;-;2;146;474;;;Max Min Total;;;;140;49;945;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;Max Min Total;;;;102;0;419;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;dre;;;ecartt;1130;moy;319;%;354;;;bta;;;ecartt;39;moy;53;%;74;;;;;;;;;;;;;;;;;;;;;;;
;;;;;Type ;Name ;Size ;GC% ;Protein ;rRNA ;tRNA ;RNA ;Gene ;Pseudo;;Type ;Name ;Size ;GC% ;Protein ;rRNA ;tRNA ;RNA ;Gene ;Pseudo;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;1345.07;36.8;62823;1;7977;6836;37391;297;;;;2660.91;41.9;48993;1;1578;9712;32314;3888;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;1;59.58;36.4;2176;-;31;326;1444;22;;Chr;1;158.34;40.1;1981;-;67;405;1267;165;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;2;59.64;36.7;2229;-;76;274;1464;8;;Chr;2;137.06;40.8;2085;-;49;362;1237;163;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;3;62.63;36.9;2436;-;346;362;1992;23;;Chr;3;121.43;41.9;2922;-;171;462;1832;223;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;4;78.09;38.4;2450;-;5723;1252;7909;70;;Chr;4;120.83;40.6;1673;-;59;386;1142;123;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;5;72.5;36.4;2713;1;140;395;1679;6;;Chr;5;121.19;41.7;2753;-;54;444;1715;218;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;6;60.27;36.4;2123;-;52;250;1238;16;;Chr;6;119.46;40;1420;-;51;320;953;134;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;7;74.28;36.7;2531;-;72;322;1641;14;;Chr;7;112.64;42;2791;-;55;474;1814;243;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;8;54.3;36.5;1986;-;240;272;1452;6;;Chr;8;113.39;41.2;1573;-;29;421;1097;142;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;9;56.46;36.5;1832;-;60;226;1060;9;;Chr;9;105.71;40;1068;-;39;281;821;142;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;10;45.42;36.6;1779;-;12;186;1076;14;;Chr;10;104.31;41.5;2014;-;65;369;1447;151;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;11;45.48;36.4;1596;-;13;166;952;4;;Chr;11;107.31;42.9;2176;-;44;388;1309;122;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;12;49.18;36.3;1679;-;123;157;1091;5;;Chr;12;91.16;40.4;886;-;47;268;660;72;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;13;52.19;36.5;1805;-;46;230;1046;6;;Chr;13;84.24;43.7;1740;-;42;377;1111;118;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;14;52.66;36.6;1481;-;11;170;945;6;;Chr;14;84.65;41.4;1066;-;38;235;734;95;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;15;48.04;36.8;1814;-;135;193;1229;14;;Chr;15;85.3;41.8;1946;-;47;269;1491;264;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;16;55.27;36.5;1996;-;17;308;1255;11;;Chr;16;81.72;42.6;1452;-;30;324;946;102;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;17;53.46;36.6;1703;-;109;190;1111;9;;Chr;17;75.16;42.3;1411;-;42;261;893;115;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;18;51.02;36.6;1541;-;5;179;915;9;;Chr;18;66;45.4;2691;-;50;378;1648;156;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;19;48.45;36.4;1762;-;7;185;1038;7;;Chr;19;64.06;46;2718;-;70;428;1570;108;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;20;55.2;36.6;1890;-;262;192;1376;3;;Chr;20;72.04;41;562;-;31;192;508;67;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;21;45.93;36.6;1948;-;253;237;1374;8;;Chr;21;71.6;43.1;1135;-;26;460;855;98;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;22;39.13;37;1674;-;143;293;1288;8;;Chr;22;61.44;43.4;1414;-;23;276;762;67;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;23;46.22;36.7;1755;-;11;204;1015;5;;Chr;23;52.53;43.4;1393;-;191;297;1134;93;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;24;42.17;36.3;1365;-;18;138;823;10;;Chr;24;62.71;41.9;751;-;19;192;469;61;;;;;;;;;;;;;;;;;;;;;;
;;;;;Chr;25;37.5;36.6;1453;-;72;129;978;4;;Chr;25;42.9;47.1;1684;1;66;259;973;50;;;;;;;;;;;;;;;;;;;;;;
;;;;;;MT;0.02;39.9;13;2;22;-;37;-;;Chr;26;51.68;42.8;991;-;14;207;559;62;;;;;;;;;;;;;;;;;;;;;;
;;;;;Un;-;334.09;36.5;9370;-;1385;1639;9570;67;;Chr;27;45.41;41.8;478;-;33;147;377;33;;;;;;;;;;;;;;;;;;;;;;
;;;;;Max Min Total;;;;5723;5;9384;;;;;Chr;28;46.31;42.2;798;-;23;111;444;64;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;Chr;29;51.51;44.2;1427;-;24;231;903;109;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;Chr;X;148.82;40.6;1994;-;79;488;1643;328;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;MT;0.02;39.4;13;2;22;-;13;-;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;Un;-;9.22;49.6;101;-;-;10;105;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;Max Min Total;;;;191;14;1600;;;;;;;;;;;;;;;;;;;;;;;;;

Taurus, distributions des tRNAs sur les chromosomes[modifier | modifier le wikicode]

max;;;51;58;62;28;64;42;56;37;28;50;58;31;59;35;36;46;63;48;78;10;37;41;36;20;62;16;26;22;28;67;;;
;;;chr1;chr2;chr3;chr4;chr5;chr6;chr7;chr8;chr9;chr10;chr11;chr12;chr13;chr14;chr15;chr16;chr17;chr18;chr19;chr20;chr21;chr22;chr23;chr24;chr25;chr26;chr27;chr28;chr29;X;total;;
1;ttt;PheAAA;1;;;;1;;;;;;;;;;1;;1;;;1;;;;;;;1;;;;6;;PheAAA
8;ttc;PheGAA;1;;;;;1;1;2;;;;2;2;;3;;1;1;;;;;7;;;;;;1;8;30;;PheGAA
3;tta;LeuTAA;;;;1;;1;;;1;;;;1;;2;;;1;;;;;3;;;;;;;;10;;LeuTAA
6;ttg;LeuCAA;;2;;;;;1;;1;1;;;;1;;;;1;1;;;;6;;;;;;;;14;;LeuCAA
4;ctt;LeuAAG;1;;;;;;1;;;3;;;1;;;;;;;;;;4;;1;;;;;;11;;LeuAAG
0;ctc;LeuGAG;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;0;;LeuGAG
2;cta;LeuTAG;;;;;;;;1;;2;;;;;;;;;1;;;;;;1;;;;;;5;;LeuTAG
3;ctg;LeuCAG;;;3;;;1;;;;;;;;;;;;1;;;;;1;;;;;;;;6;;LeuCAG
14;att;IleAAT;;;;1;;;;;;;;;;;;;;;2;;1;;14;;;;;;;;18;;IleAAT
0;atc;IleGAT;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;0;;IleGAT
3;ata;IleTAT;1;;;;;;1;;;1;1;;;;;;;1;;;;;3;;;;;;;;8;;IleTAT
19;atg;MetCAT;1;;1;1;1;;2;;1;;1;1;1;2;;;;2;1;;;;19;;1;;;;;;35;;MetCAT
11;gtt;ValAAC;2;;11;1;;;1;;;;;;;;;;;1;;;;;4;;;;;;;;20;;ValAAC
0;gtc;ValGAC;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;0;;ValGAC
6;gta;ValTAC;;;6;1;1;;1;;1;;1;;;;1;;1;;3;1;1;;2;;;;;;;1;21;;ValTAC
15;gtg;ValCAC;;2;15;;;;2;1;2;;;1;;;1;2;;2;;1;;;5;;1;;;2;1;1;39;;ValCAC
8;tct;SerAGA;;;;;;;;;;1;;;;1;;;;1;2;;;;8;;;;;;;;13;;SerAGA
4;tcc;SerGGA;4;1;1;3;;2;;1;2;1;3;;;2;;;1;;1;1;1;;;1;1;2;;;;4;32;;SerGGA
3;tca;SerTGA;;;;1;;;;;;;;;;;;;;;;;1;;3;;1;;;1;;;7;;SerTGA
3;tcg;SerCGA;;;1;;1;;;;;;;;;;;;;;1;;;;3;;1;;;;;;7;;SerCGA
7;cct;ProAGG;;;1;1;;;;;;2;;;;;1;;;;;;;;1;;7;;;;;;13;;ProAGG
0;ccc;ProGGG;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;0;;ProGGG
6;cca;ProTGG;;;;;;;;;;2;;;1;;;;;;;;;;;;6;;;;;;9;;ProTGG
1;ccg;ProCGG;;;1;;;;;;;;;;;;;;;;1;;;;1;;1;;;;;;4;;ProCGG
7;act;ThrAGT;;1;1;;;;;;;;;;;;;;;1;3;;;;7;;;;;;;1;14;;ThrAGT
1;acc;ThrGGT;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;1;1;;ThrGGT
3;aca;ThrTGT;2;;;1;;;1;;;3;;;;;;1;;1;;1;;;;;;;;;;;10;;ThrTGT
2;acg;ThrCGT;1;;;;;;;1;;;;;1;;;;;;1;;;;2;;1;;;;;;7;;ThrCGT
15;gct;AlaAGC;1;;;;;;2;;;;2;;;1;;;;4;1;;1;;15;;1;1;;;1;1;31;;AlaAGC
1;gcc;AlaGGC;;;;;;1;;;;;;;;;;;;;;;;;;;;;;;1;;2;;AlaGGC
7;gca;AlaTGC;1;2;1;;2;3;3;;1;;2;;1;1;2;;2;1;3;;;;7;1;;1;;;;1;35;;AlaTGC
5;gcg;AlaCGC;2;1;1;;;1;;;1;;1;;;;;;;;;;;1;5;1;;;;;;2;16;;AlaCGC
2;tat;TyrATA;;;;1;;;;;2;;1;2;;1;1;1;;;;;1;;1;;;;;;;;11;;TyrATA
7;tac;TyrGTA;3;1;2;;4;;2;2;1;7;1;;;3;1;;1;;;1;3;;4;1;;1;;;;1;39;;TyrGTA
1;taa;SupTTA;;;;;;;;1;;1;;;;;;;;;;;;;;;;;1;;;1;4;;SupTTA
2;tag;SupCTA;1;1;1;;;1;;2;2;1;2;;;;1;;;;;;;1;;;;;;;;;13;;SupCTA
2;cat;HisATG;;;;;;;1;;;1;;;;;;;;;;;;;;;;;;;;2;4;;HisATG
11;cac;HisGTG;;;11;;;;;1;;3;1;;;;;;;1;;;;;1;;1;;;;;;19;;HisGTG
6;caa;GlnTTG;1;;1;;1;;1;;1;1;;;;;;;;;5;;;;6;;1;;;;;1;19;;GlnTTG
13;cag;GlnCTG;2;2;13;1;3;1;1;;;1;;1;1;1;;2;;1;2;;1;;5;;1;1;;;;;40;;GlnCTG
0;aat;AsnATT;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;0;;AsnATT
24;aac;AsnGTT;;;24;1;;;1;;;;;1;1;;;;;;1;;;;1;;;;;;;;30;;AsnGTT
10;aaa;LysTTT;6;1;5;3;2;1;1;1;3;2;;1;1;;4;7;4;;6;3;3;3;10;6;2;;;1;;2;78;;LysTTT
12;aag;LysCTT;1;;3;2;1;2;3;1;1;4;1;;;;1;1;;;2;;2;1;2;;12;;;;;;40;;LysCTT
1;gat;AspATC;;;1;;;;;;;;;1;1;1;;;1;;;;;;;;;;;;;1;6;;AspATC
8;gac;AspGTC;2;;8;;2;;2;1;1;3;1;1;;1;1;;3;3;4;;2;;3;;1;;1;1;;1;42;;AspGTC
31;gaa;GluTTC;14;21;31;12;26;9;18;14;13;17;21;14;20;14;13;14;9;17;20;5;11;12;9;6;18;6;4;6;14;26;434;;GluTTC
12;gag;GluCTC;7;5;9;4;7;4;12;5;5;7;8;3;8;4;3;8;7;4;7;6;5;7;3;4;8;1;1;2;4;6;164;;GluCTC
9;tgt;CysACA;8;6;9;6;8;6;6;4;5;4;8;3;5;4;4;9;2;3;1;9;4;2;3;3;3;1;5;5;3;4;143;;CysACA
27;tgc;CysGCA;13;14;10;27;11;17;7;14;20;17;16;22;11;13;12;3;7;4;16;9;9;6;6;7;3;5;8;6;6;19;338;;CysGCA
5;tga;SeCTCA;1;4;;5;;1;;1;;2;1;1;1;1;1;;;5;;;1;1;;1;;;;1;;1;29;;SeCTCA
17;tgg;TrpCCA;3;3;10;3;4;5;12;3;1;4;11;7;7;6;5;4;5;8;17;1;9;6;9;4;5;2;4;3;2;15;178;;TrpCCA
7;cgt;ArgACG;;;1;1;;;;;;1;;;;1;;;;;;;;1;7;;;;;1;;;13;;ArgACG
1;cgc;ArgGCG;1;1;;1;1;;;1;;1;;;;;;;;;;1;;;;;;;;;;;7;;ArgGCG
3;cga;ArgTCG;1;;;;;;;1;;;1;;;;;;;;1;1;1;;2;;3;;;;;1;12;;ArgTCG
3;cgg;ArgCCG;1;1;;;;;1;1;;2;;;1;;;1;;;2;;;;3;;1;;;;;2;16;;ArgCCG
1;agt;SerACT;;;;;;;;1;;;1;1;;;;;;;;;;;;;;;1;;;;4;;SerACT
10;agc;SerGCT;1;1;;;;1;;;;2;;;1;;;;;;1;1;;;10;;;;;;1;;19;;SerGCT
5;aga;ArgTCT;3;2;2;;4;1;;;3;;1;;5;;3;1;2;1;2;1;1;;4;;2;;1;1;2;2;44;;ArgTCT
10;agg;ArgCCT;4;3;7;5;3;3;10;4;3;2;7;4;7;1;7;2;4;3;10;1;1;4;2;2;7;2;1;1;1;5;116;;ArgCCT
3;ggt;GlyACC;;;;2;1;;;;1;1;1;1;1;1;2;;1;;1;1;;3;;;1;;;;;2;20;;GlyACC
8;ggc;GlyGCC;3;3;4;3;2;1;1;1;;1;3;1;5;;1;2;3;8;2;;2;3;4;1;;1;3;2;1;2;63;;GlyGCC
27;gga;GlyTCC;19;15;14;4;23;11;20;7;8;9;27;12;17;11;12;10;18;23;17;9;9;13;8;6;16;7;11;7;7;21;391;;GlyTCC
78;ggg;GlyCCC;51;58;62;28;64;42;56;37;28;50;58;31;59;35;36;46;63;48;78;10;37;41;36;20;62;16;26;22;28;67;1295;;GlyCCC
;;Undet???;;1;2;1;;;;;;;1;;1;;;;;;1;;;;;;;;;;;;9;;Undet???
;;total;164;152;273;121;173;116;171;109;108;160;183;111;161;106;119;114;136;147;217;64;107;105;259;64;170;47;68;62;73;202;4064;;
;NCBI;;chr1;chr2;chr3;chr4;chr5;chr6;chr7;chr8;chr9;chr10;chr11;chr12;chr13;chr14;chr15;chr16;chr17;chr18;chr19;chr20;chr21;chr22;chr23;chr24;chr25;chr26;chr27;chr28;chr29;X;MT;Un;Total
;mb;Size;158.34;137.06;121.43;120.83;121.19;119.46;112.64;113.39;105.71;104.31;107.31;91.16;84.24;84.65;85.3;81.72;75.16;66;64.06;72.04;71.6;61.44;52.53;62.71;42.9;51.68;45.41;46.31;51.51;148.82;0.02;9.22;2670.15
;;GC% ;40.1;40.8;41.9;40.6;41.7;40;42;41.2;40;41.5;42.9;40.4;43.7;41.4;41.8;42.6;42.3;45.4;46;41;43.1;43.4;43.4;41.9;47.1;42.8;41.8;42.2;44.2;40.6;39.4;49.6;
;;Protein ;1981;2085;2922;1673;2753;1420;2791;1573;1068;2014;2176;886;1740;1066;1946;1452;1411;2691;2718;562;1135;1414;1393;751;1684;991;478;798;1427;1994;13;101;
;;rRNA ;-;-;-;-;-;-;-;-;-;-;-;-;-;-;-;-;-;-;-;-;-;-;-;-;1;-;-;-;-;-;2;-;
;;tRNA ;67;49;171;59;54;51;55;29;39;65;44;47;42;38;47;30;42;50;70;31;26;23;191;19;66;14;33;23;24;79;22;-;
;; RNA ;405;362;462;386;444;320;474;421;281;369;388;268;377;235;269;324;261;378;428;192;460;276;297;192;259;207;147;111;231;488;-;10;
;;Gene ;1267;1237;1832;1142;1715;953;1814;1097;821;1447;1309;660;1111;734;1491;946;893;1648;1570;508;855;762;1134;469;973;559;377;444;903;1643;13;105;
;;Pseudo ;165;163;223;123;218;134;243;142;142;151;122;72;118;95;264;102;115;156;108;67;98;67;93;61;50;62;33;64;109;328;-;4;
;;compte;164;152;273;121;173;116;171;109;108;160;183;111;161;106;119;114;136;147;217;64;107;105;259;64;170;47;68;62;73;202;;;

Distribution homogène des gènes de tRNA sur les chromosomes, Bos Taurus et Felis catus[modifier | modifier le wikicode]

bta;ggg;ggc;gga;gaa;gag;tgc;tgt;gct; ;fca;cga;aag;caa
X;67;2;21;26;6;7;4;1;;chrA1;100;57;67
chr1;51;2;19;14;7;13;8;1;;chrA2;80;55;66
chr2;58;3;15;21;5;14;6;0;;chrA3;73;50;44
chr3;62;4;14;31;9;10;9;0;;chrB1;70;49;72
chr4;28;3;4;12;4;27;6;0;;chrB2;71;52;62
chr5;64;2;23;26;7;11;8;0;;chrB3;70;54;45
chr6;42;1;11;9;4;17;6;0;;chrB4;66;61;53
chr7;56;1;20;18;12;14;6;2;;chrC1;109;99;60
chr8;37;1;7;14;5;20;4;0;;chrC2;66;39;48
chr9;28;2;8;13;5;19;5;0;;chrD1;53;40;32
chr10;50;1;9;17;7;17;4;0;;chrD2;40;19;28
chr11;58;3;27;21;8;16;8;2;;chrD3;65;33;29
chr12;31;1;12;14;3;22;3;0;;chrD4;46;34;38
chr13;59;5;17;20;8;11;5;0;;chrE1;61;42;22
chr14;35;0;11;14;4;13;4;1;;chrE2;33;36;18
chr15;36;1;12;13;3;12;4;0;;chrE3;29;37;17
chr16;46;2;10;14;8;3;9;0;;chrF1;41;25;27
chr17;63;3;18;9;7;7;2;0;;chrF2;42;23;17
chr18;48;8;23;17;4;4;3;4;;X;81;80;37
chr19;78;2;17;20;7;16;1;1;;Ud;5;2;
chr20;10;0;9;5;6;9;9;0;;;;;
chr21;37;2;9;11;5;9;4;1;;;;;
chr22;41;3;13;12;7;6;2;0;;;;;
chr23;36;4;8;9;3;6;3;15;;;;;
chr24;20;1;6;6;4;7;3;0;;;;;
chr25;62;0;16;18;8;3;3;1;;;;;
chr26;16;1;7;6;1;5;1;1;;;;;
chr27;26;3;11;4;1;8;5;0;;;;;
chr28;22;2;7;6;2;6;5;0;;;;;
chr29;28;1;7;14;4;6;3;1;;;;;
bta 30 chromosomes;;;;;;;;;;fca  19 chromosomes;;;
;ggg;ggc;gga;gaa;gag;tgc;tgt;gct;;;cga;aag;caa
total;1295;64;391;435;164;338;143;31;;total;1201;887;782
moy;43.2;2.1;13.0;14.5;5.5;11.3;4.8;1.0;;moy;62.9;46.6;41.2
ecartt;17.1;1.7;5.9;6.6;2.5;6.0;2.3;2.8;;ecartt;21.5;19.4;18.2
max;78;8;27;31;12;27;9;15;;max;109;99;72
min;10;0;4;4;1;3;1;0;;min;29;19;17
e/m%;40;78;45;46;46;53;49;270;;e/m%;34;42;44

Exemples de distributions des tRNAs sur les chromosomes[modifier | modifier le wikicode]

  • Lien Tableaux: Exemples de distributions des tRNAs sur les chromosomes.
  • Légende: Bases de données, gtRNAdb.fa [2], NCBI [orgn]
    m, moyenne par chromosome,   e, écart type.
    KEGG   gtRNAdb
    sce   Saccharomyces cerevisiae (S288c Apr 2011)
    mmu   Mus musculus (mm10 Dec 2011)
    has   Homo sapiens (hg38 - GRCh38 Dec 2013)
    oas   Ovis aries (sheep) (Feb 2010)
    dre   Danio rerio (Zebrafish) (Zv8 Apr 2009)
    bta   Bos taurus (Cow Jun. 2014 Bos_taurus_UMD_3.1.1/bosTau8)
;tRNAs;Moyenne par chromosome;;;;NCBI;gtRNAdb;
;sce;mmu;has;oas;dre;bta;dre;bta
;4;37;90;200;31;67;44;164
;13;8;8;111;76;49;266;152
;10;40;4;127;346;171;228;273
;28;8;1;51;5723;59;7825;121
;20;10;17;65;140;54;416;173
;10;53;144;52;52;51;49;116
;36;10;21;66;72;55;159;171
;11;7;5;42;240;29;241;109
;10;7;3;38;60;39;122;108
;24;11;3;31;12;65;13;160
;16;47;13;77;13;44;17;183
;21;3;9;37;123;47;200;111
;21;105;4;34;46;42;54;161
;14;12;18;45;11;38;10;106
;20;4;9;40;135;47;188;119
;17;2;27;20;17;30;26;114
;−;12;33;42;109;42;138;136
;−;0;1;34;5;50;87;147
;−;10;6;20;7;70;8;217
;−;17;0;184;262;31;358;64
;−;0;1;22;253;26;573;107
;−;−;0;19;143;23;362;105
;−;−;4;26;11;191;9;259
;−;−;0;69;18;19;31;64
;−;−;−;20;72;66;81;170
;−;−;−;20;−;14;−;47
;−;−;−;75;−;33;−;68
;−;−;−;−;−;23;−;62
;−;−;−;−;−;24;−;73
;−;−;−;−;−;79;−;202
Total;275;403;421;1567;7977;1578;11505;4062
m;17.2;19.2;17.5;58.0;319;52.6;460;144.4
e;8.0;25.0;32.9;47.2;1130;38.7;1542;51.5
e/m %;47;130;187;81;354;74;335;36

La genèse des tRNAs dans les 3 domaines[modifier | modifier le wikicode]

La genèse des 4032 bactéries[modifier | modifier le wikicode]

Les solitaires[modifier | modifier le wikicode]

;;;Les soliaires;;;;;;;;;;;;;;;
;4;ct;ag;;;4;ct;ag;;;4;ct;ag;;;4;ct;ag
total;3948;3938;3933;;total;3945;3825;3943;;total;3932;3932;29;;total;3947;3927;3934
ttt;0;0;;;tct;0;3;;;tat;0;0;;;tgt;0;0;
ttc;15;3928;;;tcc;2;3820;;;tac;3899;3928;;;tgc;12;3924;
tta;0;;96;;tca;85;;1493;;taa;0;;12;;tga;0;;15
ttg;2;;190;;tcg;0;;22;;tag;0;;16;;tgg;17;;2629
;;;;;;;;;;;;;;;;;;
total;3940;3832;3933;;total;3940;2665;3937;;total;3938;3933;3943;;total;3946;3930;3833
ctt;0;322;;;cct;0;8;;;cat;0;0;;;cgt;106;3610;
ctc;7;3501;;;ccc;3;2656;;;cac;5;3930;;;cgc;1;307;
cta;98;;1151;;cca;1173;;1813;;caa;6;;2130;;cga;7;;539
ctg;0;;17;;ccg;1;;5;;cag;2;;18;;cgg;7;;3026
;;;;;;;;;;;;;;;;;;
total;3949;3864;3947;;total;3946;3775;3944;;total;3949;3930;3941;;total;3944;3931;3928
att;0;1;;;act;0;41;;;aat;0;0;;;agt;0;0;
atc;2;3856;;;acc;2;3682;;;aac;2;3925;;;agc;1;3930;
ata;0;;0;;aca;152;;1288;;aaa;5;;1899;;aga;0;;780
atg;81;;3947;;acg;3;;13;;aag;1;;9;;agg;0;;10
;;;;;;;;;;;;;;;;;;
total;3943;3212;3935;;total;3934;3035;3902;;total;3949;3933;3928;;total;3948;3880;3939
gtt;0;5;;;gct;0;0;;;gat;0;0;;;ggt;0;1;
gtc;8;3200;;;gcc;32;3033;;;gac;5;3933;;;ggc;9;3879;
gta;724;;2724;;gca;877;;2721;;gaa;8;;2808;;gga;66;;1699
gtg;1;;2;;gcg;7;;11;;gag;1;;5;;ggg;0;;11

La genèse[modifier | modifier le wikicode]

  • Lien aux tableaux:La genèse.
  • Légende: Prélèvement du 29.10.18
Bactéries ;;4032;;genèse;;;;;Bactéries ;;4032;;Effectifs;;;;;Bactéries ;;4032;genèse;;duplication;;%
ttt;10;tct;5;tat;4;tgt;3;;ttt;10;tct;5;tat;4;tgt;3;;ttt;0;tct;0;tat;0;tgt;0
ctt;331;cct;10;cat;3;cgt;3 623;;ctt;368;cct;10;cat;4;cgt;7 473;;ctt;11;cct;0;cat;33;cgt;106
att;5;act;92;aat;5;agt;1;;att;5;act;101;aat;5;agt;1;;att;0;act;10;aat;0;agt;0
gtt;9;gct;2;gat;0;ggt;1;;gtt;9;gct;2;gat;0;ggt;1;;gtt;0;gct;0;gat;-;ggt;0
ttc;3 938;tcc;3 822;tac;3 932;tgc;3 927;;ttc;6 100;tcc;4 517;tac;6 416;tgc;4 471;;ttc;55;tcc;18;tac;63;tgc;14
ctc;3 510;ccc;2 657;cac;3 933;cgc;318;;ctc;3 848;ccc;2 741;cac;4 712;cgc;333;;ctc;10;ccc;3;cac;20;cgc;5
atc;3 863;acc;3 732;aac;3 930;agc;3 931;;atc;9 193;acc;4 511;aac;8 758;agc;4 419;;atc;138;acc;21;aac;123;agc;12
gtc;3 207;gcc;3 035;gac;3 933;ggc;3 879;;gtc;4 426;gcc;4 164;gac;9 017;ggc;9 265;;gtc;38;gcc;37;gac;129;ggc;139
tta;3 741;tca;3 921;taa;12;tga;1 304;;tta;4 746;tca;5 296;taa;12;tga;1 314;;tta;27;tca;35;taa;0;tga;1
cta;3 916;cca;3 932;caa;3 924;cga;807;;cta;4 937;cca;5 449;caa;6 385;cga;887;;cta;26;cca;39;caa;63;cga;10
ata;48;aca;3 929;aaa;3 930;aga;3 916;;ata;55;aca;5 874;aaa;9 100;aga;4 802;;ata;15;aca;50;aaa;132;aga;23
gta;3 931;gca;3 889;gaa;3 923;gga;3 926;;gta;8 853;gca;10 177;gaa;9 673;gga;5 511;;gta;125;gca;162;gaa;147;gga;40
ttg;3 835;tcg;2 449;tag;17;tgg;3 918;;ttg;3 997;tcg;2 621;tag;18;tgg;4 364;;ttg;4;tcg;7;tag;6;tgg;11
ctg;2 782;ccg;2 124;cag;1 811;cgg;3 292;;ctg;5 182;ccg;2 182;cag;2 387;cgg;3 353;;ctg;86;ccg;3;cag;32;cgg;2
atg;3 945;acg;2 655;aag;2 040;agg;3 147;;atg;18 014;acg;2 759;aag;2 425;agg;3 449;;atg;357;acg;4;aag;19;agg;10
gtg;1 209;gcg;1 181;gag;1 121;ggg;2 238;;gtg;1 313;gcg;1 224;gag;1 387;ggg;2 264;;gtg;9;gcg;4;gag;24;ggg;1

Distribution des duplications[modifier | modifier le wikicode]

  • Lien aux tableaux:Distribution des duplications.
  • Légende: Décompte du 04.12.18. Le séparateur de calc est :. ? * § $ pour les couleurs de la genèse, respectivement de 3,945−3,822   3,741−3,035  2,782−1,811   1,304−807.
Occurence::Leu::::Phe::::Arg::::Arg:Ser:::Ser::
:ctg:cta:ctc:ctt:ttg:tta:ttc:ttt:cgg:cga:cgt:cgc:agg:aga:agc:agt:tcg:tca:tcc:tct
1:1,668:3,277:3,192:295:3,696:2,969:2,281:10:3,241:772:1,623:304:2,846:3,314:3,471:1:2,300:2,982:3,165:5
2:440:436:307:35:119:576:1,304::45:13:910:13:300:449:435::129:654:624:
3:119:133:7:1:17:167:217::4:8:551:1:1:97:22::17:165:29:
4:530:27:1::3:22:125::1:9:429:::25:3::3:101:3:
5:5:24:2:::6:7::0:1:50:::13::::13:1:
6:15:2:0:::1:3::1:4:45:::5::::3::
7:1:7:1::::1::::5:::4::::2::
8:2:2::: ::::::6:::5::::0::
9:1:0::: ::::::2:::4::::0::
10:1:4::: ::::::0:: :::::0::
11::4::: ::::::0:: :::::1::
13: :::: ::::::1:: :::: :::
27: :::: ::::::1:: :::: :::
genèse:§2,782:?3,916:*3,510:331:?3,835:*3,741:?3,938:10:*3,292:$807:*3,623:318:*3,147:?3,916:?3,931:1:§2,449:?3,921:?3,822:5
Dup %:86:26:10:11:4:27:55:0:2:10:106:5:10:23:12:0:7:35:18:0
::::::::::::::::::::
::::::::::::::::::::
:gtg:gta:gtc:gtt:gcg:gca:gcc:gct:ggg:gga:ggc:ggt:ccg:cca:ccc:cct:acg:aca:acc:act
1:1,114:1,957:2,189:9:1,145:1,343:2,055:2:2,214:3,018:1,359:1:2,069:2,822:2,586:10:2,556:2,824:2,965:83
2:88:475:849::30:582:884::22:475:1,008::53:794:58::95:612:755:9
3:5:596:152::5:1,000:61::2:250:565::1:241:13::3:253:12:
4:2:525:6::1:482:20:::141:741::1:64:::1:150::
5::258:7:::250:12:::28:110:::7::::73::
6::90:4:::167:3:::10:48:::3::::17::
7::20::::43::::3:23:::1::: :::
8::6::::16::::1:11:: :::: :::
9::2::::2:::::4:: :::: :::
10::0::::1:::::4:: :::: :::
11::2::::3:::::4:: :::: :::
12: :::: ::::::2:: :::: :::
genèse:$1,209:?3,931:*3,207:9:$1,181:?3,889:*3,035:2:§2,238:?3,926:?3,879:1:§2,124:?3,932:§2,657:10:§2,655:?3,929:*3,732:92
Dup %:9:125:38:0:4:162:37:0:1:40:139:0:3:39:3:0:4:50:21:10
::::::::::::::::::::
::Gln:His:::Lys:Asn:::Glu:Asp:::Stp:Tyr::Trp:SeC:Cys:
:cag:caa:cac:cat:aag:aaa:aac:aat:gag:gaa:gac:gat:tag:taa:tac:tat:tgg:tga:tgc:tgt
1:1,247:2,289:3,208:2:1,746:1,930:1,753:5:915:1,566:1,402:0:16:12:2,373:4:3,539:1,294:3,480:3
2:556:1,162:686:1:219:724:770::152:837:889::1::826::321:10:377:
3:6:185:31::65:416:466::50:523:1,087::::630::51::52:
4:1:235:4::6:204:706::3:569:363::::52::5::12:
5:0:42:2::2:393:189::0:168:65::::27::2::4:
6:1:10:1::2:197:31::1:117:104::::14::::1:
7::1:1:::38:10:::118:17::::7::::1:
8: :::::16:3:::17:3::::2:: :::
9: :::::9:2:::3:1::::1:: :::
10: :::::1::::1:0:: :::: :::
11: :::::0::::2:1:: :::: :::
12: :::::1::::1:1:: :::: :::
13: :::::0::::1::: :::: :::
14: :::::1::: :::: :::: :::
genèse:§1,811:?3,924:?3,933:3:§2,040:?3,930:?3,930:5:$1,121:?3,923:?3,933:0:17:12:?3,932:4:?3,918:$1,304:?3,927:3
Dup %:32:63:20:33:19:132:123:0:24:147:129:−:6:0:63:0:11:1:14:0
::::::::::::::::::::
::Met:Ile:::::::::::::::::
:atg:ata:atc:att::::::::::::::::
1:7:44:1,329:5::::::::::::::::
2:54:2:832:::::::::::::::::
3:1,567:1:1,055:::::::::::::::::
4:848:1:391:::::::::::::::::
5:368::135:::::::::::::::::
6:534::77:::::::::::::::::
7:238::26:::::::::::::::::
8:151::14:::::::::::::::::
9:64::1:::::::::::::::::
10:45::2:::::::::::::::::
11:21::0:::::::::::::::::
12:20::0:::::::::::::::::
13:17::1:::::::::::::::::
14:4:::::::::::::::::::
15:2:::::::::::::::::::
16:2:::::::::::::::::::
17:2:::::::::::::::::::
18:1:::::::::::::::::::
genèse:?3,945:48:?3,863:5::::::::::::::::
Dup %:357:15:138:0::::::::::::::::

Les zéros des 79 eucaryotes[modifier | modifier le wikicode]

E79z-tg;;zéros;−;;;;zéros;;E79g;;Genèse;;;;;;;E79t-tg;;db,diff;;db + diff;;mtri+1;;;E79d;;taux duplications;;;;;
ttt;52;tct;2;tat;52;tgt;48;;ttt;27;tct;77;tat;27;tgt;31;;ttt;51;tct;920;tat;57;tgt;68;;ttt;89;tct;1 095;tat;111;tgt;119
ctt;0;cct;0;cat;57;cgt;1;;ctt;79;cct;79;cat;22;cgt;78;;ctt;857;cct;908;cat;36;cgt;884;;ctt;985;cct;1 049;cat;64;cgt;1 033
att;0;act;1;aat;46;agt;61;;att;79;act;78;aat;33;agt;18;;att;1 238;act;1 021;aat;75;agt;80;;att;1 467;act;1 209;aat;127;agt;344
gtt;0;gct;0;gat;44;ggt;61;;gtt;79;gct;79;gat;35;ggt;18;;gtt;1 022;gct;1 733;gat;76;ggt;80;;gtt;1 194;gct;2 094;gat;117;ggt;344
ttc;1;tcc;52;tac;0;tgc;1;;ttc;78;tcc;27;tac;79;tgc;78;;ttc;1 195;tcc;86;tac;1 310;tgc;1 845;;ttc;1 432;tcc;219;tac;1 558;tgc;2 265
ctc;70;ccc;61;cac;1;cgc;65;;ctc;9;ccc;18;cac;78;cgc;14;;ctc;11;ccc;29;cac;1 028;cgc;24;;ctc;22;ccc;61;cac;1 218;cgc;71
atc;52;acc;56;aac;0;agc;1;;atc;27;acc;23;aac;79;agc;78;;atc;71;acc;68;aac;1 592;agc;910;;atc;163;acc;196;aac;1 915;agc;1 067
gtc;42;gcc;55;gac;0;ggc;1;;gtc;37;gcc;24;gac;79;ggc;78;;gtc;67;gcc;69;gac;1 571;ggc;1 411;;gtc;81;gcc;188;gac;1 889;ggc;1 709
tta;0;tca;0;taa;41;tga;16;;tta;79;tca;79;taa;38;tga;63;;tta;592;tca;579;taa;75;tga;140;;tta;649;tca;633;taa;97;tga;122
cta;3;cca;0;caa;0;cga;0;;cta;76;cca;79;caa;79;cga;79;;cta;486;cca;995;caa;942;cga;609;;cta;539;cca;1 159;caa;1 092;cga;671
ata;1;aca;0;aaa;1;aga;0;;ata;78;aca;79;aaa;78;aga;79;;ata;564;aca;716;aaa;1 413;aga;682;;ata;623;aca;806;aaa;1 712;aga;763
gta;0;gca;1;gaa;0;gga;0;;gta;79;gca;78;gaa;79;gga;79;;gta;635;gca;1 100;gaa;1 176;gga;1 041;;gta;704;gca;1 310;gaa;1 389;gga;1 218
ttg;1;tcg;0;tag;53;tgg;1;;ttg;78;tcg;79;tag;26;tgg;78;;ttg;657;tcg;438;tag;81;tgg;936;;ttg;742;tcg;454;tag;212;tgg;1 100
ctg;0;ccg;0;cag;0;cgg;8;;ctg;79;ccg;79;cag;79;cgg;71;;ctg;711;ccg;405;cag;1 095;cgg;369;;ctg;800;ccg;413;cag;1 286;cgg;420
atg;0;acg;2;aag;1;agg;1;;atg;79;acg;77;aag;78;agg;78;;atg;2 188;acg;480;aag;1 627;agg;794;;atg;2 670;acg;523;aag;1 986;agg;918
gtg;1;gcg;0;gag;0;ggg;4;;gtg;78;gcg;79;gag;79;ggg;75;;gtg;1 002;gcg;611;gag;1 401;ggg;582;;gtg;1 185;gcg;673;gag;1 673;ggg;676

Les zéros des 42 champignons[modifier | modifier le wikicode]

C42z-tg;;zéros;−;;;;;;C42g;;Genèse;;;;;;;C42-tg;;effectifs;;;;;;;C42d;;taux duplications;;;;;
ttt;41;tct;0;tat;40;tgt;41;;ttt;1;tct;42;tat;2;tgt;1;;ttt;2;tct;310;tat;2;tgt;1;;ttt;100;tct;638;tat;0;tgt;0
ctt;11;cct;4;cat;42;cgt;0;;ctt;31;cct;38;cat;0;cgt;42;;ctt;170;cct;155;cat;0;cgt;238;;ctt;448;cct;308;cat;-;cgt;467
att;0;act;0;aat;40;agt;42;;att;42;act;42;aat;2;agt;0;;att;378;act;332;aat;2;agt;0;;att;800;act;690;aat;0;agt;-
gtt;0;gct;0;gat;40;ggt;40;;gtt;42;gct;42;gat;2;ggt;2;;gtt;401;gct;389;gat;2;ggt;2;;gtt;855;gct;826;gat;0;ggt;0
ttc;0;tcc;41;tac;0;tgc;2;;ttc;42;tcc;1;tac;42;tgc;40;;ttc;296;tcc;1;tac;252;tgc;143;;ttc;605;tcc;0;tac;500;tgc;258
ctc;30;ccc;41;cac;0;cgc;42;;ctc;12;ccc;1;cac;42;cgc;0;;ctc;18;ccc;1;cac;220;cgc;0;;ctc;50;ccc;0;cac;424;cgc;-
atc;36;acc;42;aac;0;agc;1;;atc;6;acc;0;aac;42;agc;41;;atc;6;acc;0;aac;297;agc;155;;atc;0;acc;-;aac;607;agc;278
gtc;41;gcc;42;gac;0;ggc;0;;gtc;1;gcc;0;gac;42;ggc;42;;gtc;1;gcc;0;gac;409;ggc;487;;gtc;0;gcc;-;gac;874;ggc;1 060
tta;3;tca;0;taa;41;tga;31;;tta;39;tca;42;taa;1;tga;11;;tta;132;tca;92;taa;1;tga;12;;tta;238;tca;119;taa;0;tga;9
cta;6;cca;1;caa;0;cga;20;;cta;36;cca;41;caa;42;cga;22;;cta;75;cca;205;caa;196;cga;92;;cta;108;cca;400;caa;367;cga;318
ata;1;aca;0;aaa;1;aga;2;;ata;41;aca;42;aaa;41;aga;40;;ata;59;aca;100;aaa;155;aga;207;;ata;44;aca;138;aaa;278;aga;418
gta;2;gca;0;gaa;0;gga;0;;gta;40;gca;42;gaa;42;gga;42;;gta;64;gca;141;gaa;252;gga;146;;gta;60;gca;236;gaa;500;gga;248
ttg;4;tcg;0;tag;41;tgg;2;;ttg;38;tcg;42;tag;1;tgg;40;;ttg;190;tcg;80;tag;1;tgg;173;;ttg;400;tcg;90;tag;0;tgg;333
ctg;11;ccg;21;cag;0;cgg;4;;ctg;31;ccg;21;cag;42;cgg;38;;ctg;89;ccg;36;cag;149;cgg;55;;ctg;187;ccg;71;cag;255;cgg;45
atg;0;acg;1;aag;1;agg;1;;atg;42;acg;41;aag;41;agg;41;;atg;324;acg;66;aag;426;agg;69;;atg;671;acg;61;aag;939;agg;68
gtg;0;gcg;16;gag;0;ggg;3;;gtg;42;gcg;26;gag;42;ggg;39;;gtg;94;gcg;60;gag;296;ggg;69;;gtg;124;gcg;131;gag;605;ggg;77

La genèse des 184 archées[modifier | modifier le wikicode]

Les effectifs des tRNAs des archées[modifier | modifier le wikicode]

archée;;;1 methanopyri;;;;;;Archées;nombres;;184;;;;;;methanococci;;nombres;;16;;;
ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0
ctt;0;cct;0;cat;0;cgt;0;;ctt;1;cct;0;cat;0;cgt;2;;ctt;0;cct;0;cat;0;cgt;0
att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0
gtt;0;gct;0;gat;0;ggt;0;;gtt;1;gct;0;gat;0;ggt;1;;gtt;0;gct;0;gat;0;ggt;0
ttc;1;tcc;1;tac;1;tgc;1;;ttc;215;tcc;190;tac;190;tgc;299;;ttc;16;tcc;16;tac;16;tgc;16
ctc;1;ccc;1;cac;1;cgc;1;;ctc;214;ccc;171;cac;185;cgc;187;;ctc;16;ccc;15;cac;16;cgc;16
atc;1;acc;1;aac;1;agc;1;;atc;212;acc;189;aac;214;agc;187;;atc;16;acc;16;aac;16;agc;16
gtc;1;gcc;1;gac;1;ggc;1;;gtc;212;gcc;184;gac;218;ggc;243;;gtc;16;gcc;16;gac;25;ggc;16
tta;1;tca;1;taa;0;tga;1;;tta;191;tca;184;taa;0;tga;18;;tta;16;tca;16;taa;0;tga;16
cta;1;cca;1;caa;1;cga;1;;cta;185;cca;184;caa;196;cga;185;;cta;16;cca;16;caa;16;cga;17
ata;0;aca;1;aaa;1;aga;1;;ata;2;aca;198;aaa;197;aga;186;;ata;0;aca;16;aaa;25;aga;16
gta;1;gca;1;gaa;2;gga;1;;gta;186;gca;256;gaa;230;gga;189;;gta;17;gca;22;gaa;32;gga;17
ttg;0;tcg;0;tag;0;tgg;1;;ttg;163;tcg;152;tag;1;tgg;184;;ttg;0;tcg;0;tag;0;tgg;16
ctg;0;ccg;0;cag;0;cgg;0;;ctg;160;ccg;151;cag;165;cgg;139;;ctg;0;ccg;0;cag;0;cgg;0
atg;3;acg;0;aag;0;agg;0;;atg;589;acg;169;aag;166;agg;165;;atg;56;acg;1,0;aag;0;agg;0
gtg;0;gcg;0;gag;0;ggg;0;;gtg;170;gcg;159;gag;160;ggg;155;;gtg;7;gcg;0;gag;0;ggg;0

La genèse des archées[modifier | modifier le wikicode]

Archées;;184;;genèse;;;;;Archées;;184;;Effectifs;;;;;Archées;;184;genèse;;duplication;;%
ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0;;ttt;-;tct;-;tat;-;tgt;-
ctt;1;cct;0;cat;0;cgt;2;;ctt;1;cct;0;cat;0;cgt;2;;ctt;0;cct;-;cat;-;cgt;0
att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0;;att;-;act;-;aat;-;agt;-
gtt;1;gct;0;gat;0;ggt;1;;gtt;1;gct;0;gat;0;ggt;1;;gtt;0;gct;-;gat;-;ggt;0
ttc;183;tcc;183;tac;183;tgc;183;;ttc;215;tcc;190;tac;190;tgc;299;;ttc;17;tcc;4;tac;4;tgc;63
ctc;180;ccc;170;cac;183;cgc;183;;ctc;214;ccc;171;cac;185;cgc;187;;ctc;19;ccc;1;cac;1;cgc;2
atc;183;acc;182;aac;183;agc;183;;atc;212;acc;189;aac;214;agc;187;;atc;16;acc;4;aac;17;agc;2
gtc;183;gcc;182;gac;183;ggc;181;;gtc;212;gcc;184;gac;218;ggc;243;;gtc;16;gcc;1;gac;19;ggc;34
tta;183;tca;182;taa;0;tga;18;;tta;191;tca;184;taa;0;tga;18;;tta;4;tca;1;taa;-;tga;0
cta;183;cca;183;caa;182;cga;183;;cta;185;cca;184;caa;196;cga;185;;cta;1;cca;1;caa;8;cga;1
ata;2;aca;183;aaa;182;aga;183;;ata;2;aca;198;aaa;197;aga;186;;ata;0;aca;8;aaa;8;aga;2
gta;183;gca;182;gaa;183;gga;182;;gta;186;gca;256;gaa;230;gga;189;;gta;2;gca;41;gaa;26;gga;4
ttg;158;tcg;151;tag;1;tgg;183;;ttg;163;tcg;152;tag;1;tgg;184;;ttg;3;tcg;1;tag;0;tgg;1
ctg;154;ccg;149;cag;164;cgg;139;;ctg;160;ccg;151;cag;165;cgg;139;;ctg;4;ccg;1;cag;1;cgg;0
atg;183;acg;166;aag;160;agg;164;;atg;589;acg;169;aag;166;agg;165;;atg;222;acg;2;aag;4;agg;1
gtg;168;gcg;155;gag;157;ggg;153;;gtg;170;gcg;159;gag;160;ggg;155;;gtg;1;gcg;3;gag;2;ggg;1

Les taux de genèse dans les 3 domaines[modifier | modifier le wikicode]

C42g;;Genèse;;Taux;;42;;;E79g;;Genèse;;Taux;;79;
ttt;2;tct;100;tat;5;tgt;2;;ttt;34;tct;97;tat;34;tgt;39
ctt;74;cct;90;cat;0;cgt;100;;ctt;100;cct;100;cat;28;cgt;99
att;100;act;100;aat;5;agt;0;;att;100;act;99;aat;42;agt;23
gtt;100;gct;100;gat;5;ggt;5;;gtt;100;gct;100;gat;44;ggt;23
ttc;100;tcc;2;tac;100;tgc;95;;ttc;99;tcc;34;tac;100;tgc;99
ctc;29;ccc;2;cac;100;cgc;0;;ctc;11;ccc;23;cac;99;cgc;18
atc;14;acc;0;aac;100;agc;98;;atc;34;acc;29;aac;100;agc;99
gtc;2;gcc;0;gac;100;ggc;100;;gtc;47;gcc;30;gac;100;ggc;99
tta;93;tca;100;taa;2;tga;26;;tta;100;tca;100;taa;48;tga;80
cta;86;cca;98;caa;100;cga;52;;cta;96;cca;100;caa;100;cga;100
ata;98;aca;100;aaa;98;aga;95;;ata;99;aca;100;aaa;99;aga;100
gta;95;gca;100;gaa;100;gga;100;;gta;100;gca;99;gaa;100;gga;100
ttg;90;tcg;100;tag;2;tgg;95;;ttg;99;tcg;100;tag;33;tgg;99
ctg;74;ccg;50;cag;100;cgg;90;;ctg;100;ccg;100;cag;100;cgg;90
atg;100;acg;98;aag;98;agg;98;;atg;100;acg;97;aag;99;agg;99
gtg;100;gcg;62;gag;100;ggg;93;;gtg;99;gcg;100;gag;100;ggg;95
;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;
Archées;;genèse;;Taux;;183;;;Bactéries ;;4032;genèse;Taux;;3949;
ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0
ctt;1;cct;0;cat;0;cgt;1;;ctt;8;cct;0;cat;0;cgt;92
att;0;act;0;aat;0;agt;0;;att;0;act;2;aat;0;agt;0
gtt;1;gct;0;gat;0;ggt;1;;gtt;0;gct;0;gat;0;ggt;0
ttc;100;tcc;100;tac;100;tgc;100;;ttc;100;tcc;97;tac;100;tgc;99
ctc;98;ccc;93;cac;100;cgc;100;;ctc;89;ccc;67;cac;100;cgc;8
atc;100;acc;99;aac;100;agc;100;;atc;98;acc;95;aac;100;agc;100
gtc;100;gcc;99;gac;100;ggc;99;;gtc;81;gcc;77;gac;100;ggc;98
tta;100;tca;99;taa;0;tga;10;;tta;95;tca;99;taa;0;tga;33
cta;100;cca;100;caa;99;cga;100;;cta;99;cca;100;caa;99;cga;20
ata;1;aca;100;aaa;99;aga;100;;ata;1;aca;99;aaa;100;aga;99
gta;100;gca;99;gaa;100;gga;99;;gta;100;gca;98;gaa;99;gga;99
ttg;86;tcg;83;tag;1;tgg;100;;ttg;97;tcg;62;tag;0;tgg;99
ctg;84;ccg;81;cag;90;cgg;76;;ctg;70;ccg;54;cag;46;cgg;83
atg;100;acg;91;aag;87;agg;90;;atg;100;acg;67;aag;52;agg;80
gtg;92;gcg;85;gag;86;ggg;84;;gtg;31;gcg;30;gag;28;ggg;57

Les introns des eucaryotes[modifier | modifier le wikicode]

Effectifs;;;;;Effectifs;;;;;Génomes;;;;Génomes;;
C42;;;;;E79;;;;;C42;;;;E79;;
faibles;%;autres;;;faibles;%;autres;;;faibles;%;autres;;faibles;%;autres
18;<5;;;;11;0-6;14;;;18;<5;;;16;0-6;19
tga;21;;;;5;8-19;14;;;tga;17;;;-;8-14;22
13;40-88;aga 48;;;tcc tat;22-30;5;;;19;21-38;aga 29;;tag tat;13 22;
13;100-190;ata 140;;;tga;4;;;;16;43-57;aag 50;;tga;3;
16;217-405;ttg 360;;;4;35-68;gaa ctt cca aaa;;;8;71-90;ttc ttg;;3;73-87;aga ttg ata
3;481-621;aag tac ttc;;;3;166-189;cga caa atg;;;2;98100;ata tac;;1;100;tac
-;;;;;4;406-594;aag ttg ata aga;;;-;;;;-;;
-;;;;;1;1568;tac;;;-;;;;-;;

Les introns des eucaryotes. Effectifs[modifier | modifier le wikicode]

C42;introns;;effectifs;;;;;;C42;introns;;génomes;;;;
ttt;2;tct;35;tat;0;tgt;1;;ttt;2;tct;9;tat;0;tgt;1
ctt;143;cct;125;cat;0;cgt;91;;ctt;21;cct;20;cat;0;cgt;22
att;141;act;42;aat;2;agt;0;;att;16;act;13;aat;2;agt;0
gtt;59;gct;119;gat;2;ggt;1;;gtt;9;gct;14;gat;2;ggt;1
ttc;261;tcc;1;tac;250;tgc;30;;ttc;35;tcc;1;tac;42;tgc;12
ctc;2;ccc;0;cac;92;cgc;0;;ctc;2;ccc;0;cac;19;cgc;0
atc;1;acc;0;aac;94;agc;144;;atc;1;acc;0;aac;16;agc;38
gtc;1;gcc;0;gac;125;ggc;102;;gtc;1;gcc;0;gac;15;ggc;11
tta;35;tca;43;taa;1;tga;9;;tta;19;tca;24;taa;1;tga;7
cta;68;cca;168;caa;59;cga;80;;cta;32;cca;33;caa;20;cga;16
ata;59;aca;30;aaa;131;aga;20;;ata;41;aca;15;aaa;36;aga;12
gta;25;gca;43;gaa;50;gga;42;;gta;21;gca;16;gaa;18;gga;14
ttg;151;tcg;66;tag;1;tgg;124;;ttg;32;tcg;37;tag;1;tgg;30
ctg;71;ccg;31;cag;65;cgg;17;;ctg;20;ccg;18;cag;15;cgg;12
atg;104;acg;25;aag;202;agg;36;;atg;24;acg;15;aag;21;agg;18
gtg;37;gcg;36;gag;170;ggg;33;;gtg;20;gcg;18;gag;16;ggg;16
;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;
E79;introns;;effectifs;;;;;;E79;introns;;génomes;;;;
ttt;11;tct;2;tat;24;tgt;2;;ttt;5;tct;2;tat;17;tgt;2
ctt;45;cct;18;cat;6;cgt;0;;ctt;10;cct;6;cat;3;cgt;0
att;5;act;10;aat;4;agt;2;;att;3;act;7;aat;4;agt;2
gtt;3;gct;4;gat;4;ggt;4;;gtt;2;gct;4;gat;3;ggt;3
ttc;2;tcc;23;tac;1 239;tgc;14;;ttc;2;tcc;4;tac;79;tgc;10
ctc;1;ccc;5;cac;11;cgc;3;;ctc;1;ccc;3;cac;9;cgc;3
atc;14;acc;0;aac;8;agc;9;;atc;5;acc;0;aac;5;agc;6
gtc;0;gcc;1;gac;18;ggc;7;;gtc;0;gcc;1;gac;2;ggc;4
tta;18;tca;13;taa;8;tga;3;;tta;8;tca;9;taa;3;tga;2
cta;2;cca;50;caa;148;cga;131;;cta;2;cca;7;caa;8;cga;7
ata;454;aca;5;aaa;54;aga;469;;ata;69;aca;3;aaa;8;aga;58
gta;5;gca;2;gaa;28;gga;21;;gta;5;gca;2;gaa;8;gga;9
ttg;400;tcg;2;tag;13;tgg;5;;ttg;65;tcg;1;tag;10;tgg;4
ctg;7;ccg;11;cag;17;cgg;4;;ctg;7;ccg;4;cag;8;cgg;2
atg;149;acg;7;aag;321;agg;14;;atg;11;acg;6;aag;7;agg;5
gtg;6;gcg;4;gag;13;ggg;15;;gtg;6;gcg;4;gag;6;ggg;7

Les introns des eucaryotes. Comparaisons[modifier | modifier le wikicode]

C42;introns;;effectifs;;%;;;;C42;introns;;génomes;;%;;
ttt;5;tct;83;tat;0;tgt;2;;ttt;5;tct;21;tat;0;tgt;2
ctt;340;cct;298;cat;0;cgt;217;;ctt;50;cct;48;cat;0;cgt;52
att;336;act;100;aat;5;agt;0;;att;38;act;31;aat;5;agt;0
gtt;140;gct;283;gat;5;ggt;2;;gtt;21;gct;33;gat;5;ggt;2
ttc;621;tcc;2;tac;595;tgc;71;;ttc;83;tcc;2;tac;100;tgc;29
ctc;5;ccc;0;cac;219;cgc;0;;ctc;5;ccc;0;cac;45;cgc;0
atc;2;acc;0;aac;224;agc;343;;atc;2;acc;0;aac;38;agc;90
gtc;2;gcc;0;gac;298;ggc;243;;gtc;2;gcc;0;gac;36;ggc;26
tta;83;tca;102;taa;2;tga;21;;tta;45;tca;57;taa;2;tga;17
cta;162;cca;400;caa;140;cga;190;;cta;76;cca;79;caa;48;cga;38
ata;140;aca;71;aaa;312;aga;48;;ata;98;aca;36;aaa;86;aga;29
gta;60;gca;102;gaa;119;gga;100;;gta;50;gca;38;gaa;43;gga;33
ttg;360;tcg;157;tag;2;tgg;295;;ttg;76;tcg;88;tag;2;tgg;71
ctg;169;ccg;74;cag;155;cgg;40;;ctg;48;ccg;43;cag;36;cgg;29
atg;248;acg;60;aag;481;agg;86;;atg;57;acg;36;aag;50;agg;43
gtg;88;gcg;86;gag;405;ggg;79;;gtg;48;gcg;43;gag;38;ggg;38
;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;
E79;introns;;effectifs;;%;;;;E79;introns;;génomes;;%;;
ttt;14;tct;3;tat;30;tgt;3;;ttt;6;tct;3;tat;22;tgt;3
ctt;57;cct;23;cat;8;cgt;0;;ctt;13;cct;8;cat;4;cgt;0
att;6;act;13;aat;5;agt;3;;att;4;act;9;aat;5;agt;3
gtt;4;gct;5;gat;5;ggt;5;;gtt;3;gct;5;gat;4;ggt;4
ttc;3;tcc;29;tac;1 568;tgc;18;;ttc;3;tcc;5;tac;100;tgc;13
ctc;1;ccc;6;cac;14;cgc;4;;ctc;1;ccc;4;cac;11;cgc;4
atc;18;acc;0;aac;10;agc;11;;atc;6;acc;0;aac;6;agc;8
gtc;0;gcc;1;gac;23;ggc;9;;gtc;0;gcc;1;gac;3;ggc;5
tta;23;tca;16;taa;10;tga;4;;tta;10;tca;11;taa;4;tga;3
cta;3;cca;63;caa;187;cga;166;;cta;3;cca;9;caa;10;cga;9
ata;575;aca;6;aaa;68;aga;594;;ata;87;aca;4;aaa;10;aga;73
gta;6;gca;3;gaa;35;gga;27;;gta;6;gca;3;gaa;10;gga;11
ttg;506;tcg;3;tag;16;tgg;6;;ttg;82;tcg;1;tag;13;tgg;5
ctg;9;ccg;14;cag;22;cgg;5;;ctg;9;ccg;5;cag;10;cgg;3
atg;189;acg;9;aag;406;agg;18;;atg;14;acg;8;aag;9;agg;6
gtg;8;gcg;5;gag;16;ggg;19;;gtg;8;gcg;5;gag;8;ggg;9

Les introns des eucaryotes. Corrélation introns/tRNAs[modifier | modifier le wikicode]

E79;tRNAs;introns;sans in;%sans;;C42;tRNAs;introns;sans in;%sans
ctc;11;1;10;91;;acc;0;0;0;100
cgc;24;3;21;88;;agt;0;0;0;100
ccc;29;5;24;83;;cat;0;0;0;100
cat;36;6;30;83;;cgc;0;0;0;100
ttt;51;11;40;78;;gcc;0;0;0;100
tat;57;24;33;58;;gtc;1;1;0;0
gtc;67;0;67;100;;taa;1;1;0;0
tgt;68;2;66;97;;tag;1;1;0;0
acc;68;0;68;100;;tcc;1;1;0;0
gcc;69;1;68;99;;tgt;1;1;0;0
atc;71;14;57;80;;ccc;1;0;1;100
taa;75;8;67;89;;aat;2;2;0;0
aat;75;4;71;95;;gat;2;2;0;0
gat;76;4;72;95;;ttt;2;2;0;0
ggt;80;4;76;95;;ggt;2;1;1;50
agt;80;2;78;98;;tat;2;0;2;100
tag;81;13;68;84;;atc;6;1;5;83
tcc;86;23;63;73;;tga;12;9;3;25
tga;140;3;137;98;;ctc;18;2;16;89
cgg;369;4;365;99;;ccg;36;31;5;14
ccg;405;11;394;97;;cgg;55;17;38;69
tcg;438;2;436;100;;ata;59;59;0;0
acg;480;7;473;99;;gcg;60;36;24;40
cta;486;2;484;100;;gta;64;25;39;61
ata;564;*454;110;20;;acg;66;25;41;62
tca;579;13;566;98;;agg;69;36;33;48
ggg;582;15;567;97;;ggg;69;33;36;52
tta;592;18;574;97;;cta;75;68;7;9
cga;609;*131;478;78;;tcg;80;66;14;18
gcg;611;4;607;99;;ctg;89;71;18;20
gta;635;5;630;99;;cga;92;80;12;13
ttg;657;*400;257;39;;tca;92;43;49;53
aga;682;*469;213;31;;gtg;94;37;57;61
ctg;711;7;704;99;;aca;100;30;70;70
aca;716;5;711;99;;tta;132;35;97;73
agg;794;14;780;98;;gca;141;43;98;70
ctt;857;*45;812;95;;tgc;143;30;113;79
cgt;884;0;884;100;;gga;146;42;104;71
cct;908;18;890;98;;cag;149;65;84;56
agc;910;9;901;99;;agc;155;144;11;7
tct;920;2;918;100;;aaa;155;131;24;15
tgg;936;5;931;99;;cct;155;125;30;19
caa;942;*148;794;84;;ctt;170;143;27;16
cca;995;*50;945;95;;tgg;173;124;49;28
gtg;1 002;6;996;99;;ttg;190;151;39;21
act;1 021;10;1011;99;;caa;196;59;137;70
gtt;1 022;3;1019;100;;cca;205;168;37;18
cac;1 028;11;1017;99;;aga;207;20;187;90
gga;1 041;21;1020;98;;cac;220;92;128;58
cag;1 095;17;1078;98;;cgt;238;91;147;62
gca;1 100;2;1098;100;;tac;252;250;2;1
gaa;1 176;28;1148;98;;gaa;252;50;202;80
ttc;1 195;2;1193;100;;ttc;296;261;35;12
att;1 238;5;1233;100;;gag;296;170;126;43
tac;1 310;*1239;71;5;;aac;297;94;203;68
gag;1 401;13;1388;99;;tct;310;35;275;89
ggc;1 411;7;1404;100;;atg;324;104;220;68
aaa;1 413;*54;1359;96;;act;332;42;290;87
gac;1 571;18;1553;99;;att;378;141;237;63
aac;1 592;8;1584;99;;gct;389;119;270;69
aag;1 627;*321;1306;80;;gtt;401;59;342;85
gct;1 733;4;1729;100;;gac;409;125;284;69
tgc;1 845;14;1831;99;;aag;426;202;224;53
atg;2 188;*149;2039;93;;ggc;487;102;385;79

Les introns des archées[modifier | modifier le wikicode]

Liste des noms et des codes KEGG[modifier | modifier le wikicode]

  • Lien aux tableaux: Liste des noms et des codes KEGG.
  • Légende: Certains archées ne se trouve pas dans la base KEGG, aussi je leurs ai attribué un code à 3 lettre suivi de * comme hme*
Correspondance entre code KEGG et nom;
KEGG;Nom gtRNAdb
aho;Acidianus hospitalis W1 
asc;Acidilobus saccharovorans 345-15 
abi;Aciduliprofundum boonei T469 
acf;Aciduliprofundum sp. MAR08-339
ape;Aeropyrum pernix K1
afu;Archaeoglobus fulgidus DSM 4304 
afg;Archaeoglobus fulgidus DSM 8774 
apo;Archaeoglobus profundus DSM 5631
ast;Archaeoglobus sulfaticallidus PM70-1 
ave;Archaeoglobus veneficus SNP6 
cma;Caldivirga maquilingensis IC-167 
kcr;Candidatus Korarchaeum cryptofilum
mer;Candidatus Methanomassiliicoccus intestinalis Issoire-Mx1 
mear;Candidatus Methanoplasma termitum MpT1
dka;Desulfurococcus kamchatkensis 1221n 
dmu;Desulfurococcus mucosus DSM 2162
fpl;Ferroglobus placidus DSM 10642 
fac;Ferroplasma acidarmanus fer1
gac;Geoglobus acetivorans SBH6
hje;Halalkalicoccus jeotgali B3 
hhi;Haloarcula hispanica ATCC 33960 CGMCC 1.2049 
hhn;Haloarcula hispanica N601
hma;Haloarcula marismortui ATCC 43049 
hab;Haloarcula sp. CBA1115 
hsl;Halobacterium salinarum R1 DSM 671
hdl;Halobacterium sp. DL1 
hal;Halobacterium sp. NRC-1 
hme;Haloferax mediterranei ATCC 33500
hme*;Haloferax mediterranei ATCC 33500 CGMCC 1.2087 
hvo;Haloferax volcanii DS2 
hbo;Halogeometricum borinquense DSM 11551 PR 3
hmu;Halomicrobium mukohataei DSM 12286 
hxa;Halopiger xanaduensis SH-6 
hwc;Haloquadratum walsbyi C23
hwa;Haloquadratum walsbyi DSM 16790 HBSQ001 
hti;Halorhabdus tiamatea SARL4B 
hut;Halorhabdus utahensis DSM 12940
hla;Halorubrum lacusprofundi ATCC 49239 
hlr;Halostagnicola larsenii XH-48 
htu;Haloterrigena turkmenica DSM 5511
hru;Halovivax ruber XH-70
hbu;Hyperthermus butylicus DSM 5456 
iho;Ignicoccus hospitalis KIN4/I 
iag;Ignisphaera aggregans DSM 17230
mcn;Metallosphaera cuprina Ar-4 
mse;Metallosphaera sedula DSM 5348
mfi;Methanobacterium formicicum 
mfc;Methanobacterium formicicum BRM9 
mel;Methanobacterium lacus AL-21
mew;Methanobacterium paludis SWAN1 
meth;Methanobacterium sp. MB1 
mru;Methanobrevibacter ruminantium M1
msi;Methanobrevibacter smithii ATCC 35061 PS DSMZ 861 
meb;Methanobrevibacter sp. AbM4 
mfe;Methanocaldococcus fervens AG86 
mif;Methanocaldococcus infernus ME 
mja;Methanocaldococcus jannaschii DSM 2661
mfs;Methanocaldococcus sp. FS406-22 
mjh*;Methanocaldococcus sp. JH146 
mvu;Methanocaldococcus vulcanius M7
rci;Methanocella arvoryzae MRE50 
mez;Methanocella conradii HZ254 
mpd;Methanocella paludicola SANAE
mbu;Methanococcoides burtonii DSM 6242 
mmet;Methanococcoides methylutens MM1 
mae;Methanococcus aeolicus Nankai-3 
mmq;Methanococcus maripaludis C5 
mmx;Methanococcus maripaludis C6
mmz;Methanococcus maripaludis C7 
mmp;Methanococcus maripaludis S2 
mmd;Methanococcus maripaludis X1
mvn;Methanococcus vannielii SB 
mvo;Methanococcus voltae A3 
mla;Methanocorpusculum labreanum Z
mbg;Methanoculleus bourgensis MS2 MS2T 
mem;Methanoculleus marisnigri JR1 
mev;Methanohalobium evestigatum Z-7303
mmh;Methanohalophilus mahii DSM 5219 
mpi;Methanolacinia petrolearia DSM 11571 
mta*;Methanolinea tarda NOBI-1
mpy;Methanolobus psychrophilus R15 
mhz;Methanomethylovorans hollandica DSM 15978 
mka;Methanopyrus kandleri AV19
mbn;Methanoregula boonei 6A8
mfo;Methanoregula formicica SMSP 
mco*;Methanosaeta concilii GP6 
mhi;Methanosaeta harundinacea 6Ac
mth*;Methanosaeta thermophila PT 
mzh;Methanosalsum zhilinae DSM 4017 
mac;Methanosarcina acetivorans C2A
mbar;Methanosarcina barkeri 227 
mbak;Methanosarcina barkeri 3 
mby;Methanosarcina barkeri MS
mba;Methanosarcina barkeri str. Fusaro 
mbw;Methanosarcina barkeri str. Wiesmoor 
mhor;Methanosarcina horonobensis HB-1 JCM 15518
mls;Methanosarcina lacustris Z-7289 
mmac;Methanosarcina mazei C16 
mma;Methanosarcina mazei Go1
mml*;Methanosarcina mazei LYC 
mmj;Methanosarcina mazei S-6 
mma*;Methanosarcina mazei SarPi
mmaz;Methanosarcina mazei Tuc01 
mmw*;Methanosarcina mazei WWM610 
msj;Methanosarcina siciliae C2J
msz;Methanosarcina siciliae HI350 
msw;Methanosarcina siciliae T4/M 
mek;Methanosarcina sp. Kolksee
metm;Methanosarcina sp. MTP4 
mef;Methanosarcina sp. WH1 
meq;Methanosarcina sp. WWM596
mthe;Methanosarcina thermophila CHTI-55 
mthr;Methanosarcina thermophila TM-1 
mvc;Methanosarcina vacuolata Z-761
mst;Methanosphaera stadtmanae DSM 3091
mpl;Methanosphaerula palustris E1-9c 
mhu;Methanospirillum hungatei JF-1
mmg;Methanothermobacter marburgensis str. Marburg 
metc;Methanothermobacter sp. CaT2 
mth;Methanothermobacter thermautotrophicus str. Delta H
mok;Methanothermococcus okinawensis IH1
mfv;Methanothermus fervidus DSM 2088
mig;Methanotorris igneus Kol 5
neq;Nanoarchaeum equitans Kin4-M
nmg;Natrialba magadii ATCC 43099 
npe;Natrinema pellirubrum DSM 15624 
nat;Natrinema sp. J7-2
nge;Natronobacterium gregoryi SP2 
nou;Natronococcus occultus SP4 
nmo;Natronomonas moolapensis 8.8.11
nph;Natronomonas pharaonis DSM 2160 Gabara
nmr;Nitrosopumilus maritimus SCM1
ppac;Palaeococcus pacificus DY20341 
pto;Picrophilus torridus DSM 9790
pai;Pyrobaculum aerophilum str. IM2 
pas;Pyrobaculum arsenaticum DSM 13514 
pcl;Pyrobaculum calidifontis JCM 11548
pis;Pyrobaculum islandicum DSM 4184 
pog;Pyrobaculum oguniense TE7 
p18*;Pyrobaculum sp. 1860
pfi;Pyrococcus furiosus COM1 
pfu;Pyrococcus furiosus DSM 3638
pho;Pyrococcus horikoshii OT3 
pyn;Pyrococcus sp. NA2 
pys;Pyrococcus sp. ST04
pya;Pyrococcus yayanosii CH1
sali;Salinarchaeum sp. Harcht-Bsk1
shc;Staphylothermus hellenicus DSM 12710 
smr;Staphylothermus marinus F1 
sai;Sulfolobus acidocaldarius DSM 639
sii;Sulfolobus islandicus L.D.8.5 
sis;Sulfolobus islandicus L.S.2.15 
sia;Sulfolobus islandicus M.14.25
sim;Sulfolobus islandicus M.16.27 
sid;Sulfolobus islandicus M.16.4 
sir;Sulfolobus islandicus REY15A
siy;Sulfolobus islandicus Y.G.57.14 
sin;Sulfolobus islandicus Y.N.15.51 
ss9*;Sulfolobus solfataricus 98/2
ssp*;Sulfolobus solfataricus P2 
sto*;Sulfolobus tokodaii str. 7 
tba;Thermococcus barophilus MP 
teu;Thermococcus eurythermalis A501 
tga;Thermococcus gammatolerans EJ3 DSM 15229
tko;Thermococcus kodakarensis KOD1 
tlt;Thermococcus litoralis DSM 5473 
tnu;Thermococcus nautili 30-1
ton;Thermococcus onnurineus NA1 
tsi;Thermococcus sibiricus MM 739 
the;Thermococcus sp. 4557
tha;Thermococcus sp. AM4 
thc*;Thermococcus sp. CL1 
ths*;Thermococcus sp. ES1
tpe;Thermofilum pendens Hrk 5
tac;Thermoplasma acidophilum DSM 1728 
tvo;Thermoplasma volcanium GSS1 
tar;Thermoplasmatales archaeon BRNA1
tne*;Thermoproteus neutrophilus V24Sta 
ttn;Thermoproteus tenax Kra 1 
tuz;Thermoproteus uzoniensis 768-20
tag;Thermosphaera aggregans DSM 11486
vdi;Vulcanisaeta distributa DSM 14429 
vmo;Vulcanisaeta moutnovskia 768-28

Liste des introns par codon[modifier | modifier le wikicode]

  • Lien aux tableaux:Liste des introns par codon.
  • Légende: La recherche des introns se fait par la fonction sifter de gtRNAdb en notant le nombre d'introns, de 0 à 3, portés par le même tRNA, à la case Number of introns in each tRNA.
    I0 à I3 0 à 3 introns portés par le même tRNA.
    tpe, colonne erreurs. Ce génome affiche 2 valeurs différentes: Recherche sur tpe, la liste des introns donne 2 pour GTA alors que dans la liste des tRNAs il n’y a qu’un seul GTA. Mais la recherche sur GTA-I2 n’affiche pas tpe et affiche 7 introns avec 2 introns, au lieu de 8 attendus. Les décomptes par génomes auront donc 1 intron de moins que le décompte par codon.
    ape, colonne erreurs. Ce génome affiche 2 valeurs différentes: Recherche sur GTC-I1 affiche 2 pour ape. Recherche sur ape affiche 1 pour GTC.
Décompte des tRNAs archés par codons;;;;;;;;;décompte par génome;;;;;
codon;gene;tRNAs;I3;I2;I1;I0;total;introns;codon;gene;zéros;génomes;introns;erreurs
CAA;ttg;163;0;0;25;138;163;25;CAA;ttg;158;25;25;
CAC;gtg;170;0;2;7;161;170;9;CAC;gtg;174;9;9;
CAG;ctg;160;0;1;8;151;160;9;CAG;ctg;174;9;9;
CAT;atg;589;0;11;217;361;589;228;CAT;atg;10;173;228;
CCA;tgg;184;0;11;163;10;184;174;CCA;tgg;9;174;174;
CCC;ggg;155;0;0;11;144;155;11;CCC;ggg;172;11;11;
CCG;cgg;139;0;0;11;128;139;11;CCG;cgg;172;11;11;
CCT;agg;165;1;2;26;136;165;29;CCT;agg;154;29;29;
CGA;tcg;152;0;2;35;115;152;37;CGA;tcg;146;37;37;
CGC;gcg;159;0;2;6;151;159;8;CGC;gcg;175;8;8;
CGG;ccg;151;1;6;22;122;151;29;CGG;ccg;154;29;29;
CGT;acg;169;0;5;37;127;169;42;CGT;acg;141;42;42;
CTA;tag;1;0;0;0;1;1;0;CTA;tag;183;0;0;
CTC;gag;160;4;6;20;130;160;30;CTC;gag;153;30;30;
CTG;cag;165;1;3;10;151;165;14;CTG;cag;169;14;14;
CTT;aag;166;0;3;25;138;166;28;CTT;aag;156;27;28;
GAA;ttc;215;0;0;12;203;215;12;GAA;ttc;171;12;12;
GAC;gtc;212;0;2;11;199;212;13;GAC;gtc;170;13;13;
GAG;ctc;214;0;0;3;211;214;3;GAG;ctc;180;3;3;
GAT;atc;212;0;5;23;184;212;28;GAT;atc;155;28;28;
GCA;tgc;299;1;17;23;258;299;41;GCA;tgc;143;40;41;
GCC;ggc;243;0;1;14;228;243;15;GCC;ggc;168;15;15;
GCG;cgc;187;0;1;16;170;187;17;GCG;cgc;166;17;17;
GCT;agc;187;0;0;4;183;187;4;GCT;agc;179;4;4;
GGA;tcc;190;0;0;17;173;190;17;GGA;tcc;166;17;17;
GGC;gcc;184;0;1;4;179;184;5;GGC;gcc;178;5;5;
GGG;ccc;171;1;7;35;128;171;43;GGG;ccc;140;43;43;
GGT;acc;189;0;1;14;174;189;15;GGT;acc;168;15;15;
GTA;tac;190;0;7;99;84;190;106;GTA;tac;78;105;105;tpe
GTC;gac;218;1;8;7;202;218;16;GTC;gac;168;15;15;ape
GTG;cac;185;0;1;11;173;185;12;GTG;cac;171;12;12;
GTT;aac;214;0;7;32;175;214;39;GTT;aac;146;37;39;
TAA;tta;191;0;1;21;169;191;22;TAA;tta;162;21;22;
TAC;gta;186;0;6;12;168;186;18;TAC;gta;165;18;18;
TAG;cta;185;0;0;3;182;185;3;TAG;cta;180;3;3;
TAT;ata;2;0;0;2;0;2;2;TAT;ata;181;2;2;
TCA;tga;18;0;0;1;17;18;1;TCA;tga;182;1;1;
TCC;gga;189;0;3;14;172;189;17;TCC;gga;166;17;17;
TCG;cga;185;0;0;42;143;185;42;TCG;cga;141;42;42;
TCT;aga;186;0;0;34;152;186;34;TCT;aga;149;34;34;
TGA;tca;184;0;1;15;168;184;16;TGA;tca;167;16;16;
TGC;gca;256;0;3;13;240;256;16;TGC;gca;167;16;16;
TGG;cca;184;3;2;12;167;184;17;TGG;cca;166;17;17;
TGT;aca;198;2;6;32;158;198;40;TGT;aca;143;40;40;
TTA;taa;0;0;0;0;0;0;0;TTA;taa;183;0;0;
TTC;gaa;230;4;7;22;197;230;33;TTC;gaa;151;32;33;
TTG;caa;196;1;3;27;165;196;31;TTG;caa;152;31;31;
TTT;aaa;197;0;2;23;172;197;25;TTT;aaa;158;25;25;
AAA;ttt;0;0;0;0;0;0;0;AAA;ttt;183;0;0;
AAC;gtt;1;0;0;1;0;1;1;AAC;gtt;182;1;1;
AAG;ctt;0;0;0;0;0;0;0;AAG;ctt;183;0;0;
AAT;att;0;0;0;0;0;0;0;AAT;att;183;0;0;
ACA;tgt;0;0;0;0;0;0;0;ACA;tgt;183;0;0;
ACC;ggt;1;0;0;1;0;1;1;ACC;ggt;182;1;1;
ACG;cgt;1;0;0;1;0;1;1;ACG;cgt;182;1;1;
ACT;agt;0;0;0;0;0;0;0;ACT;agt;183;0;0;
AGA;tct;0;0;0;0;0;0;0;AGA;tct;183;0;0;
AGC;gct;0;0;0;0;0;0;0;AGC;gct;183;0;0;
AGG;cct;0;0;0;0;0;0;0;AGG;cct;183;0;0;
AGT;act;0;0;0;0;0;0;0;AGT;act;183;0;0;
ATA;tat;0;0;0;0;0;0;0;ATA;tat;183;0;0;
ATC;gat;0;0;0;0;0;0;0;ATC;gat;183;0;0;
ATG;cat;0;0;0;0;0;0;0;ATG;cat;183;0;0;
ATT;aat;0;0;0;0;0;0;0;ATT;aat;183;0;0;

Liste des introns par génome[modifier | modifier le wikicode]

Thermococci Methanococci[modifier | modifier le wikicode]

;Euryarchaeota;;;;;;;;;;;;;;;;;;;;
;Thermococci;;19;;;;;;;;;;;;;;;;;;
;;pfi;pfu;pho;ppac;pya;pyn;pys;tba;teu;tga;tha;thc*;the;ths*;tko;tlt;tnu;ton;tsi;moyenne
CAT;atg;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1
CCA;tgg;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1
autres;-;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0
tRNAs;-;46;46;46;47;46;46;46;46;46;46;46;46;47;46;46;46;46;46;46;46,1
;;;;;;;;;;;;;;;;;;;;;
;Methanococci;;16;;;;;;;;;;;;;;;;;;
;;mae;mfe;mfs;mif;mig;mja;mjh*;mmd;mmp;mmq;mmx;mmz;mok;mvn;mvo;mvu;;;;moyenne
CAT;atg;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;;;;1
CCA;tgg;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;;;;1
autres;-;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;;;0
tRNAs;-;39;37;37;38;35;37;37;38;38;38;38;38;38;38;39;37;;;;37,6

Methanobacteria[modifier | modifier le wikicode]

  • Lien aux tableaux: Methanobacteria.
  • Légende: cyan, (mth,ggg) est un gène avec 2 introns.
;Methanobacteria;;;13;;;;;;;;;;;
;;meb;mel;metc;meth;mew;mfc;mfi;mfv;mmg;mru;msi;mst;mth;Total
CAT;atg;1;1;1;1;1;1;1;1;1;1;1;1;1;13
CCA;tgg;1;1;1;1;1;1;1;1;1;1;1;1;1;13
GGG;ccc;0;0;0;0;0;0;0;1;0;0;0;0;1;2
GTA;tac;0;0;0;0;1;0;0;0;0;0;0;0;0;1
TTG;caa;0;1;1;1;1;1;1;0;1;0;0;0;0;7
autres;-;0;0;0;0;0;0;0;0;0;0;0;0;0;0
;;;;;;;;;;;;;;;moyenne
tRNA;-;38;43;39;44;48;46;47;41;40;59;36;42;39;43,2
total;-;2;3;3;3;4;3;3;3;3;2;2;2;3;2,8

Methanomicrobia[modifier | modifier le wikicode]

  • Lien aux tableaux: Methanomicrobia.
  • Légende: Il n'y a que des tRNAs à un seul intron quand c'est le cas. Le cas de (mth*,tgc) représente 2 tRNAs avec un intron chacun.
archée;;mac;mba;mbak;mbar;mbg;mbn;mbu;mbw;mby;mco*;mef;mek;mem;meq;metm;mev;mez;mfo;mhi;mhor;mhu;mhz;mla;mls;mma;mma*;mmac;mmaz;mmet;mmh;mmj;mml*;mmw*;mpd;mpi;mpl;mpy;msj;msw;msz;mta*;mth*;mthe;mthr;mvc;mzh;rci;Total
CAA;ttg;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
CAC;gtg;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1
CAG;ctg;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
CAT;atg;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;0;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;46
CCA;tgg;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;47
CCC;ggg;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
CCG;cgg;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;1
CCT;agg;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
CGA;tcg;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
CGC;gcg;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
CGG;ccg;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0;0;1;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;1;0;6
CGT;acg;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;3
CTA;tag;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
CTC;gag;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
CTG;cag;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
CTT;aag;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GAA;ttc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1
GAC;gtc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GAG;ctc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GAT;atc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GCA;tgc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;3
GCC;ggc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GCG;cgc;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;3
GCT;agc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GGA;tcc;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;1;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;1;0;0;0;0;0;5
GGC;gcc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;2
GGG;ccc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GGT;acc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GTA;tac;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;47
GTC;gac;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GTG;cac;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GTT;aac;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;2
TAA;tta;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
TAC;gta;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1
TAG;cta;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
TAT;ata;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
TCA;tga;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
TCC;gga;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;3
TCG;cga;1;1;1;1;0;0;1;1;1;1;1;1;0;1;1;1;1;0;1;1;0;1;0;1;1;1;1;1;1;1;1;1;1;0;0;0;1;1;1;1;0;1;1;1;1;1;0;36
TCT;aga;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
TGA;tca;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;3
TGC;gca;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
TGG;cca;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
TGT;aca;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;3
TTA;taa;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
TTC;gaa;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
TTG;caa;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
TTT;aaa;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;3
AAC;gtt;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;moyenne
tRNA;;58;62;60;61;47;49;51;62;59;48;56;62;49;58;57;50;50;49;46;60;51;52;53;57;57;57;58;42;55;54;57;57;57;50;48;56;53;58;57;57;47;47;58;58;62;50;54;54,4
total;;4;4;4;4;3;3;5;4;4;11;4;4;3;4;4;7;6;3;11;4;3;5;2;4;4;4;4;4;6;5;4;4;4;4;3;3;5;5;4;4;3;15;4;4;4;7;3;4,6
archée;;mac;mba;mbak;mbar;mbg;mbn;mbu;mbw;mby;mco*;mef;mek;mem;meq;metm;mev;mez;mfo;mhi;mhor;mhu;mhz;mla;mls;mma;mma*;mmac;mmaz;mmet;mmh;mmj;mml*;mmw*;mpd;mpi;mpl;mpy;msj;msw;msz;mta*;mth*;mthe;mthr;mvc;mzh;rci;

Halobacteria[modifier | modifier le wikicode]

  • Lien aux tableaux:Halobacteria.
  • Légende: Il n'y a que des tRNAs à un seul intron. Le vert, cas de (hal,atg) représente 2 tRNAs à un seul intron chacun.
archée;;hab;hal;hbo;hdl;hhi;hhn;hje;hla;hlr;hma;hme;hme*;hmu;hru;hsl;hti;htu;hut;hvo;hwa;hwc;hxa;nat;nge;nmg;nmo;nou;npe;nph;sali;Total
CAA;ttg;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
CAC;gtg;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
CAG;ctg;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
CAT;atg;1;2;1;2;1;1;1;1;2;1;1;1;1;2;2;1;1;1;1;1;1;1;2;2;2;3;1;1;2;2;42
CCA;tgg;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;30
CCC;ggg;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
CCG;cgg;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
CCT;agg;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
CGA;tcg;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
CGC;gcg;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
CGG;ccg;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;2
CGT;acg;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
CTA;tag;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
CTC;gag;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
CTG;cag;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
CTT;aag;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GAA;ttc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GAC;gtc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GAG;ctc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GAT;atc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GCA;tgc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GCC;ggc;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;1;0;1;0;0;0;0;0;3
GCG;cgc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GCT;agc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GGA;tcc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GGC;gcc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GGG;ccc;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1
GGT;acc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GTA;tac;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GTC;gac;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GTG;cac;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
GTT;aac;0;0;0;0;0;0;0;0;1;0;2;2;0;0;0;0;1;0;0;0;0;1;0;0;1;0;0;0;0;0;8
TAA;tta;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
TAC;gta;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
TAG;cta;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
TAT;ata;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
TCA;tga;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
TCC;gga;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1
TCG;cga;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
TCT;aga;1;0;0;0;1;1;1;0;0;1;0;0;1;0;0;0;0;0;0;0;0;1;0;1;1;1;0;0;1;0;11
TGA;tca;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
TGC;gca;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
TGG;cca;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
TGT;aca;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
TTA;taa;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
TTC;gaa;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1
TTG;caa;0;0;0;1;0;0;0;0;0;0;1;1;0;0;0;0;0;0;1;0;0;1;0;0;1;0;1;0;0;1;8
TTT;aaa;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;
ACC;ggt;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;1
ACG;cgt;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;moyen
tRNA;;49;47;52;47;49;49;50;51;48;49;55;57;48;47;47;49;50;46;53;45;45;50;52;49;49;46;54;49;46;47;49,2
total;;3;3;3;4;3;3;5;3;5;3;5;5;3;4;3;2;3;2;4;2;2;5;4;4;7;5;3;3;4;4;3,6
archée;;hab;hal;hbo;hdl;hhi;hhn;hje;hla;hlr;hma;hme;hme*;hmu;hru;hsl;hti;htu;hut;hvo;hwa;hwc;hxa;nat;nge;nmg;nmo;nou;npe;nph;sali;

Crenarchaeota[modifier | modifier le wikicode]

  • Lien aux tableaux:Crenarchaeota.
  • Lien de la dernière colonne.
  • Article sur les introns des archées 2014 [1]
  • Légende: Pour le tableur on peut conserver les marques ? $ ° pour les couleurs à remplacer avec le code html adéquat. Remplacer § par 0. Les 3 côtes pour gras de wikipédia sont à supprimer aussi. Ne pas enlever les astérisques qui font partie du pseudo code KEGG et @ qui indique les exceptions.
    Chaque tRNA avec, $ rouge 3 introns, ? cyan 2 introns, blanc et ° jaune 1 intron
    I0 I1 I2 I3 pour un tRNA avec 0 1 2 3 introns. Le décompte est obtenu en mettant dans la case Number of introns in each tRNA de sifter de la base de donnée gtRNAdb (ref.) 0 1 2 3.
    Exceptions, représentées par @
    _ (atg,pcl tuz) ont 6 introns chacun pour 3 tRNAs ce qui fait 3 tRNAs à 2 introns chacun.
    _ (atg,pog tpe) ont 4 introns chacun pour 3 tRNAs ce qui fait 1 tRNA à 2 introns chacun et 2 tRNAs à 1 intron.
    _ (atg,p18*) a 5 introns pour 3 tRNAs ce qui fait 2 tRNAs à 2 introns chacun et 1 tRNA à 1 intron.
    _ (atg,tag) a 3 introns pour 3 tRNAs. Après contrôle j'ai 1 tRNAs à 2 introns et 1 tRNA à 1 intron, donc 2 tRNAs à introns.
    _ (ape,gac), ambiguité dans la base de données. Recherche sur GTC avec I1 affiche 2 pour ape. Recherche sur ape avec I1 affiche 1 pour GTC.
    _ (tpe,tac), ambiguïté dans la base de données. Recherche sur tpe, la liste des introns donne 2 pour GTA alors que dans la liste des tRNAs il n’y a qu’un seul GTA. Mais la recherche sur GTA I2 n’affiche pas tpe et affiche 7 introns avec 2 modifications, au lieu de 8 attendus. Les décomptes par génomes auront donc 1 tRNA modifié de moins que le décompte par codon.
    _ (cma,tRNA), ambiguité dans la base de données. Recherche sur total des tRNAs de cma donne 55 mais l'affichage du tableau des tRNAs par codon (recherche sur un tRNA de la liste des 55) donne 47.
crenarchaeota;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;aho;ape;asc;cma;dka;dmu;hbu;iag;iho;mcn;mse;p18*;pai;pas;pcl;pis;pog;sai;shc;sia;sid;sii;sim;sin;sir;sis;siy;smr;ss9*;ssp*;sto*;tag;tne*;tpe;ttn;tuz;vdi;vmo;introns;zéros;génomes;I3;I2;I1;I3+I2;;
CAA;ttg;0;0;0;0;1;1;0;0;0;1;1;1;0;0;0;0;0;0;1;1;1;1;1;1;1;1;1;1;1;1;1;1;0;1;0;0;0;1;21;17;21;§;§;21;§;CAA;ttg
CAC;gtg;0;0;0;1;0;0;0;0;0;0;0;1;0;0;?1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;?1;0;0;0;1;7;31;7;§;2;5;2;CAC;gtg
CAG;ctg;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;?1;1;0;1;1;9;29;9;§;1;8;1;CAG;ctg
CAT;atg;°2;°2;1;0;1;1;1;1;1;°2;°2;?3@;°3;°3;?3@;°2;?3@;°2;°2;°2;°2;°2;°2;°2;°2;°2;°2;°2;°2;°2;°3;?2@;°2;?3@;°3;?3@;°2;°2;77;1;37;§;?11;66;11;CAT;atg
CCA;tgg;1;1;0;0;?1;?1;1;?1;1;1;1;1;0;0;?1;0;0;1;?1;1;1;1;1;1;1;1;1;?1;1;1;1;?1;1;?1;0;?1;0;0;29;9;29;§;?9;20;9;CCA;tgg
CCC;ggg;0;0;0;0;0;0;0;0;0;0;0;1;0;0;1;1;0;1;0;0;0;0;0;0;0;0;1;0;0;0;0;0;1;1;1;1;0;0;9;29;9;§;§;9;§;CCC;ggg
CCG;cgg;0;0;0;0;0;0;0;0;0;0;0;1;1;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;1;0;0;7;31;7;§;§;7;§;CCG;cgg
CCT;agg;1;0;0;0;0;0;0;1;1;1;1;?1;1;0;1;1;0;1;1;1;1;1;1;1;1;1;1;1;1;1;1;0;1;1;?1;$1;0;0;27;11;27;$1;2;24;3;CCT;agg
CGA;tcg;1;1;0;0;1;1;1;0;1;1;1;1;0;?1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;?1;1;1;1;1;34;4;34;§;2;32;2;CGA;tcg
CGC;gcg;0;0;0;0;0;0;0;0;0;0;0;1;0;0;?1;0;0;0;1;0;0;0;0;0;0;0;0;1;0;0;0;0;1;?1;1;1;0;0;8;30;8;§;2;6;2;CGC;gcg
CGG;ccg;0;1;1;1;1;1;1;?1;1;0;0;1;0;0;?1;?1;0;0;1;0;0;0;0;0;0;0;0;1;0;0;0;1;?1;$1;?1;1;?1;0;19;19;19;$1;?6;12;7;CGG;ccg
CGT;acg;1;1;1;1;1;1;1;0;1;1;1;1;1;1;?1;?1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;?1;1;?1;?1;1;1;37;1;37;§;?5;32;5;CGT;acg
CTA;tag;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;§;38;§;§;§;§;§;CTA;tag
CTC;gag;0;0;0;0;1;1;0;0;0;1;1;?1;?1;?1;$1;$1;?1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;$1;?1;$1;?1;0;1;30;8;30;$'''4;?6;20;10;CTC;gag
CTG;cag;0;0;1;0;0;1;0;0;0;0;0;?1;1;0;$1;?1;0;0;1;0;0;0;0;0;0;0;0;1;0;0;0;1;?1;0;1;1;0;0;12;26;12;$1;3;8;4;CTG;cag
CTT;aag;1;1;1;0;0;0;1;1;°2;1;1;?1;0;0;1;?1;0;1;0;1;1;1;1;1;1;1;1;0;1;1;1;0;1;1;?1;1;0;0;28;11;27;§;3;25;3;CTT;aag
GAA;ttc;0;0;0;0;0;0;0;1;0;1;1;0;0;0;1;1;0;1;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;1;0;0;1;0;10;28;10;§;§;10;§;GAA;ttc
GAC;gtc;0;0;0;1;0;0;0;0;0;0;0;1;1;1;?1;1;1;0;1;0;0;0;0;0;0;0;0;1;0;0;0;0;1;1;0;0;1;?1;13;25;13;§;2;11;2;GAC;gtc
GAG;ctc;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;1;0;3;35;3;§;§;3;§;GAG;ctc
GAT;atc;1;0;1;1;0;0;0;0;0;1;1;?1;0;0;1;?1;0;0;0;1;1;1;1;1;1;1;1;0;1;1;1;0;?1;?1;1;?1;1;1;25;13;25;§;?5;20;5;GAT;atc
GCA;tgc;0;1;1;0;1;1;1;1;1;?1;?1;$1;1;1;?1;?1;1;1;1;?1;?1;?1;?1;?1;?1;?1;?1;1;?1;?1;1;1;?1;?1;1;?1;1;1;36;2;36;$1;?'''17;18;18;GCA;tgc
GCC;ggc;0;0;0;0;0;0;0;0;0;0;0;1;1;1;1;1;1;0;1;0;0;0;0;0;0;0;0;1;0;0;0;0;1;1;?1;1;0;0;12;26;12;§;1;11;1;GCC;ggc
GCG;cgc;0;0;0;0;0;0;0;0;0;0;0;?1;1;1;1;1;1;0;1;0;0;0;0;0;0;0;0;1;0;0;1;0;1;1;1;0;0;0;12;26;12;§;1;11;1;GCG;cgc
GCT;agc;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;3;35;3;§;§;3;§;GCT;agc
GGA;tcc;1;0;0;0;0;0;0;0;0;1;1;1;0;1;1;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;1;1;11;27;11;§;§;11;§;GGA;tcc
GGC;gcc;0;0;0;0;0;0;0;0;0;0;0;1;0;0;?1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;3;35;3;§;1;2;1;GGC;gcc
GGG;ccc;1;1;1;1;1;1;1;1;1;1;1;?1;1;1;?1;?1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;$1;?1;?1;?1;1;38;§;38;$1;?6;31;7;GGG;ccc
GGT;acc;1;0;0;0;0;0;0;0;0;1;1;1;?1;1;1;0;1;0;1;0;0;0;0;0;0;0;0;1;0;0;0;0;1;1;1;1;0;1;15;23;15;§;1;14;1;GGT;acc
GTA;tac;1;1;?1;1;1;1;1;1;1;1;1;?1;1;?1;?1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;°2@;1;?1;?1;?1;39;§;38;§;?7;32;7;GTA;tac
GTC;gac;0;°2@;0;0;0;0;0;0;0;0;0;?1;?1;?1;?1;$1;?1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;?1;?1;?1;0;0;0;11;28;10;$1;?8;2;9;GTC;gac
GTG;cac;0;0;0;0;1;1;0;1;1;0;0;1;1;0;?1;0;0;0;1;0;0;0;0;0;0;0;0;1;0;0;0;1;0;1;0;0;0;0;11;27;11;§;1;10;1;GTG;cac
GTT;aac;0;0;0;0;1;1;0;0;0;0;1;?1;1;0;?1;?1;0;1;1;1;1;1;1;1;1;1;1;1;1;1;0;?1;?1;?1;1;?1;1;0;26;12;26;§;?7;19;7;GTT;aac
TAA;tta;1;0;0;0;0;0;0;0;0;1;1;1;0;0;0;0;0;0;1;1;1;1;1;1;1;1;1;1;1;1;0;0;0;1;0;1;0;1;19;19;19;§;§;19;§;TAA;tta
TAC;gta;0;0;0;1;1;1;0;0;1;0;0;?1;1;1;?1;?1;1;0;1;0;0;0;0;0;0;0;0;1;0;0;0;1;?1;?1;1;?1;0;0;17;21;17;§;?6;11;6;TAC;gta
TAG;cta;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;3;35;3;§;§;3;§;TAG;cta
TAT;ata;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;§;38;§;§;§;§;§;TAT;ata
TCA;tga;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;37;1;§;§;1;§;TCA;tga
TCC;gga;0;0;0;0;0;0;0;0;0;0;0;1;1;1;?1;1;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;?1;1;?1;1;1;1;13;25;13;§;3;10;3;TCC;gga
TCG;cga;0;0;0;0;0;0;0;0;0;0;0;1;0;1;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;1;0;0;6;32;6;§;§;6;§;TCG;cga
TCT;aga;0;1;0;0;0;0;0;0;0;1;1;1;0;0;1;1;0;1;0;1;1;1;1;1;1;1;1;0;1;1;1;1;1;1;1;1;0;0;23;15;23;§;§;23;§;TCT;aga
TGA;tca;1;0;0;0;0;0;0;0;0;1;1;1;0;1;1;?1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;1;0;1;1;1;13;25;13;§;1;12;1;TGA;tca
TGC;gca;0;0;0;0;1;?1;0;0;1;1;1;1;1;0;?1;1;0;0;1;0;0;0;0;0;0;0;0;1;0;0;0;1;0;?1;1;1;1;0;16;22;16;§;3;13;3;TGC;gca
TGG;cca;0;0;0;1;0;0;0;0;0;0;0;1;1;1;$1;$1;1;0;1;0;0;0;0;0;0;0;0;1;0;0;0;0;?1;$1;1;1;?1;1;15;23;15;$'''3;2;10;5;TGG;cca
TGT;aca;1;1;1;?1;1;1;0;0;1;1;1;?1;?1;1;$1;?1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;1;?1;$1;?1;1;1;1;36;2;36;$2;?6;28;8;TGT;aca
TTA;taa;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;§;38;§;§;§;§;§;TTA;taa
TTC;gaa;1;0;0;0;0;0;0;0;0;0;1;?1;$1;?1;$1;$1;?1;1;0;1;1;1;1;1;1;1;1;0;1;1;1;0;$1;?1;1;?1;1;0;25;13;25;$'''4;?5;16;9;TTC;gaa
TTG;caa;0;0;1;0;1;1;1;0;0;0;0;1;0;0;$1;?1;0;0;1;0;0;0;0;0;0;0;0;1;0;0;0;1;?1;0;?1;1;1;0;14;24;14;$1;3;10;4;TTG;caa
TTT;aaa;0;1;1;0;0;0;0;1;0;0;0;1;0;0;1;1;0;1;0;1;1;1;1;1;1;1;1;0;1;1;1;0;1;1;?1;?1;0;0;22;16;22;§;2;20;2;TTT;aaa
archée;;aho;ape;asc;cma;dka;dmu;hbu;iag;iho;mcn;mse;p18*;pai;pas;pcl;pis;pog;sai;shc;sia;sid;sii;sim;sin;sir;sis;siy;smr;ss9*;ssp*;sto*;tag;tne*;tpe;ttn;tuz;vdi;vmo;archée;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;moyenne;;;;;;;;
tRNA;;47;46;46;55;47;46;46;46;47;46;46;46;46;46;46;46;48;46;46;46;46;46;46;46;48;46;47;46;46;46;46;47;46;46;47;47;46;47;46,6;;;;;;;;
total;;16;15;12;10;16;17;10;11;15;23;25;41;24;22;40;32;21;21;26;19;19;19;19;19;19;19;20;26;19;19;24;20;33;42;35;34;22;21;22,2;;;;;;;;
I0;;33;35;36;38;32;31;38;37;34;26;24;9;26;28;10;17;29;28;23;30;30;30;30;30;30;30;29;23;30;30;26;29;16;9;15;16;27;28;I0;;;;;;;;
I1;;16;15;11;9;15;15;10;9;15;22;24;25;19;17;15;16;17;21;25;18;18;18;18;18;18;18;19;25;18;18;24;19;19;24;25;19;18;19;I1;;;;;;;;
I2;;§;§;1;1;1;2;§;2;§;1;1;?15;?4;5;?19;?12;4;§;1;1;1;1;1;1;1;1;1;1;1;1;§;1;?12;?14;?9;?14;4;2;I2;;;;;;;;
I3;;§;§;§;§;§;§;§;§;§;§;§;$1;$1;§;$'''6;$'''4;§;§;§;§;§;§;§;§;§;§;§;§;§;§;§;§;$2;$'''4;$1;$1;§;§;I3;;;;;;;;

Archaeoglobi Thermoplasmata[modifier | modifier le wikicode]

  • Lien aux tableaux:Archaeoglobi Thermoplasmata.
  • Légende: cyan, (mka,gaa) a 2 tRNA avec 2 introns chacun. Vert, (aciduliprofundum, atg), 2 et 3 tRNAs avec un intron chacun.
;;;archaeoglobi;;7;;;;;;thermoplasmata;;;7;;;;;Pyri 1;;Aciduliprofundum 2;;;
archée;;afg;afu;apo;ast;ave;fpl;gac;Total;;tac;tvo;pto;fac;tar;mer;mear;Total;;mka;abi;acf;;
CAA;ttg;1;1;0;1;0;0;0;3;ttg;0;0;0;0;0;0;0;;ttg;0;0;0;ttg;CAA
CAC;gtg;0;0;0;0;0;0;0;;gtg;0;0;0;0;0;0;0;;gtg;0;0;0;gtg;CAC
CAG;ctg;0;0;0;0;0;0;0;;ctg;0;0;0;0;0;0;0;;ctg;0;0;0;ctg;CAG
CAT;atg;0;0;0;0;0;0;0;;atg;1;1;1;1;1;0;1;6;atg;1;2;3;atg;CAT
CCA;tgg;1;1;1;1;1;1;1;7;tgg;1;1;1;1;1;1;1;7;tgg;1;1;1;tgg;CCA
CCC;ggg;0;0;0;0;0;0;0;;ggg;1;1;0;0;0;0;0;2;ggg;0;0;0;ggg;CCC
CCG;cgg;0;0;0;0;0;0;0;;cgg;0;0;0;0;0;1;0;1;cgg;0;1;1;cgg;CCG
CCT;agg;0;0;0;0;0;0;0;;agg;0;0;0;0;0;1;0;1;agg;0;0;0;agg;CCT
CGA;tcg;0;0;0;1;0;0;0;1;tcg;0;0;0;0;0;1;0;1;tcg;0;0;0;tcg;CGA
CGC;gcg;0;0;0;0;0;0;0;;gcg;0;0;0;0;0;0;0;;gcg;0;0;0;gcg;CGC
CGG;ccg;0;0;0;0;0;0;0;;ccg;0;0;0;0;0;0;0;;ccg;0;1;1;ccg;CGG
CGT;acg;0;0;0;0;0;0;0;;acg;0;0;0;0;0;0;0;;acg;0;1;1;acg;CGT
CTA;tag;0;0;0;0;0;0;0;;tag;0;0;0;0;0;0;0;;tag;0;0;0;tag;CTA
CTC;gag;0;0;0;0;0;0;0;;gag;0;0;0;0;0;0;0;;gag;0;0;0;gag;CTC
CTG;cag;0;0;0;0;0;0;0;;cag;0;0;0;0;0;0;0;;cag;0;1;0;cag;CTG
CTT;aag;0;0;0;0;0;0;0;;aag;0;0;0;0;0;0;0;;aag;0;0;0;aag;CTT
GAA;ttc;0;0;0;0;0;0;0;;ttc;0;0;0;0;0;0;0;;ttc;1;0;0;ttc;GAA
GAC;gtc;0;0;0;0;0;0;0;;gtc;0;0;0;0;0;0;0;;gtc;0;0;0;gtc;GAC
GAG;ctc;0;0;0;0;0;0;0;;ctc;0;0;0;0;0;0;0;;ctc;0;0;0;ctc;GAG
GAT;atc;0;0;0;0;1;0;0;1;atc;0;0;0;0;0;0;0;;atc;0;1;1;atc;GAT
GCA;tgc;0;0;0;0;0;0;0;;tgc;0;0;0;0;0;1;0;1;tgc;1;0;0;tgc;GCA
GCC;ggc;0;0;0;0;0;0;0;;ggc;0;0;0;0;0;0;0;;ggc;0;0;0;ggc;GCC
GCG;cgc;0;0;0;0;0;0;0;;cgc;0;0;0;0;0;0;0;;cgc;0;1;1;cgc;GCG
GCT;agc;0;0;0;1;0;0;0;1;agc;0;0;0;0;0;0;0;;agc;0;0;0;agc;GCT
GGA;tcc;0;0;0;0;0;0;0;;tcc;0;0;0;0;0;0;0;;tcc;0;0;0;tcc;GGA
GGC;gcc;0;0;0;0;0;0;0;;gcc;0;0;0;0;0;0;0;;gcc;0;0;0;gcc;GGC
GGG;ccc;0;0;0;1;0;0;0;1;ccc;0;0;0;0;0;0;0;;ccc;1;0;0;ccc;GGG
GGT;acc;0;0;0;0;0;0;0;;acc;0;0;0;0;0;0;0;;acc;0;0;0;acc;GGT
GTA;tac;1;1;1;1;1;1;1;7;tac;1;1;1;1;1;1;1;7;tac;0;1;1;tac;GTA
GTC;gac;1;1;0;0;1;0;0;3;gac;0;0;0;0;0;0;0;;gac;0;1;1;gac;GTC
GTG;cac;0;0;0;0;0;0;0;;cac;0;0;0;0;0;0;0;;cac;0;1;0;cac;GTG
GTT;aac;0;0;0;0;0;0;0;;aac;0;0;0;0;0;1;0;1;aac;1;0;1;aac;GTT
TAA;tta;0;0;0;0;1;0;0;1;tta;0;0;0;0;0;0;1;1;tta;0;0;0;tta;TAA
TAC;gta;0;0;0;0;0;0;0;;gta;0;0;0;0;0;0;0;;gta;0;0;0;gta;TAC
TAG;cta;0;0;0;0;0;0;0;;cta;0;0;0;0;0;0;0;;cta;0;0;0;cta;TAG
TAT;ata;0;0;0;0;0;0;0;;ata;0;0;0;0;0;0;0;;ata;0;0;0;ata;TAT
TCA;tga;0;0;0;0;0;0;0;;tga;0;0;0;0;0;0;0;;tga;0;0;0;tga;TCA
TCC;gga;0;0;0;0;0;0;0;;gga;0;0;0;0;0;0;0;;gga;0;0;0;gga;TCC
TCG;cga;0;0;0;0;0;0;0;;cga;0;0;0;0;0;0;0;;cga;0;0;0;cga;TCG
TCT;aga;0;0;0;0;0;0;0;;aga;0;0;0;0;0;0;0;;aga;0;0;0;aga;TCT
TGA;tca;0;0;0;0;0;0;0;;tca;0;0;0;0;0;0;0;;tca;0;0;0;tca;TGA
TGC;gca;0;0;0;0;0;0;0;;gca;0;0;0;0;0;0;0;;gca;0;0;0;gca;TGC
TGG;cca;0;0;0;0;0;0;0;;cca;0;0;0;0;0;0;0;;cca;0;1;1;cca;TGG
TGT;aca;0;0;0;0;0;0;0;;aca;0;0;0;0;0;0;0;;aca;0;0;1;aca;TGT
TTA;taa;0;0;0;0;0;0;0;;taa;0;0;0;0;0;0;0;;taa;0;0;0;taa;TTA
TTC;gaa;1;1;0;0;0;0;0;2;gaa;0;0;0;0;0;0;0;;gaa;2;1;1;gaa;TTC
TTG;caa;0;0;0;0;0;0;0;;caa;0;0;0;0;0;0;0;;caa;0;1;1;caa;TTG
TTT;aaa;0;0;0;0;0;0;0;;aaa;0;0;0;0;0;0;0;;aaa;0;0;0;aaa;TTT
;;;;;;;;;moyenne;;;;;;;;;moyenne;;;;;;
tRNA;;46;46;47;51;46;49;48;47,6;;46;46;47;46;46;45;46;46,0;;35;46;46;;tRNA
total;;5;5;2;6;5;2;2;3,9;;4;4;3;3;3;7;4;4,0;;8;15;16;;total
archée;;afg;afu;apo;ast;ave;fpl;gac;;;tac;tvo;pto;fac;tar;mer;mear;;;mka;abi;acf;;archée

Nano Thaum Kor archaeota[modifier | modifier le wikicode]

;;Nanoarcheota Thaumarchaeota Korarchaeota;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;CAA;CAC;CAG;CAT;CCA;CCC;CCG;CCT;CGA;CGC;CGG;CGT;CTA;CTC;CTG;CTT;GAA;GAC;GAG;GAT;GCA;GCC;GCG;GCT;GGA;GGC;GGG;GGT;GTA;GTC;GTG;GTT;TAA;TAC;TAG;TAT;TCA;TCC;TCG;TCT;TGA;TGC;TGG;TGT;TTA;TTC;TTG;TTT;;;
abrégé;archée;ttg;gtg;ctg;atg;tgg;ggg;cgg;agg;tcg;gcg;ccg;acg;tag;gag;cag;aag;ttc;gtc;ctc;atc;tgc;ggc;cgc;agc;tcc;gcc;ccc;acc;tac;gac;cac;aac;tta;gta;cta;ata;tga;gga;cga;aga;tca;gca;cca;aca;taa;gaa;caa;aaa;tRNA;total;archée
nano;neq;0;0;0;?1;?1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;?1;0;0;0;0;0;0;*1;0;0;0;0;0;0;0;0;0;0;0;0;44;4;neq
thaum;nmr;?1;?1;0;?1;$1;0;0;?1;0;0;0;0;0;0;?1;0;0;0;0;0;0;0;0;0;?1;0;0;0;?1;0;0;0;$1;0;0;0;0;0;0;0;0;0;0;0;0;?1;0;0;44;10;nmr
kor;kcr;0;0;0;?1;$1;0;0;0;?1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;?1;0;0;0;0;0;0;*1;0;0;0;0;0;0;0;0;0;0;0;0;46;5;kcr

Les totaux des crenarchaeota et des euryarchaeota[modifier | modifier le wikicode]

  • Lien aux tableaux:Les totaux des crenarchaeota et des euryarchaeota.
  • Voir les détails dans les listes ci-dessus.
  • Légende: rouge (nmr,tgg) est un gène avec 3 introns, cyan, (nmr,tgg) est un gène avec 2 introns, jaune (neq,tgg) est un gène avec 1 intron.
décompte par génome des crenarchaeota;;;;;;38;;;décompte par génome des euryarchaeota;;;;;;142;;
codon;gene;introns;zéros;génomes;I3;I2;I1;I3+I2;codon;gene;introns;zéros;génomes;I3;I2;I1;I3+I2
CAA;ttg;21;17;21;0;0;21;0;CAA;ttg;3;139;3;0;0;3;0
CAC;gtg;7;31;7;0;2;5;2;CAC;gtg;1;141;1;0;0;1;0
CAG;ctg;9;29;9;0;1;8;1;CAG;ctg;0;142;0;0;0;0;0
CAT;atg;77;1;37;0;11;66;11;CAT;atg;148;9;133;0;0;148;0
CCA;tgg;29;9;29;0;9;20;9;CCA;tgg;142;0;142;0;0;142;0
CCC;ggg;9;29;9;0;0;9;0;CCC;ggg;2;140;2;0;0;2;0
CCG;cgg;7;31;7;0;0;7;0;CCG;cgg;4;138;4;0;0;4;0
CCT;agg;27;11;27;1;2;24;3;CCT;agg;1;141;1;0;0;1;0
CGA;tcg;34;4;34;0;2;32;2;CGA;tcg;2;140;2;0;0;2;0
CGC;gcg;8;30;8;0;2;6;2;CGC;gcg;0;142;0;0;0;0;0
CGG;ccg;19;19;19;1;6;12;7;CGG;ccg;10;132;10;0;0;10;0
CGT;acg;37;1;37;0;5;32;5;CGT;acg;5;137;5;0;0;5;0
CTA;tag;0;38;0;0;0;0;0;CTA;tag;0;142;0;0;0;0;0
CTC;gag;30;8;30;4;6;20;10;CTC;gag;0;142;0;0;0;0;0
CTG;cag;12;26;12;1;3;8;4;CTG;cag;1;141;1;0;0;1;0
CTT;aag;28;11;27;0;3;25;3;CTT;aag;0;142;0;0;0;0;0
GAA;ttc;10;28;10;0;0;10;0;GAA;ttc;2;140;2;0;0;2;0
GAC;gtc;13;25;13;0;2;11;2;GAC;gtc;0;142;0;0;0;0;0
GAG;ctc;3;35;3;0;0;3;0;GAG;ctc;0;142;0;0;0;0;0
GAT;atc;25;13;25;0;5;20;5;GAT;atc;3;139;3;0;0;3;0
GCA;tgc;36;2;36;1;17;18;18;GCA;tgc;5;138;4;0;0;5;0
GCC;ggc;12;26;12;0;1;11;1;GCC;ggc;3;139;3;0;0;3;0
GCG;cgc;12;26;12;0;1;11;1;GCG;cgc;5;137;5;0;0;5;0
GCT;agc;3;35;3;0;0;3;0;GCT;agc;1;141;1;0;0;1;0
GGA;tcc;11;27;11;0;0;11;0;GGA;tcc;5;137;5;0;0;5;0
GGC;gcc;3;35;3;0;1;2;1;GGC;gcc;2;140;2;0;0;2;0
GGG;ccc;38;0;38;1;6;31;7;GGG;ccc;5;137;5;0;1;4;1
GGT;acc;15;23;15;0;1;14;1;GGT;acc;0;142;0;0;0;0;0
GTA;tac;39;0;38;0;7;32;7;GTA;tac;64;78;64;0;0;64;0
GTC;gac;11;28;10;1;8;2;9;GTC;gac;5;137;5;0;0;5;0
GTG;cac;11;27;11;0;1;10;1;GTG;cac;1;141;1;0;0;1;0
GTT;aac;26;12;26;0;7;19;7;GTT;aac;13;131;11;0;0;13;0
TAA;tta;19;19;19;0;0;19;0;TAA;tta;2;141;2;0;0;2;0
TAC;gta;17;21;17;0;6;11;6;TAC;gta;1;141;1;0;0;1;0
TAG;cta;3;35;3;0;0;3;0;TAG;cta;0;142;0;0;0;0;0
TAT;ata;0;38;0;0;0;0;0;TAT;ata;0;142;0;0;0;0;0
TCA;tga;1;37;1;0;0;1;0;TCA;tga;0;142;0;0;0;0;0
TCC;gga;13;25;13;0;3;10;3;TCC;gga;4;138;4;0;0;4;0
TCG;cga;6;32;6;0;0;6;0;TCG;cga;36;106;36;0;0;36;0
TCT;aga;23;15;23;0;0;23;0;TCT;aga;11;131;11;0;0;11;0
TGA;tca;13;25;13;0;1;12;1;TGA;tca;3;139;3;0;0;3;0
TGC;gca;16;22;16;0;3;13;3;TGC;gca;0;142;0;0;0;0;0
TGG;cca;15;23;15;3;2;10;5;TGG;cca;2;140;2;0;0;2;0
TGT;aca;36;2;36;2;6;28;8;TGT;aca;4;138;4;0;0;4;0
TTA;taa;0;38;0;0;0;0;0;TTA;taa;0;142;0;0;0;0;0
TTC;gaa;25;13;25;4;5;16;9;TTC;gaa;7;136;6;0;2;5;2
TTG;caa;14;24;14;1;3;10;4;TTG;caa;17;125;17;0;0;17;0
TTT;aaa;22;16;22;0;2;20;2;TTT;aaa;3;139;3;0;0;3;0
AAA;ttt;0;38;0;0;0;0;0;AAA;ttt;0;142;0;0;0;0;0
AAC;gtt;0;38;0;0;0;0;0;AAC;gtt;1;141;1;0;0;1;0
AAG;ctt;0;38;0;0;0;0;0;AAG;ctt;0;142;0;0;0;0;0
AAT;att;0;38;0;0;0;0;0;AAT;att;0;142;0;0;0;0;0
ACA;tgt;0;38;0;0;0;0;0;ACA;tgt;0;142;0;0;0;0;0
ACC;ggt;0;38;0;0;0;0;0;ACC;ggt;1;141;1;0;0;1;0
ACG;cgt;0;38;0;0;0;0;0;ACG;cgt;1;141;1;0;0;1;0
ACT;agt;0;38;0;0;0;0;0;ACT;agt;0;142;0;0;0;0;0
AGA;tct;0;38;0;0;0;0;0;AGA;tct;0;142;0;0;0;0;0
AGC;gct;0;38;0;0;0;0;0;AGC;gct;0;142;0;0;0;0;0
AGG;cct;0;38;0;0;0;0;0;AGG;cct;0;142;0;0;0;0;0
AGT;act;0;38;0;0;0;0;0;AGT;act;0;142;0;0;0;0;0
ATA;tat;0;38;0;0;0;0;0;ATA;tat;0;142;0;0;0;0;0
ATC;gat;0;38;0;0;0;0;0;ATC;gat;0;142;0;0;0;0;0
ATG;cat;0;38;0;0;0;0;0;ATG;cat;0;142;0;0;0;0;0
ATT;aat;0;38;0;0;0;0;0;ATT;aat;0;142;0;0;0;0;0

Comparaison entre archées[modifier | modifier le wikicode]

Total introns[modifier | modifier le wikicode]

Archées;;183;introns;total;;;;;Crena;38;introns;total;;;;
ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0
ctt;0;cct;0;cat;0;cgt;1;;ctt;0;cct;0;cat;0;cgt;0
att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0
gtt;1;gct;0;gat;0;ggt;1;;gtt;0;gct;0;gat;0;ggt;0
ttc;12;tcc;17;tac;106;tgc;41;;ttc;10;tcc;11;tac;39;tgc;36
ctc;3;ccc;43;cac;12;cgc;17;;ctc;3;ccc;38;cac;11;cgc;12
atc;28;acc;15;aac;39;agc;4;;atc;25;acc;15;aac;26;agc;3
gtc;13;gcc;5;gac;16;ggc;15;;gtc;13;gcc;3;gac;11;ggc;12
tta;22;tca;16;taa;0;tga;1;;tta;19;tca;13;taa;0;tga;1
cta;3;cca;17;caa;31;cga;42;;cta;3;cca;15;caa;14;cga;6
ata;2;aca;40;aaa;25;aga;34;;ata;0;aca;36;aaa;22;aga;23
gta;18;gca;16;gaa;33;gga;17;;gta;17;gca;16;gaa;25;gga;13
ttg;25;tcg;37;tag;0;tgg;174;;ttg;21;tcg;34;tag;0;tgg;29
ctg;9;ccg;29;cag;14;cgg;11;;ctg;9;ccg;19;cag;12;cgg;7
atg;228;acg;42;aag;28;agg;29;;atg;77;acg;37;aag;28;agg;27
gtg;9;gcg;8;gag;30;ggg;11;;gtg;7;gcg;8;gag;30;ggg;9
;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;
Crena;introns;3+2;;total;;;;;EuryA;142;introns;total;;;;
ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0
ctt;0;cct;0;cat;0;cgt;0;;ctt;0;cct;0;cat;0;cgt;1
att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0
gtt;0;gct;0;gat;0;ggt;0;;gtt;1;gct;0;gat;0;ggt;1
ttc;0;tcc;0;tac;7;tgc;18;;ttc;2;tcc;5;tac;64;tgc;5
ctc;0;ccc;7;cac;1;cgc;1;;ctc;0;ccc;5;cac;1;cgc;5
atc;5;acc;1;aac;7;agc;0;;atc;3;acc;0;aac;13;agc;1
gtc;2;gcc;1;gac;9;ggc;1;;gtc;0;gcc;2;gac;5;ggc;3
tta;0;tca;1;taa;0;tga;0;;tta;2;tca;3;taa;0;tga;0
cta;0;cca;5;caa;4;cga;0;;cta;0;cca;2;caa;17;cga;36
ata;0;aca;8;aaa;2;aga;0;;ata;0;aca;4;aaa;3;aga;11
gta;6;gca;3;gaa;9;gga;3;;gta;1;gca;0;gaa;7;gga;4
ttg;0;tcg;2;tag;0;tgg;9;;ttg;3;tcg;2;tag;0;tgg;142
ctg;1;ccg;7;cag;4;cgg;0;;ctg;0;ccg;10;cag;1;cgg;4
atg;10;acg;5;aag;3;agg;3;;atg;148;acg;5;aag;0;agg;1
gtg;2;gcg;2;gag;10;ggg;0;;gtg;1;gcg;0;gag;0;ggg;2

Introns pour 100 génomes[modifier | modifier le wikicode]

Archées;;183;introns;%;;;;;Crena;38;introns;;;%;;;;EuryA;142;introns;;%;;;
ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0
ctt;0;cct;0;cat;0;cgt;1;;ctt;0;cct;0;cat;0;cgt;0;;ctt;0;cct;0;cat;0;cgt;1
att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0
gtt;1;gct;0;gat;0;ggt;1;;gtt;0;gct;0;gat;0;ggt;0;;gtt;1;gct;0;gat;0;ggt;1
ttc;7;tcc;9;tac;58;tgc;22;;ttc;26;tcc;29;tac;103;tgc;95;;ttc;1;tcc;4;tac;45;tgc;4
ctc;2;ccc;23;cac;7;cgc;9;;ctc;8;ccc;100;cac;29;cgc;32;;ctc;0;ccc;4;cac;1;cgc;4
atc;15;acc;8;aac;21;agc;2;;atc;66;acc;39;aac;68;agc;8;;atc;2;acc;0;aac;9;agc;1
gtc;7;gcc;3;gac;9;ggc;8;;gtc;34;gcc;8;gac;29;ggc;32;;gtc;0;gcc;1;gac;4;ggc;2
tta;12;tca;9;taa;0;tga;1;;tta;50;tca;34;taa;0;tga;3;;tta;1;tca;2;taa;0;tga;0
cta;2;cca;9;caa;17;cga;23;;cta;8;cca;39;caa;37;cga;16;;cta;0;cca;1;caa;12;cga;25
ata;1;aca;22;aaa;14;aga;19;;ata;0;aca;95;aaa;58;aga;61;;ata;0;aca;3;aaa;2;aga;8
gta;10;gca;9;gaa;18;gga;9;;gta;45;gca;42;gaa;66;gga;34;;gta;1;gca;0;gaa;5;gga;3
ttg;14;tcg;20;tag;0;tgg;95;;ttg;55;tcg;89;tag;0;tgg;76;;ttg;2;tcg;1;tag;0;tgg;100
ctg;5;ccg;16;cag;8;cgg;6;;ctg;24;ccg;50;cag;32;cgg;18;;ctg;0;ccg;7;cag;1;cgg;3
atg;125;acg;23;aag;15;agg;16;;atg;205;acg;97;aag;74;agg;71;;atg;104;acg;4;aag;0;agg;1
gtg;5;gcg;4;gag;16;ggg;6;;gtg;18;gcg;21;gag;79;ggg;24;;gtg;1;gcg;0;gag;0;ggg;1
;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;
Archées;;183;tRNAs;;;;;;Crena;38;tRNAs;;;;;;;Eury;142;tRNAs;;;;;
ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0
ctt;1;cct;0;cat;0;cgt;2;;ctt;0;cct;0;cat;0;cgt;0;;ctt;1;cct;0;cat;0;cgt;2
att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0
gtt;1;gct;0;gat;0;ggt;1;;gtt;0;gct;0;gat;0;ggt;0;;gtt;1;gct;0;gat;0;ggt;1
ttc;215;tcc;190;tac;190;tgc;299;;ttc;38;tcc;38;tac;39;tgc;38;;ttc;174;tcc;149;tac;148;tgc;258
ctc;214;ccc;171;cac;185;cgc;187;;ctc;38;ccc;38;cac;38;cgc;40;;ctc;173;ccc;130;cac;143;cgc;144
atc;212;acc;189;aac;214;agc;187;;atc;38;acc;39;aac;39;agc;38;;atc;171;acc;147;aac;172;agc;146
gtc;212;gcc;184;gac;218;ggc;243;;gtc;38;gcc;38;gac;40;ggc;40;;gtc;171;gcc;143;gac;175;ggc;200
tta;191;tca;184;taa;0;tga;18;;tta;38;tca;38;taa;0;tga;1;;tta;150;tca;143;taa;0;tga;17
cta;185;cca;184;caa;196;cga;185;;cta;38;cca;38;caa;38;cga;38;;cta;144;cca;143;caa;154;cga;144
ata;2;aca;198;aaa;197;aga;186;;ata;0;aca;38;aaa;39;aga;39;;ata;0;aca;157;aaa;155;aga;144
gta;186;gca;256;gaa;230;gga;189;;gta;38;gca;39;gaa;40;gga;40;;gta;145;gca;214;gaa;186;gga;146
ttg;163;tcg;152;tag;1;tgg;184;;ttg;38;tcg;38;tag;0;tgg;38;;ttg;122;tcg;111;tag;1;tgg;143
ctg;160;ccg;151;cag;165;cgg;139;;ctg;39;ccg;37;cag;38;cgg;38;;ctg;119;ccg;112;cag;124;cgg;100
atg;589;acg;169;aag;166;agg;165;;atg;115;acg;38;aag;40;agg;38;;atg;466;acg;128;aag;122;agg;124
gtg;170;gcg;159;gag;160;ggg;155;;gtg;38;gcg;39;gag;38;ggg;40;;gtg;129;gcg;117;gag;118;ggg;112

Génomes par codon[modifier | modifier le wikicode]

Archées;;183;introns;génomes;;;;;Crena;38;introns;génomes;;;;;;EuryA;142;introns;génomes;;;;
ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0
ctt;0;cct;0;cat;0;cgt;1;;ctt;0;cct;0;cat;0;cgt;0;;ctt;0;cct;0;cat;0;cgt;1
att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0
gtt;1;gct;0;gat;0;ggt;1;;gtt;0;gct;0;gat;0;ggt;0;;gtt;1;gct;0;gat;0;ggt;1
ttc;12;tcc;17;tac;105;tgc;40;;ttc;10;tcc;11;tac;38;tgc;36;;ttc;2;tcc;5;tac;64;tgc;4
ctc;3;ccc;43;cac;12;cgc;17;;ctc;3;ccc;38;cac;11;cgc;12;;ctc;0;ccc;5;cac;1;cgc;5
atc;28;acc;15;aac;37;agc;4;;atc;25;acc;15;aac;26;agc;3;;atc;3;acc;0;aac;11;agc;1
gtc;13;gcc;5;gac;15;ggc;15;;gtc;13;gcc;3;gac;10;ggc;12;;gtc;0;gcc;2;gac;5;ggc;3
tta;22;tca;16;taa;0;tga;1;;tta;19;tca;13;taa;0;tga;1;;tta;2;tca;3;taa;0;tga;0
cta;3;cca;17;caa;31;cga;42;;cta;3;cca;15;caa;14;cga;6;;cta;0;cca;2;caa;17;cga;36
ata;2;aca;40;aaa;25;aga;34;;ata;0;aca;36;aaa;22;aga;23;;ata;0;aca;4;aaa;3;aga;11
gta;18;gca;16;gaa;32;gga;17;;gta;17;gca;16;gaa;25;gga;13;;gta;1;gca;0;gaa;6;gga;4
ttg;25;tcg;37;tag;0;tgg;174;;ttg;21;tcg;34;tag;0;tgg;29;;ttg;3;tcg;2;tag;0;tgg;142
ctg;9;ccg;29;cag;14;cgg;11;;ctg;9;ccg;19;cag;12;cgg;7;;ctg;0;ccg;10;cag;1;cgg;4
atg;173;acg;42;aag;27;agg;29;;atg;37;acg;37;aag;27;agg;27;;atg;133;acg;5;aag;0;agg;1
gtg;9;gcg;8;gag;30;ggg;11;;gtg;7;gcg;8;gag;30;ggg;9;;gtg;1;gcg;0;gag;0;ggg;2

Taux des génomes à introns[modifier | modifier le wikicode]

Archées;;183;introns;génomes;;;;;Crena;38;introns;génomes;;;;;;EuryA;142;introns;génomes;;;;
ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0
ctt;0;cct;0;cat;0;cgt;1;;ctt;0;cct;0;cat;0;cgt;0;;ctt;0;cct;0;cat;0;cgt;1
att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0
gtt;1;gct;0;gat;0;ggt;1;;gtt;0;gct;0;gat;0;ggt;0;;gtt;1;gct;0;gat;0;ggt;1
ttc;12;tcc;17;tac;105;tgc;40;;ttc;10;tcc;11;tac;38;tgc;36;;ttc;2;tcc;5;tac;64;tgc;4
ctc;3;ccc;43;cac;12;cgc;17;;ctc;3;ccc;38;cac;11;cgc;12;;ctc;0;ccc;5;cac;1;cgc;5
atc;28;acc;15;aac;37;agc;4;;atc;25;acc;15;aac;26;agc;3;;atc;3;acc;0;aac;11;agc;1
gtc;13;gcc;5;gac;15;ggc;15;;gtc;13;gcc;3;gac;10;ggc;12;;gtc;0;gcc;2;gac;5;ggc;3
tta;22;tca;16;taa;0;tga;1;;tta;19;tca;13;taa;0;tga;1;;tta;2;tca;3;taa;0;tga;0
cta;3;cca;17;caa;31;cga;42;;cta;3;cca;15;caa;14;cga;6;;cta;0;cca;2;caa;17;cga;36
ata;2;aca;40;aaa;25;aga;34;;ata;0;aca;36;aaa;22;aga;23;;ata;0;aca;4;aaa;3;aga;11
gta;18;gca;16;gaa;32;gga;17;;gta;17;gca;16;gaa;25;gga;13;;gta;1;gca;0;gaa;6;gga;4
ttg;25;tcg;37;tag;0;tgg;174;;ttg;21;tcg;34;tag;0;tgg;29;;ttg;3;tcg;2;tag;0;tgg;142
ctg;9;ccg;29;cag;14;cgg;11;;ctg;9;ccg;19;cag;12;cgg;7;;ctg;0;ccg;10;cag;1;cgg;4
atg;173;acg;42;aag;27;agg;29;;atg;37;acg;37;aag;27;agg;27;;atg;133;acg;5;aag;0;agg;1
gtg;9;gcg;8;gag;30;ggg;11;;gtg;7;gcg;8;gag;30;ggg;9;;gtg;1;gcg;0;gag;0;ggg;2

Taux des tRNAs avec introns[modifier | modifier le wikicode]

Archées;;183;Taux introns/tRNAs;;;;;;Crena;38;Taux introns/tRNAs;;;;;;;Eury;142;Taux introns/tRNAs;;;;;
ttt;−;tct;−;tat;−;tgt;−;;ttt;−;tct;−;tat;−;tgt;−;;ttt;−;tct;−;tat;−;tgt;−
ctt;0;cct;−;cat;−;cgt;50;;ctt;−;cct;−;cat;−;cgt;−;;ctt;0;cct;−;cat;−;cgt;50
att;−;act;−;aat;−;agt;−;;att;−;act;−;aat;−;agt;−;;att;−;act;−;aat;−;agt;−
gtt;100;gct;−;gat;−;ggt;100;;gtt;−;gct;−;gat;−;ggt;−;;gtt;100;gct;−;gat;−;ggt;100
ttc;6;tcc;9;tac;56;tgc;14;;ttc;26;tcc;29;tac;100;tgc;95;;ttc;1;tcc;3;tac;43;tgc;2
ctc;1;ccc;25;cac;6;cgc;9;;ctc;8;ccc;100;cac;29;cgc;30;;ctc;0;ccc;4;cac;1;cgc;3
atc;13;acc;8;aac;18;agc;2;;atc;66;acc;38;aac;67;agc;8;;atc;2;acc;0;aac;8;agc;1
gtc;6;gcc;3;gac;7;ggc;6;;gtc;34;gcc;8;gac;28;ggc;30;;gtc;0;gcc;1;gac;3;ggc;2
tta;12;tca;9;taa;−;tga;6;;tta;50;tca;34;taa;−;tga;100;;tta;1;tca;2;taa;−;tga;0
cta;2;cca;9;caa;16;cga;23;;cta;8;cca;39;caa;37;cga;16;;cta;0;cca;1;caa;11;cga;25
ata;100;aca;20;aaa;13;aga;18;;ata;−;aca;95;aaa;56;aga;59;;ata;−;aca;3;aaa;2;aga;8
gta;10;gca;6;gaa;14;gga;9;;gta;45;gca;41;gaa;63;gga;33;;gta;1;gca;0;gaa;4;gga;3
ttg;15;tcg;24;tag;0;tgg;95;;ttg;55;tcg;89;tag;−;tgg;76;;ttg;2;tcg;2;tag;0;tgg;99
ctg;6;ccg;19;cag;8;cgg;8;;ctg;23;ccg;51;cag;32;cgg;18;;ctg;0;ccg;9;cag;1;cgg;4
atg;39;acg;25;aag;17;agg;18;;atg;67;acg;97;aag;70;agg;71;;atg;32;acg;4;aag;0;agg;1
gtg;5;gcg;5;gag;19;ggg;7;;gtg;18;gcg;21;gag;79;ggg;23;;gtg;1;gcg;0;gag;0;ggg;2

Les tRNAs des euryarchaeota[modifier | modifier le wikicode]

Methanomicrobia;;;tRNAs;47;;;;;Halobacteria;;;tRNAs;30;;;;;Thermococci;;;tRNAs;19;;;
ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0
ctt;0;cct;0;cat;0;cgt;0;;ctt;0;cct;0;cat;0;cgt;0;;ctt;0;cct;0;cat;0;cgt;0
att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0
gtt;1;gct;0;gat;0;ggt;0;;gtt;0;gct;0;gat;0;ggt;0;;gtt;0;gct;0;gat;0;ggt;0
ttc;72;tcc;47;tac;47;tgc;158;;ttc;34;tcc;32;tac;34;tgc;30;;ttc;19;tcc;19;tac;19;tgc;19
ctc;78;ccc;47;cac;47;cgc;47;;ctc;30;ccc;31;cac;31;cgc;31;;ctc;19;ccc;18;cac;19;cgc;19
atc;73;acc;47;aac;71;agc;47;;atc;30;acc;35;aac;32;agc;31;;atc;19;acc;19;aac;19;agc;19
gtc;72;gcc;47;gac;51;ggc;94;;gtc;33;gcc;32;gac;49;ggc;41;;gtc;19;gcc;19;gac;19;ggc;19
tta;53;tca;46;taa;0;tga;0;;tta;30;tca;30;taa;0;tga;0;;tta;19;tca;19;taa;0;tga;0
cta;48;cca;47;caa;48;cga;47;;cta;30;cca;30;caa;31;cga;30;;cta;19;cca;19;caa;19;cga;19
ata;0;aca;60;aaa;48;aga;47;;ata;0;aca;31;aaa;31;aga;31;;ata;0;aca;19;aaa;19;aga;19
gta;48;gca;73;gaa;71;gga;47;;gta;30;gca;54;gaa;31;gga;31;;gta;19;gca;20;gaa;19;gga;19
ttg;48;tcg;40;tag;1;tgg;47;;ttg;33;tcg;30;tag;0;tgg;30;;ttg;19;tcg;19;tag;0;tgg;19
ctg;51;ccg;47;cag;47;cgg;47;;ctg;30;ccg;30;cag;30;cgg;18;;ctg;18;ccg;19;cag;18;cgg;19
atg;167;acg;49;aag;48;agg;46;;atg;96;acg;30;aag;30;agg;29;;atg;57;acg;19;aag;19;agg;19
gtg;47;gcg;47;gag;47;ggg;46;;gtg;30;gcg;33;gag;32;ggg;28;;gtg;20;gcg;19;gag;19;ggg;19
;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;
Methanococci;;tRNAs;;16;;;;;Methanobacteria;;;tRNAs;13;;;;;Archaeoglobi;;;tRNAs;7;;;
ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0
ctt;0;cct;0;cat;0;cgt;0;;ctt;0;cct;0;cat;0;cgt;1;;ctt;0;cct;0;cat;0;cgt;0
att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0
gtt;0;gct;0;gat;0;ggt;0;;gtt;0;gct;0;gat;0;ggt;0;;gtt;0;gct;0;gat;0;ggt;0
ttc;16;tcc;16;tac;16;tgc;16;;ttc;15;tcc;18;tac;15;tgc;18;;ttc;8;tcc;7;tac;7;tgc;7
ctc;16;ccc;15;cac;16;cgc;16;;ctc;13;ccc;2;cac;13;cgc;13;;ctc;8;ccc;7;cac;7;cgc;8
atc;16;acc;16;aac;16;agc;16;;atc;15;acc;13;aac;16;agc;16;;atc;8;acc;7;aac;7;agc;7
gtc;16;gcc;16;gac;25;ggc;16;;gtc;14;gcc;12;gac;14;ggc;13;;gtc;7;gcc;7;gac;7;ggc;7
tta;16;tca;16;taa;0;tga;16;;tta;15;tca;15;taa;0;tga;0;;tta;7;tca;7;taa;;tga;
cta;16;cca;16;caa;16;cga;17;;cta;14;cca;14;caa;21;cga;13;;cta;7;cca;7;caa;9;cga;8
ata;0;aca;16;aaa;25;aga;16;;ata;0;aca;13;aaa;16;aga;14;;ata;;aca;8;aaa;7;aga;7
gta;17;gca;22;gaa;32;gga;17;;gta;14;gca;28;gaa;15;gga;15;;gta;7;gca;7;gaa;7;gga;7
ttg;0;tcg;0;tag;0;tgg;16;;ttg;7;tcg;6;tag;0;tgg;14;;ttg;7;tcg;7;tag;;tgg;7
ctg;0;ccg;0;cag;0;cgg;0;;ctg;4;ccg;0;cag;12;cgg;0;;ctg;7;ccg;7;cag;8;cgg;7
atg;56;acg;1;aag;0;agg;0;;atg;39;acg;12;aag;9;agg;13;;atg;21;acg;8;aag;7;agg;7
gtg;7;gcg;0;gag;0;ggg;0;;gtg;9;gcg;2;gag;4;ggg;3;;gtg;7;gcg;7;gag;7;ggg;7
;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;
Thermoplasmata;;;tRNAs;7;;;;;Aciduliprofundum;;;tRNAs;2;;;;;Methanopyri;;;tRNAs;1;;;
ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0;;ttt;0;tct;0;tat;0;tgt;0
ctt;1;cct;0;cat;0;cgt;0;;ctt;0;cct;0;cat;0;cgt;0;;ctt;0;cct;0;cat;0;cgt;0
att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0;;att;0;act;0;aat;0;agt;0
gtt;0;gct;0;gat;0;ggt;0;;gtt;0;gct;0;gat;0;ggt;0;;gtt;0;gct;0;gat;0;ggt;0
ttc;7;tcc;7;tac;7;tgc;7;;ttc;2;tcc;2;tac;2;tgc;2;;ttc;1;tcc;1;tac;1;tgc;1
ctc;6;ccc;7;cac;7;cgc;7;;ctc;2;ccc;2;cac;2;cgc;2;;ctc;1;ccc;1;cac;1;cgc;1
atc;7;acc;7;aac;8;agc;7;;atc;2;acc;2;aac;2;agc;2;;atc;1;acc;1;aac;1;agc;1
gtc;7;gcc;7;gac;7;ggc;7;;gtc;2;gcc;2;gac;2;ggc;2;;gtc;1;gcc;1;gac;1;ggc;1
tta;7;tca;7;taa;0;tga;0;;tta;2;tca;2;taa;0;tga;0;;tta;1;tca;1;taa;0;tga;1
cta;7;cca;7;caa;7;cga;7;;cta;2;cca;2;caa;2;cga;2;;cta;1;cca;1;caa;1;cga;1
ata;0;aca;7;aaa;6;aga;7;;ata;0;aca;2;aaa;2;aga;2;;ata;0;aca;1;aaa;1;aga;1
gta;7;gca;7;gaa;7;gga;7;;gta;2;gca;2;gaa;2;gga;2;;gta;1;gca;1;gaa;2;gga;1
ttg;6;tcg;7;tag;0;tgg;7;;ttg;2;tcg;2;tag;0;tgg;2;;ttg;0;tcg;0;tag;0;tgg;1
ctg;7;ccg;7;cag;7;cgg;7;;ctg;2;ccg;2;cag;2;cgg;2;;ctg;0;ccg;0;cag;0;cgg;0
atg;21;acg;7;aag;7;agg;8;;atg;6;acg;2;aag;2;agg;2;;atg;3;acg;0;aag;0;agg;0
gtg;7;gcg;7;gag;7;ggg;7;;gtg;2;gcg;2;gag;2;ggg;2;;gtg;0;gcg;0;gag;0;ggg;0

Les modifications des tRNAs[modifier | modifier le wikicode]

Liste des short name trouvés en colonnes 38 et 41[modifier | modifier le wikicode]

34::::37:
::Eu et pro caryotes:::
N:xU:::H:xA
<:xC:::;:xG
I:inosine:::O:m1I
3:mcm5s2U:::K:m1G
Q:QtRNA:::6:t6A
1:mcm5U:::/:m2A
8:manQtRNA:::+:i6A
J:Um:::E:m6t6A
2:s2U:::[:ms2t6A
#:Gm:::W:o2yW
&:ncm5U:::Y:yW
,:mchm5U:::`:io6A
P:pseudoU:::=:m6A
°:f5Cm:::≠:ms2io6A
B:Cm:::*:ms2i6A
?:m5C::::
∼:ncm5Um::::
):cmnm5Um::::
9:galQtRNA::::
5:mo5U::::
V:cmo5U::::
{:mnm5U::::
⊄:gluQtRNA::::
S:mnm5s2U::::
}:k2C::::
M:ac4C::::
$:cmnm5s2U::::

Liste des tRNAs de la base gtRNAdb[modifier | modifier le wikicode]

µSTXT(N35;41;1)µµµµµµµµµµµ
STXT(N35;38;1)µµµµµµµµµµµµ
38µµ41µµµµgèneµtRNAµaaµcodonµgénomeµmilieuµséquence
IµµOµµµµgctµEucaryµAlaµAGCµSaccharomyces cerevisiaeµcytosolic µ-GGGCGUGUKGCGUAGDC-GGD--AGCGCRCUCCCUUIGCOPGGGAGAG-------------------GDCUCCGGTPCGAUUCCGGACUCGUCCACCA 
IµµOµµµµgctµAµAlaµIGCµBombyx moriµcytosolic µ-GGGGGCGUALCUCAGAD-GGU--AGAGCRCUCGCJUIGCOP#PGAGAG-------------------7UA?CGGGAPCG"UACCCGGCGCCUCCACCA 
IµµOµµµµgctµAµAlaµIGCµBombyx moriµcytosolic µ-GGGGGCGUALCUCAGAD-GGU--AGAGCRCUCGCJUIGCOP#PGAGAG-------------------7UA?CGGGAPCG"UACCCGGCGCCUCCACCA 
IµµOµµµµgctµAµAlaµIGCµHomo sapiensµcytosolic µ-GGGGGAUUALCUCAAAD-GGD--AGAGCRCUCGCJUIGCOP#CGAGAG-------------------7UAGCGGGAPCG"UGCCCGCAUCCUCCACCA 
IµµOµµµµgctµAµAlaµIGCµHomo sapiensµcytosolic µ-GGGGAAUUALCUCAAAD-GGD--AGAGCRCUCGCJUIGCOP#CGAGAG-------------------7UAGCGGGAPCG"UGCCCGCAUUCUCCACCA 
IµµOµµµµgctµAµAlaµIGCµPichia jadiniiµcytosolic µ-GGGCGUGUKGCGUAGDD-GGD--AGCGCRPUCGCUUIGCOPGCGAAAG-------------------GDCUCCGGTPCG"CUCCGGACUCGUCCACCA 
3µµ6µµµµagaµUµArgµ3CPµBos taurusµcytosolic µ-GGCUCCGUKGCGCAAD--GGAD-AGCGCAPPGGA'U3CP6AUPCAAAG-------------------7DU?CGGGTPCG"GUCCCGGCGGAGUCGCCA 
CµµKµµµµcggµCµArgµCCGµBos taurusµcytosolic µ-GACCCAGUKLCCUAAD--#GAD-AAGGCAPCAGCBUCCGKAGCUGGGG-------------------ADUGPGGGTPCG"GUCCCAUCUGGGUCGCCA 
CµµKµµµµcggµCµArgµCCGµTriticum aestivumµcytosolic µ-GACCGCGUKGCCUAAD--GGAX-AAGGCRCUCGCBUCCGKAGCGGGAG-------------------ADU?UGGGTPCG"CUCCCAGCGPGGUCGCCA 
Cµµ6µµµµaggµCµArgµCCUµBos taurusµcytosolic µ-GCCCCAGUKLCCUAAD--GGAD-AAGGCAPUGGC'UCCU6AGCCAGGG-------------------ADUGPGGGTPCG"GUCCCAUCUGGGGPCCCA 
IµµKµµµµcgtµAµArgµICGµMus musculusµcytosolic µ-GGGCCAGUKLCGCAAD--GGAD-AACGCRPCUGABUICGKAPCAGAAG-------------------ADU?PAGGPPCG"CUCCUGGCUGGCUCGCCA 
IµµKµµµµcgtµAµArgµICGµMus musculusµcytosolic µ-GGGCCAGUKLCGCAAD--GGAD-AACGCRPCUGABUICGKAPCAGAAG-------------------ADU?PAGGPPCG"CUCCUGGCUGGCUCGCCA 
IµµAµµµµcgtµAµArgµICGµSaccharomyces cerevisiaeµcytosolic µ-PUCCUCGUKLCCCAAD--GGDC-ACGGCRPCUGGCUICGAACCAGAAG-------------------ADU?CAGGTPCA"GUCCUGGCGGGGAAGCCA 
Iµµ/µµµµcgtµAµArgµICGµTriticum aestivumµcytosolic µ-GACUCCGUKLCCCAAD--#GAX-AAGGCRCUGGUBUICG/AACCAGAG-------------------ADU?UGGGTPCG"UCCCCAGCGGAGUCGCCA 
1µµ6µµµµagaµUµArgµUCUµSaccharomyces cerevisiaeµcytosolic µ-GCUCGCGUKLCGUAAD--GGC--AACGCRPCUGACU1CU6APCAGAAG-------------------ADUAUGGGTPCG"CCCCCAUCGUGAGUGCCA 
Gµµ6µµµµaacµGµAsnµGUUµRattus norvegicusµcytosolic µ-GUCUCUGUKLCGCAADC-GGDX-AGCGCRPPCGGCUGUU6ACCGAAAG-------------------7DUGGUGG.PCG"GCCCACCCAGGGACGCCA 
Gµµ6µµµµaacµGµAsnµGUUµSaccharomyces cerevisiaeµcytosolic µ-GACUCCAUGLCCAAGDD-GGDD-AAGGCRUGCGACUGUU6APCGCAAG-------------------AD?GUGAGTPCA"CCCUCACUGGGGUCGCCA 
Qµµ6µµµµaacµGµAsnµQUUµBos taurusµcytosolic µ-GUCUCUGUKLCGCAADC-GGDX-AGCGCRPPCGGCUQUU6ACCGAAAG-------------------7DUGGUGG@PCG"GCCCACCCAGGGACGCCA 
Qµµ6µµµµaacµGµAsnµQUUµHomo sapiensµcytosolic µ-GUCUCUGUKLCGCAADC-GGDX-AGCGCRPPCGGCUQUU6ACCGAAAG-------------------7DUGGUGG.PCG"GCCCACCCAGGGACGCCA 
Qµµ6µµµµaacµGµAsnµQUUµLupinus luteusµcytosolic µ-GCCUCAGUALCUCAGD--GGDX-AGAGCRGUCGGBUQUU6ACCGAUAG-------------------7D?GUAGGTPCG"GCCCUACUUGGGGCGCCA 
Qµµ6µµµµaacµGµAsnµQUUµRattus norvegicusµcytosolic µ-GUCUCUGUKLCGCAADC-GGDX-AGCGCRPPCGGCUQUU6ACCGAAAG-------------------7DUGGUGG.PCG"GCCCACCCAGGGACGCCA 
8µµAµµµµgacµGµAspµ8UCµBos taurusµcytosolic µ-GGUGCCGUALCGPAGD--#GC--A.CG.GACUCUBU8UCAAAGAGUGG-------------------7A?.UGAGTPCG"UACUCAACGGCACCGCCA 
8µµAµµµµgacµGµAspµ8UCµOryctolagus cuniculusµcytosolic µ-UCCCGUCUAGUAPAGU--GGDG-AGUAUAUCCGCCU8UCACGCGGGAG-------------------GA??GGGGTPCG"AUCCCCGGACGGGAGCCA 
8µµAµµµµgacµGµAspµ8UCµRattus norvegicusµcytosolic µ-UCCUCGUUAGUAPAGU--GGDG-AGUAUCCCCGCUC8UCA?GCGGGAG-------------------A-??GGGGTPCGAUUCCCCGACGGGGAGCCA 
8µµAµµµµgacµGµAspµ8UCµXenopus laevisµcytosolic µ-UCCUCLUUKGUAPAGU--GGDG-AGUAUCCCCGCCU8UCA?GCGGGAG-------------------A-??GGGGTPCAAUUCCCCGACGGGGAGCCA 
GµµAµµµµgacµGµAspµGUCµEuglena gracilisµcytosolic µ-UCUUCGGUAGUAPAGD--#GDA-AGUAU;PCCGCCUGUCA<GCGGAAG-------------------A-<HCGGGTPCAHUUCCCGGCCGGAGAGCCA 
GµµAµµµµgacµGµAspµGUCµRattus norvegicusµcytosolic µAUCCUCGUUAGUAPAGU--GGDG-AGUAUCCCCGCUCGUCA?GCGGGAG-------------------A-??GGGGTPCGAUUCCCCGACGGGGAGCCA 
GµµKµµµµgacµGµAspµGUCµSaccharomyces cerevisiaeµcytosolic µ-UCCGUGAUAGUUPAAD--GGDC-AGAAUGGGCGCPUGUCKCGUGCCAG-------------------A-U?GGGGTPCAAUUCCCCGUCGCGGAGCCA 
GµµKµµµµtgcµGµCysµGCAµNicotiana rusticaµcytosolic µ-GGGUCCAUAGCUCAGD--#GD--AGAGCAPPUGABUGCAKAPCAAGAG-------------------7DCACCGGUPCG"ACCCGGUUGGGCCCUCCA 
Gµµ+µµµµtgcµGµCysµGCAµSaccharomyces cerevisiaeµcytosolic µ-GCUCGUAUGGCGCAGD--GGD--AGCGCAGCAGAPUGCA+APCUGUUG-------------------7D?CUUAGTPCG"UCCUGAGUGCGAGCUCCA 
Cµµ6µµµµtagµCµGlnµCUAµTetrahymena thermophilaµcytosolic µ-GGUUCUAUALUAPAGC--GCDD-AGUACUGGGGA<UCUA6APCCCUUG-------------------A-C?UGGGUPCG"AUCCCAGUAGGACCUCCA 
CµµAµµµµcagµCµGlnµCUGµBos taurusµcytosolic µ-GGUUCCAUKGUGPAAD--#GDD-AGCACUCPGGABUCUGAAPCCAGCG-------------------A-U?CGAGPPCA"AUCUCGGUGGAACCUCCA 
CµµAµµµµcagµCµGlnµCUGµMus musculusµcytosolic µ-GGUUCCAUKGUGPAAD--#GDD-AGCACUCPGGABUCUGAAPCCAGCG-------------------A-U??GAGPPCA"AUCUCGGUGGAACCUCCA 
CµµAµµµµcagµCµGlnµCUGµRattus norvegicusµcytosolic µ-GGUUCCAUKGUGPAAD--#GDD-AGCACUCUGGABUCUGAAPCCAGCG-------------------A-U??GAGPPCA"AUCUCGGUGGAACCUCCA 
Jµµ6µµµµtaaµUµGlnµJUAµTetrahymena thermophilaµcytosolic µ-GGUUCCAUALUAPAGD--GGDD-AGUACUGGGGABUJUA6APCCCUUG-------------------A-C?UGGGUPCG"AUCCCAGUGGGACCUCCA 
JµµAµµµµcaaµUµGlnµJUGµMus musculusµcytosolic µ-GGUCCCAUKGUGPAAD--#GDD-AGCACUCPGGABUJUGAAPCCAGCG-------------------A-U??GAGPPCA"AUCUCGGUGGGACCUCCA 
Jµµ/µµµµcaaµUµGlnµJUGµNicotiana rusticaµcytosolic µ-GGUUCUAUKGUGPAGD--#GDD-AGCACUCPGGABUJUG/APCCAGCG--------------------ACCUGGGTPCG"CUCCCGGUAGGACCUCCA 
JµµAµµµµcaaµUµGlnµJUGµTetrahymena thermophilaµcytosolic µ-GGUUGUAUKLUGPAGC--GGDD-AGCACCGAGGACUJUGAAPCCUCUG-------------------A-C?UGGGUPCG"AUCCCAGUACGACCUCCA 
NµµAµµµµcaaµUµGlnµNUGµHomo sapiensµcytosolic µ-GGCCCCAUKGUGPAAU--#GDD-AGCACUCPGGABUNUGAAPCCAGCG-------------------A-U??GAGPPCA"AUCUCGGUGGGACCUCCA 
NµµAµµµµcaaµUµGlnµNUGµHomo sapiensµcytosolic µ-GGUCCCAUKGUGPAAU--#GDD-AGCACUCPGGABUNUGAAPCCAGCG-------------------A-U??GAGPPCA"AUCUCGGUGGGACCUCCA 
UµµEµµµµtaaµUµGlnµUUAµLupinus luteusµcytosolic µ-..CGUCUUAL...AGD--GG..-A...CR.C.UGBUUUAEACACG.UG-------------------7D?GUGGGTPCG"AUCCCACAGACGAGACCA 
2µµAµµµµgaaµUµGluµ2UCµDrosophila melanogasterµcytosolic µ-UCCCAUAUGGUCPAGD--GGCD-AGGAUAUCUGGBU2UCACCCAGAAG-------------------G-CCCGGGTPCGAUUCCCGGUAUGGGAACCA 
3µµAµµµµgaaµUµGluµ3UCµRattus norvegicusµcytosolic µ-UCCCACAUKGUCPAGC--GGDD-AGGAUUCCUGGPU3UCACCCAGGCG-------------------G-C??GGG\PCGACUCCCGGUGUGGGAACCA 
3µµAµµµµgaaµUµGluµ3UCµSchizosaccharomyces pombeµcytosolic µ-UCCGUUGUKGUCCAAC--GGCD-AGGAUUCGUCGCU3UCACCGACGGG-------------------A-G?GGGGTPCGACUCCCCGCAACGGAGCCA 
CµµAµµµµgagµCµGluµCPCµHordeum vulgareµcytosolic µ-UCCGUCGUAGUCPAGGD-GGDP-AGGAUACUCGGCUCPCACCCGAGAG-------------------A-C?CGGGTPCG"GUCCCGGCGACGGAACCA 
CµµAµµµµgagµCµGluµCUCµHomo sapiensµcytosolic µ-UCCCUGGUGLUCPAGU--GGDP-AGGAUUCGGCGCUCUCACCGCCGCG-------------------G-C??GGG\PCGAUUCCCGGUCAGGGAACCA 
CµµAµµµµgagµCµGluµCUCµLupinus luteusµcytosolic µ-UCCGUUGUAGUCPAGDD-GGDC-AGGAUAUUCGGCUCUCACCCGAAAG-------------------A-C?CGGGTPCA"GUCCCGGCGACGGAACCA 
CµµAµµµµgagµCµGluµCUCµMus musculusµcytosolic µ-UCCCUGGUGLUCPAGU--GGDP-AGGAUUCGGCGCUCUCACCGCCGCG-------------------G-C??GGG\PCGAUUCCCGGUCAGGGAACCA 
UµµAµµµµgaaµUµGluµUPCµHordeum vulgareµcytosolic µ-UCCGUCGUAGUCPAGGD-GGDP-AGGAUACUCGGCUUPCACCCGAGAG-------------------A-C?CGGGTPCA"GUCCCGGCGACGGAACCA 
3µµAµµµµgaaµUµGluµUUCµSaccharomyces cerevisiaeµcytosolic µ-UCCGAUAUAGUGPAAC--GGCD-AUCACAPCACGCU3UCACCGUGGAG-------------------A-C?GGGGTPCGACUCCCCGUAUCGGAGCCA 
,µµAµµµµggaµUµGlyµ,CCµBombyx moriµcytosolic µ-GCGJUGGUKGUGPAAD--GGDC-AGCAUAGPUGCCU,CCAAGCAGUUG-------------------A-U??GGGTPCG"UUCCCGGCCAACGCACCA 
CµµAµµµµgggµCµGlyµCCCµHomo sapiensµcytosolic µ-GCGBCLCUGGUGPAGU--GGD--AUCAUGCAAGAJUCCCAUZCUUGCG-------------------A-C??GGGTPCG"UUCCCGGGCGGCGCACCA 
GµµAµµµµggcµGµGlyµGCCµBombyx moriµcytosolic µ-GCAJCGGUKGUUCAGU--GGD--AGAAUGCUCGCCUGCCA?GCGGGCG-------------------G-???GGGTPCG"UUCCCGGCCGAUGCACCA 
GµµAµµµµggcµGµGlyµGCCµHomo sapiensµcytosolic µ-GCAJULGUGGUUCAGU--GGD--AGAAUUCUCGCCUGCCA?GCGGGAG-------------------G-???GGGTPCG"UUCCCGGCCAAUGCACCA 
GµµAµµµµggcµGµGlyµGCCµLupinus luteusµcytosolic µ-GCABCAGUKGUCPAGD--GGU--AGAAUAGUACCCUGCCA?GGUACAG-------------------A-???GGGUPCG"UUCCCGGCUGGUGCACCA 
GµµAµµµµggcµGµGlyµGCCµSaccharomyces cerevisiaeµcytosolic µ-GCGBAAGUKGUUPAGD--GGD--AAAAUCCAACGPUGCCAPCGUUGGG---------------------C?CCGGTPCGAUUCCGGGCUUGCGCACCA 
GµµAµµµµggcµGµGlyµGCCµTriticum aestivumµcytosolic µ-GCABCAGUKGUCPAGD--GGU--AGAAUAGUACCCUGCCA?GGUACAG-------------------A-???GGGUPCG"UUCCCGGCUGGUGCACCA 
NµµAµµµµggaµUµGlyµUCCµSaccharomyces cerevisiaeµcytosolic µ-GGGCGGUUAGUGPAGD--GGDD-AUCAUCCCACCCUNCCAAGGUGGGG-------------------A-CACGGGTPCGAUUCUCGUACCGCUCACCA 
GµµKµµµµcacµGµHisµGUGµDrosophila melanogasterµcytosolic µGGCCGUGAUCGUCPAGD--GGDD-AGGACCCCACGPUGUGKCCGUGGUA-------------------A-CC?AGGUPCG"AUCCUGGUCACGG?ACCA 
GµµGµµµµcacµGµHisµGUGµHomo sapiensµcytosolic µ;GCCGUGAUCGUAPAGD--GGDD-AGUACUCUGCGPUGUGGCCGCAGCA-------------------A-??UCGGUPCG"AUCCGAGUCACGGCACCA 
GµµKµµµµcacµGµHisµGUGµLupinus luteusµcytosolic µGGUGGCUGUAGUUPAGD--GGDD-AGAACACAACGPUGUGKCCGUUGAA-------------------A-C?UGGGUPCG"AUCCCAGCAGCCACACCA 
GµµKµµµµcacµGµHisµGUGµSaccharomyces cerevisiaeµcytosolic µGGCC:UCUUAGUAPAGD--#GDD-AGUACACAACAPUGUGKCPGUUGAA-------------------A-C?CUGGTPCGAUUCUAGGAGGUGGCACCA 
GµµKµµµµcacµGµHisµGUGµSaccharomyces cerevisiaeµcytosolic µGGCC:UCUUAGUAPAGD--#GDD-AGUACACAUCGPUGUGKCCGAUGAA-------------------A-C?CUGGTPCGAUUCUAGGAGAUGGCACCA 
QµµKµµµµcacµGµHisµQUGµOvis ariesµcytosolic µGGCCGULAUCGUAPAGD--GGDD-AGUACUCUGCGPUQUGKCCGCAGCA-------------------A-C?UCGGUPCG"AUCCGAGUCACGG?ACCA 
Iµµ6µµµµattµAµIleµAAUµSaccharomyces cerevisiaeµcytosolic µ-GGUCUCUUKLCCCAGDD-GGDD-AAGGCACCGUGCUIAU6ACGCGGGG-------------------AD?AGCGGTPCG"UCCCGCUAGAGACCACCA 
Iµµ6µµµµattµAµIleµIAUµBombyx moriµcytosolic µ-GGCCCAUUALCUCAGDD-GGDN-AGAGCRPCGUGCUIAU6ACGCGAAG-------------------7U?G?GGGTPCG"UCCCCUCAUGGGCCACCA 
Iµµ6µµµµattµAµIleµIAUµLupinus luteusµcytosolic µ-GGCCCAUUALCCCAGDD-GGDD-AAGGCRPGGUGCUIAU6ACGCCGAA-------------------GD?AGCAGTPCG"UCCUGCUAUGGGCCACCA 
Iµµ6µµµµattµAµIleµIAUµMus musculusµcytosolic µ-GGCCGGUUALCUCAGDD-GGDD-AGAGCRPGGPGCUIAU6ACGCCAAG-------------------7D?GCGGGTPCG"UCCCCGUACGGGCCACCA 
Iµµ6µµµµattµAµIleµIAUµPichia jadiniiµcytosolic µ-GGUCCCUUGLCCCAGDD-GGDD-AAGGCRPGGUGCUIAU6ACGCCAAG-------------------AD?AGCAGTPCG"UCCUGCUAGGGACCACCA 
Pµµ6µµµµataµUµIleµUAUµSaccharomyces cerevisiaeµcytosolic µ-GCUCGUGUALCUCAGD--GGDD-AGAGCUPCGUGCUPAP6ACGCGACC-------------------7D?GUGGGTPCA"UCCCCACCPCGAGCACCA 
Cµµ6µµµµatgµCµIniµCAUµAsterina amurensisµcytosolic µ-AGCAGAGUKLCGCAGU--GGA--AGCGUGCUGGGCCCAU6ACCCAGAG-------------------7D?CGAGGAPCG"AACCUCGCUCUGCUACCA 
Cµµ6µµµµatgµCµIniµCAUµDrosophila melanogasterµcytosolic µ-AGCAGAGUKLCGCAGU--GGA--AGCGULCUGGGCCCAU6ACCCAGAG-------------------7D?CGAGGAUCG"AACCUUGCUCUGCUACCA 
Cµµ6µµµµatgµCµIniµCAUµEuphausia superbaµcytosolic µ-AGCAGAGUKLCGCAGU--GGA--AGCGULCUGGGCCCAU6ACCCAGAG-------------------7UCGGUAGAPCG"AACUACUCUCUGCUACCA 
Cµµ6µµµµatgµCµIniµCAUµHomo sapiensµcytosolic µ-AGCAGAGUKLCGCAGC--GGA--AGCGULCUGGGCCCAU6ACCCAGAG-------------------7D?GAUGGAUCG"AACCAUCCUCUGCUACCA 
Cµµ6µµµµatgµCµIniµCAUµLupinus luteusµcytosolic µ-AUCAGAGUKLCGCAGC--GGA--AGCGCRGPGGGCCCAU6ACCCACAG-------------------7D?<CAGGAPCG"AACCU.GCUCUGAUACCA 
Cµµ6µµµµatgµCµIniµCAUµMus musculusµcytosolic µ-AGCAGAGUKLCGCAGC--GGA--AGCGULCUGGGCCCAU6ACCCAGAG-------------------7D?GAUGGAUCG"AACCAUCCUCUGCUACCA 
Cµµ6µµµµatgµCµIniµCAUµNeurospora crassaµcytosolic µ-AGCUGCAUKGCGCAGC--GGA--AGCGCRC.GGGCUCAU6ACCCGGAG-------------------7DCACUCGAUCG"AACGA;UUGCAGCUACCA 
Cµµ6µµµµatgµCµIniµCAUµOryctolagus cuniculusµcytosolic µ-AGCAGAGUKLCGCAGC--GGA--AGCGULCUGGGCCCAU6ACCCAGAG-------------------7D?GAUGGAUCG"AACCAUCCUCUGCUACCA 
Cµµ6µµµµatgµCµIniµCAUµOvis ariesµcytosolic µ-AGCAGAGUKLCGCAGC--GGA--AGCGULCUGGGCCCAU6ACCCAGAG-------------------7D?GAUGGAUCG"AACCAUCCUCUGCUACCA 
Cµµ6µµµµatgµCµIniµCAUµPhaseolus vulgarisµcytosolic µ-AUCAGAGUKLCGCAGC--GGA--AGCGULGUGGGCCCAU6ACCCACAG-------------------7D?CCAGGAPCG"AACCU#GCUCUGAUACCA 
Cµµ6µµµµatgµCµIniµCAUµPichia jadiniiµcytosolic µ-AGCGUCUUKLCGCAGD--GGA--AGCGCRCAGGGCUCAU6ACCCUGAU-------------------7D??CUGGAUCG"AACCAℑGAGACGCUACCA 
Cµµ6µµµµatgµCµIniµCAUµSaccharomyces cerevisiaeµcytosolic µ-AGCGCCGUKLCGCAGD--GGA--AGCGCRCAGGGCUCAU6ACCCUGAU-------------------7D??UCGGAUCG"AACCGˆGCGGCGCUACCA 
Cµµ6µµµµatgµCµIniµCAUµSalmo salarµcytosolic µ-AGCAGAGUKLCGCAGC--GGA--AGCGURCUGGGCCCAU6ACCCAGAG-------------------7D?GAUGGAUCG"AACCAUCCUCUGCUACCA 
Cµµ6µµµµatgµCµIniµCAUµScenedesmus obliquusµcytosolic µ-AGCUGAGUKLCGCAGD--GGA--AGCGPLAPGGGCUCAU6ACCCAUAG-------------------7D?ACAGGAUCG"AACCU;UCUCAGCUACCA 
Cµµ+µµµµatgµCµIniµCAUµSchizosaccharomyces pombeµcytosolic µ-PGCGCGGUALGAGAGD--GGA--ACUCCRACGGGCUCAU+ACCCGUAG-------------------7UC?CAGGAUCG"AACCUGGCCGCGCAACCA 
Cµµ6µµµµatgµCµIniµCAUµTetrahymena thermophilaµcytosolic µ-AGCAGGGUKGCGAAAD--#GA--AUCGCGUPGGGCUCAU6ACPCAAAA-------------------7U?AGAGGAPCG"AACCUCUCUCUGCUACCA 
Cµµ6µµµµatgµCµIniµCAUµTriticum aestivumµcytosolic µ-AUCAGAGUKLCGCAGC--GGA--AGCGULGPGGGCCCAU6ACCCACAG-------------------7D??CAGGAPCG"AACCU;GCUCUGAUACCA 
Cµµ6µµµµatgµCµIniµCAUµXenopus laevisµcytosolic µ-AGCAGAGUKLCGCAGC--GGA--AGCGULCUGGGCCCAU6ACCCAGAG-------------------7D?GAUGGAUCG"AACCAUCCUCUGCUACCA 
.µµKµµµµtt.µµLeuµ.AAµHomo sapiensµcytosolic µ-GUCAGLAUGLCMGAGU--GGDCPAAGGCRCCAGACU.AAKPPCUGGJ-CPCCG--GA-----UGGAG--?GUGGGTPCG"AUCCCACUUCUGACACCA 
.µµKµµµµtt.µµLeuµ.AAµPhaseolus vulgarisµcytosolic µ-GUCAGGAUGLCMGAGD--GGDCXAAGGCRCCAGACU.AAKPPCUGGJ-CUUC---GAGA----GAGGG-?GUGGGTPCA"AUCCCACUUCUGACACCA 
.µµKµµµµtt.µµLeuµ.AAµPhaseolus vulgarisµcytosolic µ-GUCAGGAUGLCMGAGD--GGDCXAAGGCRCCAGACU.AAKPPCUGGJ-CUUC---GAAA----GAGGG-?GUGGGTPCA"AUCCCACUUCUGACACCA 
.µµKµµµµtt.µµLeuµ.AAµPhaseolus vulgarisµcytosolic µ-GCUGGUUUGGCMGAGA--GGDD-AAGGCRGAAGACU.AAKAPCUUCJ-GCAG---UCAA----CUGCG-?AUGGGTPCG"ACCCCAUAGCCAGCACCA 
.µµKµµµµtt.µµLeuµ.AAµSolanum tuberosumµcytosolic µ-GUCAGGAUGGCMGAGD--GGDCXAAGGCRCCAGACU.AAKUPCUGGJ-CUUC---GUAA----GAGGG-?GUGGGTPCA"AUCCCACUUCUGACACCA 
.µµKµµµµct.µµLeuµ.AGµPhaseolus vulgarisµcytosolic µ-GAUAGUUUGLCMGAGD--GGDCXAAGGCRCCAGAPU.AGKCPCUGGJ-CCG----AAA------.GGG-?GUGGGUPCA"AUCCCACAGCUGUCACCA 
°µµKµµµµttgµCµLeuµ°AAµBos taurusµcytosolic µ-GUCAGLAUGLCMGAGU--GGDCPAAGGCLCCAGACU°AAKPPCUGGJ-CPCC---GUAU----GGAGG-?GUGGGTPCG"AUCCCACUUCUGACACCA 
<µµ;µµµµttgµCµLeuµ<AAµRattus norvegicusµcytosolic µAGUCAGLAUGLCMGAGU--GGDCPAAGGCRCCAGACU<AA;PPCUGGN-PCCG---AA------UGGAG-?GUGGGTPCG"AUCCCACUUCUGACACCA 
<µµ;µµµµttgµCµLeuµ<AAµRattus norvegicusµcytosolic µAGUCAGLAUGLCMGAGU--GGDCPAAGGCRCCAGACU<AA;PPCUGGN-PCCG---UA------UGGAG-?GUGGGTPCG"AUCCCACUUCUGACACCA 
BµµKµµµµttgµCµLeuµBAAµCandida cylindraceaµcytosolic µ-GGCCGUUUGLCMGAGD--#GDCDAAGGCRUCUGABUBAAKAPCAGAJ-CUC----GUAA-----GAGG-?GUGUGTPCG"ACCACACAGCGGUCACCA 
BµµKµµµµttgµCµLeuµBAAµPichia jadiniiµcytosolic µ-GGAUCUUUGLCMGAGC--#GDDUAAGGCRCUCGABUBAAKAPCGAGU-AUC----GUAA-----GAUG-?AUGAGTPCG"AUCUCAUAGGAUCCACCA 
?µµKµµµµttgµCµLeuµCAAµSaccharomyces cerevisiaeµcytosolic µ-GGUUGUUUGLCMGAGC--#GDCDAAGGCRCCUGAPU?AAKCPCAGGU-AUC----GUAA-----GAUG-?AAGAGTPCGAAUCUCUUAGCAACCACCA 
CµµKµµµµctgµCµLeuµCAGµBos taurusµcytosolic µ-GUCAGLAUGLCMGAGC--GGDDCAAGGCRCUGCGJUCAGK.CGCAGJ-CPCC---CU------GGAGG-?GUGGGTPCG"AUCCCACUUCUGACACCA 
CµµKµµµµctgµCµLeuµCAGµCandida albicansµcytosolic µ-GAUACGAUGGCMGAGD--#GDD-AAGGCRAAGGAUGCAGKPPCCUU--UGGGC--AUU----GCCCG--?GCAGGTPCG"ACCCUGCUCGUGUCGCCA 
CµµKµµµµctgµCµLeuµCAGµLupinus luteusµcytosolic µ-GUCAGGAUGLCMGAG-D-GGDCXAAGGCRCCAGUJUCAGKPACUGGJCPCG----AAC------CGGG-?AUGGGTPCG"AUCCCAUUCUUGACACCA 
IµµKµµµµcttµAµLeuµIAGµBos taurusµcytosolic µ-GGUAGCGUGLCMGAGC--GGDCPAAGGCRCUGGAZUIAGKCPCCAGU-CPCP---UC------GGGGG-?GUGGGTPCG"AUCCCACCGCUGCCACCA 
IµµKµµµµcttµAµLeuµIAGµBos taurusµcytosolic µ-GGUAGCGUGLCMGAGC--GGDCPAAGGCRCUGGAZUIAGKCPCCAGU-CPCP---UC------GGGGG-?GUGGGTPCG"AUCCCACCGCUGCCACCA 
IµµGµµµµcttµAµLeuµIAGµCaenorhabditis elegansµcytosolic µ-GGAGAGAUGGCMGAGC--GGDCUAAGGCGCUGGUUUIAGGCACCAGU-CCCU---UC------GGGGG-CGUGGGTUCGAAUCCCACUCUCUUCACCA 
IµµKµµµµcttµAµLeuµIAGµCandida cylindraceaµcytosolic µ-GGUUCUCUGGCMGAGD--GGDCDAAGGCRCAUGGPUIAGKPCCAUGU-CUC----UUCG-----GAGG-?GCGAGTPCG"ACCUCGCGGGAAUCACCA 
IµµKµµµµcttµAµLeuµIAGµCandida cylindraceaµcytosolic µ-GGCUCUCUGGCMGAGD--GGDCDAAGGCRCUAGGPUIAGKPCCUAGU-CUC----UUCG-----GAGG-?GCGAGTPCG"ACCUCGCGGGAGUCACCA 
IµµKµµµµcttµAµLeuµIAGµLupinus luteusµcytosolic µ-GUCAGGAUGLCMGAG-D-GGDCXAAGGCRCCAGAZUIAGKPUCUGGJCPCGA---A-------UCGGG-?GUGGGTPCA"AUCCCACUCUUGACACCA 
IµµKµµµµcttµAµLeuµIAGµLupinus luteusµcytosolic µ-GUCAGGAUGLCMGAG-D-GGDCXAAGGCRCCAGAZUIAGKPUCUGGJCPGA----AUC------UUGG-?GUGGGTPCA"AUCCCACUCUUGACACCA 
NµµKµµµµttaµUµLeuµNAAµCucumis sativusµcytosolic µ-GUCAGGAUGLC?GAG-D-GGDCXAAGGCRCCAGACUNAAKPPCUGGJ-CCUC---UAAG----GAGGG-?GUGGGTPCA"AUCCCACUUCUGACACCA 
UµµKµµµµttaµUµLeuµUAAµLupinus luteusµcytosolic µ-GUCAGGAUGLCMGAG-D-GGDCXAAGGCRCCAGACUUAAKPPCUGGJCPCGA---A-------UCGGG-?GUGGGTPCA"AUCCCACUUCUGACACCA 
∼µµKµµµµttaµUµLeuµUAAµSaccharomyces cerevisiaeµcytosolic µ-GGAGGGUUGLCMGAGD--#GDCDAAGGCRGCAGABU∼AAKAPCUG-UUGGAC---GGUU----GUCC-G?GCGAGTPCG"ACCUCGCAUCCUUCACCA 
UµµKµµµµctaµUµLeuµUAGµSaccharomyces cerevisiaeµcytosolic µ-GGGAGUUUGLCMGAGD--#GDDDAAGGCRPCAGAPUUAGKCPCUGAU-AUC----UUCG-----GAUG-?AAGGGTPCG"AUCCCUUAGCUCUCACCA 
)µµ6µµµµaaaµUµLysµ)UUµDrosophila melanogasterµcytosolic µ-GCCCGGAUALCUCAGDC-GGD--AGAGCAPPGGACU)UU6APCCAAGG-------------------7D?CAGGG\PCA"GUCCCUGUUCGGGCGCCA 
3µµ[µµµµaaaµUµLysµ3UUµOryctolagus cuniculusµcytosolic µ-GCCCGGAUALCUCAGDC-GGD--AGAGCAPCAGACU3UU[APCUGAGG-------------------7D??AGGG\PCA"GUCCCUGUUCGGGCGCCA 
3µµ[µµµµaaaµUµLysµ3UUµRattus norvegicusµcytosolic µ-GCCCGLAUALCUCAGDC-GGD--AGAGCAPCAGACU3UU[APCUGAGG-------------------7D??AGGG\PCA"GUCCCUGUUCGGGCGCCA 
3µµ6µµµµaaaµUµLysµ3UUµSaccharomyces cerevisiaeµcytosolic µ-PCCUUGUUALCUCAGDD-GGD--AGAGCRPPCGGCU3UU6ACCGAAAU-------------------7D?AGGGGTPCG"GCCCCCUAPGAGGAGCCA 
Cµµ6µµµµaagµCµLysµCUNµMus musculusµcytosolic µ-GCCCGLCUALCUCAGDC-GGD--AGAGCAPGGGACUCUN6APCCCAGG-------------------7D?GUGGG\PCG"GCCCCACGUUGGGCGCCA 
Cµµ6µµµµaagµCµLysµCUNµRattus norvegicusµcytosolic µ-GCCCGLCUALCUCAGDC-GGD--AGAGCAPGAGACUCUN6APCUCAGG-------------------7D?GUGGG\PCG"GCCCCACGUUGGGCGCCA 
Cµµ6µµµµaagµCµLysµCUNµRattus norvegicusµcytosolic µ-GCCCGLCUALCUCAGDC-GGD--AGAGCAPGGGACUCUN6APCCCAGG-------------------7D?GUGGG\PCG"GCCCCACGUUGGGCGCCA 
Cµµ6µµµµaagµCµLysµCUUµDrosophila melanogasterµcytosolic µ-GCCCGGCUALCUCAGDC-GGD--AGAGCAPGAGACUCUU6APCUCAGG-------------------7DCGUGGG\PCG"GCCCCACGUUGGGCGCCA 
Cµµ6µµµµaagµCµLysµCUUµLoligo bleekeriµcytosolic µ-UCCCGLCUALCUCAGDC-GGU--AGAGCACGAGA<UCUU6APCUCGGG-------------------7D?GUGGG\PCG"GCCCCACGUUGGGAGCCA 
CµµHµµµµaagµCµLysµCUUµMus musculusµcytosolic µ-GCCCGGCUALCUCAGDC-GGU--AGAGCAPGAGACUCUUHAPCUCAGG-------------------7D?GUGGG\PCG"GCCCCACGUUGGGCGCCA 
Cµµ6µµµµaagµCµLysµCUUµOryctolagus cuniculusµcytosolic µ-GCCCGGCUALCUCAGDC-GGD--AGAGCAPGGGACUCUU6APCCCAGG-------------------7D?GUGGG\PCG"GCCCCACGUUGGGCGCCA 
Cµµ6µµµµaagµCµLysµCUUµOryctolagus cuniculusµcytosolic µ-GCCCGGCUALCUCAGDC-GGD--AGAGCAPGAGACUCUU6APCUCAGG-------------------7D?GUGGG\PCG"GCCCCACGUUGGGCGCCA 
Cµµ6µµµµaagµCµLysµCUUµSaccharomyces cerevisiaeµcytosolic µ-GCCUUGUUKLCGCAADC-GGD--AGCGCRPAUGACUCUU6APCAUAAG-------------------7UUAGGGGTPCG"GCCCCCUACAGGGCUCCA 
Cµµ6µµµµaagµCµLysµCUUµTriticum aestivumµcytosolic µ-GCCCGUCUALCUCAGDD-GGU--AGAGCRCAAGGCUCUU6ACCUUGUG-------------------KD?GUGGGTPCG"GCCCCACGGUPGGCGCCA 
NµµHµµµµaaaµUµLysµNUUµLoligo bleekeriµcytosolic µ-GCCUCCAUALCUCAGDC-GGU--AGAGCAPCAGACUNUUHA@CUGAGG-------------------7D?UGGGG\PCG"GUCCCCAULUGGG?UCCA 
NµµHµµµµaaaµUµLysµNUUµLoligo bleekeriµcytosolic µ-GCCUUCAUALCUCAGDC-GGU--AGAGCAPCAGACUNUUHA@CUGAGG-------------------7D?UGGGG\PCG"GUCCCCAULCGGG?UCCA 
Bµµ6µµµµatgµCµMetµBAUµHomo sapiensµcytosolic µ-GCCUCLUUALCGCAGDA-GGD--AGCGCRPCAGPCUBAU6APCUGAAG-------------------7D?GUGAGTPCG"UCCUCACACGGGGCACCA 
BµµEµµµµatgµCµMetµBAUµLupinus luteusµcytosolic µ-GGGGUGGUKLCGCAGDD-GGCX-AGCGCRPAGGPCUBAUEAPCCUGAG-------------------7D?GAGAGTPCG"GCCUCUCUCACCCCACCA 
Bµµ6µµµµatgµCµMetµBAUµMus musculusµcytosolic µ-GCCUCLUUALCGCAGDA-GGD--AGCGCRPCAGPCUBAU6APCUGAAG-------------------7D?GUGAGTPCG"UCCUCACACGGGGCACCA 
Bµµ6µµµµatgµCµMetµBAUµOryctolagus cuniculusµcytosolic µ-GCCUCLUUALCGCAGDA-GGD--AGCGCRPCAGPCUBAU6APCUGAAG-------------------7D?GUGAGTPCG"UCCUCACACGGGGCACCA 
BµµEµµµµatgµCµMetµBAUµTriticum aestivumµcytosolic µ-GGGGUGGUKLCGCAGDD-GGCX-AGCGCRPAGGPCUBAUEAPCCUGAG-------------------7D?GAGAGTPCG"GCCUCUCUCACCCCACCA 
Cµµ6µµµµatgµCµMetµCAUµSaccharomyces cerevisiaeµcytosolic µ-GCUUCAGUALCUCAGDA-GGA--AGAGCRPCAGPCUCAU6APCUGAAG-------------------7D?GAGAGTPCG"ACCUCUCCUGGAGCACCA 
#µµKµµµµttcµGµPheµ#AAµBombyx moriµcytosolic µ-GCCGAAAUALCUCAGDD-GGG--AGAGCRPPAGABU#AAKAPCUAAAG-------------------7D?CCUGGTPCA"UCCCGGGUUUCGGCACCA 
#µµKµµµµttcµGµPheµ#AAµBombyx moriµcytosolic µ-GCCGAAAUALCUCAGDD-GGG--AGAGCRPPAGABU#AAKAPCUAAAG-------------------7D?CCUGGTPCG"UCCCGGGUUUCGGCACCA 
#µµWµµµµttcµGµPheµ#AAµBos taurusµcytosolic µ-GCCGAAAUALCUC"GDD-GGG--AGAGCRPPAGABU#AAWAPCUAAAG-------------------7DC?CUGGTPCG"UCCCGGGUUUCGGCACCA 
#µµWµµµµttcµGµPheµ#AAµBos taurusµcytosolic µ-GCCGAAAUALCUC"GDD-GGG--AGAGCRPPAGABU#AAWAPCUAAAG-------------------7DC?CUGGTPCA"UCCCGGGUUUCGGCACCA 
#µµWµµµµttcµGµPheµ#AAµBos taurusµcytosolic µ-GCCGAAAUALCUC"GDD-GGG--AGAGCRPPAGABU#AAWAPCUAAAG-------------------7DC?CUGGTPCG"UCCCGGGUUUCGGCACCA 
#µµYµµµµttcµGµPheµ#AAµBrassica napusµcytosolic µ-GCGGGGAUALCUCAGDD-GGG--AGAGCRPCAGABU#AAYAPCUGAAG-------------------7DCGCGUGTPCG"UCCACGCUCACCGCACCA 
#µµKµµµµttcµGµPheµ#AAµDrosophila melanogasterµcytosolic µ-GCCGAAAUALCUCAGDD-GGG--AGAGCRPPAGABU#AAKAPCUAAAG-------------------7DCCCCGGTPCA"UCCCGGGUUUCGGCACCA 
#µµYµµµµttcµGµPheµ#AAµEuglena gracilisµcytosolic µ-GCCGACUUALCUBAGDD-GGG--AGAGCRPPAGABU#AAYAPCUAAAG-------------------7UCCCUGGTPCG"UCCCGGGAGPCGGCACCA 
#µµWµµµµttcµGµPheµ#AAµHomo sapiensµcytosolic µ-GCCGAAAUALCUC"GDD-GGG--AGAGCRPPAGABU#AAWAPCUAAAG-------------------7DC?CUGGTPCG"UCCCGGGUUUCGGCACCA 
#µµWµµµµttcµGµPheµ#AAµHordeum vulgareµcytosolic µ-GCGGGGAUALCUCAGDD-GGG--AGAGCRPCAGABU#AAWAPCUGAAG-------------------7DCGCGUGTPCG"UCCACGCUCACCGCACCA 
#µµWµµµµttcµGµPheµ#AAµLupinus luteusµcytosolic µ-GCGGGGAUALCUCAGDD-GGG--AGAGCRPCAGABU#AAWAPCUGAAG-------------------7DCACGUGTPCG"UCCACGUUCACCGCACCA 
#µµKµµµµttcµGµPheµ#AAµMus musculusµcytosolic µAGCCGAAAUALCUC"GDD-GGG--AGAGCRPPAGABU#AAKAPCUAAAG-------------------7UC?CUGGTPCG"UCCCGGGUUUCGGCACCA 
#µµYµµµµttcµGµPheµ#AAµMus musculusµcytosolic µ-GCCGAAAUALCUC"GDD-GGG--AGAGCRPPAGABU#AAYAPCUAAAG-------------------7UC?CUGGTPCG"UCCCGGGUUUCGGCACCA 
#µµYµµµµttcµGµPheµ#AAµMus musculusµcytosolic µ-GCCGAAAUALCUC"GDD-GGG--AGAGCRPPAGABU#AAYAPCUAAAG-------------------7UC?CUGGTPCG"UCCCGGGUUUCGGCACCA 
#µµYµµµµttcµGµPheµ#AAµNeurospora crassaµcytosolic µ-GCGGGUUUALCUCHGDD-GGG--AGAGCRPCAGABU#AAYAP?UGAAG-------------------7D?GUGUGTPCG"UCCACACAAACCGCACCA 
#µµWµµµµttcµGµPheµ#AAµOryctolagus cuniculusµcytosolic µ-GCCGAAAUALCUC"GDD-GGG--AGAGCRPPAGABU#AAWAPCUAAAG-------------------7DC?CUGGTPCG"UCCCGGGUUUCGGCACCA 
#µµWµµµµttcµGµPheµ#AAµPisum sativumµcytosolic µ-GCGGGGAUALCUCAGDD-GGG--AGAGCRPCAGABU#AAWAPCUGAAG-------------------7DCGCGUGTPCG"UCCACGCUCACCGCACCA 
#µµYµµµµttcµGµPheµ#AAµSchizosaccharomyces pombeµcytosolic µ-GUCGCAAU;LUGPAGDD-GGG--AGCAPLACAGABU#AAYAPCUGUUG-------------------7NCAUCGGTPCGAUCCCGGUUUGUGACACCA 
#µµWµµµµttcµGµPheµ#AAµTriticum aestivumµcytosolic µ-GCGGGGAUALCUCAGDD-GGG--AGAGCRPCAGABU#AAWAPCUGAAG-------------------7DCGCGUGTPCG"UCCACGCUCACCGCACCA 
#µµWµµµµttcµGµPheµ#AAµXenopus laevisµcytosolic µ-GCCGAAAUALCUC"GDD-GGG--AGAGCRPPAGABU#AAWAPCUAAAG-------------------7DC?CUGGTPCG"UCCCGGGUUUCGGCACCA 
#µµYµµµµttcµGµPheµGAAµSaccharomyces cerevisiaeµcytosolic µ-GCGGAUUUALCUCAGDD-GGG--AGAGCRCCAGABU#AAYAP?UGGAG-------------------7UC?UGUGTPCG"UCCACAGAAUUCGCACCA 
#µµYµµµµttcµGµPheµGAAµSaccharomyces cerevisiaeµcytosolic µ-GCGGACUUALCUCAGDD-GGG--AGAGCRCCAGABU#AAYAP?UGGAG-------------------7UC?UGUGTPCG"UCCACAGAGUUCGCACCA 
GµµKµµµµttcµGµPheµGAAµScenedesmus obliquusµcytosolic µ-GGCUUGAUALCUCAGCD-#GG--AGAGCRPPAGABUGAAKAPCUACAG-------------------7.?CCCAGTPCG"U?BUGGGUCAGGCCACCA 
&µµKµµµµccaµUµProµ&GGµPichia jadiniiµcytosolic µ-GGCBGCGUKGUCPAGD--GGD--AUGAUACUCGCUU&GGKPGPGAGUG-------------------7D??AGGGTPCA"UUCCCUGCUCGGCCCCCA 
IµµKµµµµcctµAµProµIGGµLupinus luteusµcytosolic µ-GGGACAUUKGUCPAGD--GGD--AUGAUUCUCGCUUIGGKPGCGAGAG-------------------7D?CCGAGTPCG"UUCUCGGAUGUCCCCCCA 
NµµKµµµµccaµUµProµUGGµSaccharomyces cerevisiaeµcytosolic µ-GGGBGUGUKGUCPAGD--GGD--AUGAUUCUCGCPUNGGKPGCGAGAG-------------------7CCCUGGGTPCA"UUCCCAGCUCGCCCCCCA 
1µµ+µµµµtgaµUµSecµ1CAµBos taurusµcytosolic µ-GCCCGGAU_CCUCAGU--GGUC-UGGGGUGCAGGCU1CA+ACCUGUAGCUGUC--UAGC---GACAG---AGUGGUPCA"UUCCA_UUUCGGGCGCCA 
1µµ+µµµµtgaµUµSecµ1CAµDrosophila melanogasterµcytosolic µ-GCCCCACU_CUUCGGU--GGU-CCGGGGUGCGGACU1CA+AUCCGUAGUCGAU--UUGC---GUCGA---AGUGGUPCGAUUCCA_UGGGGGGCGCCA 
1µµ+µµµµtgaµUµSecµ1CAµXenopus laevisµcytosolic µ-GCCCGGAU_CCUCAGU--GGU-CUGGGGUGCAGGCU1CA+ACCUGUAGCUGUC--UAGC---GACAG---AGUGGUPCA"UUCCA_UUUCGGGCGCCA 
Nµµ+µµµµtgaµUµSecµNCAµHomo sapiensµcytosolic µ-GCCCGGAU_CCUCAGU--GGUC-UGGGGUGCAGGCUNCA+ACCUGUAGCUGUC--UAGC---GACAG---AGUGGUPCA"UUCCA_UUUCGGGCGCCA 
Nµµ+µµµµtgaµUµSecµNCAµMus musculusµcytosolic µ-GCCCGGAU_CCUCAGU--GGUC-UGGGGUGCAGGCUNCA+ACCUGUAGCUGUU--UAGC---GACAG---AGUGGUPCA"UUCCA_UUUCGGGCGCCA 
Uµµ+µµµµtgaµUµSecµUCAµChlamydomonas reinhardtiiµcytosolic µ-GCCGCUGU_CUUGGCG--GGU-GCUGAGUGCGGUCUUCA+AACCGUAGAGGCC--GGAA---GGCCU---AGUGGUPCA"UUCCA_UCGGCGGCGCCA 
&µµ+µµµµtcaµUµSerµ&GAµCandida cylindraceaµcytosolic µ-GGUGCAAUGGCMGAGD--#GDD-AAGGCRACGGAPU&GA+CPCCGUJ-GGGA---UUC-----UCCCU-?GCAGGTPCG"AUCCUGUUUGCAUCGCCA 
&µµ`µµµµtcaµUµSerµ&GAµNicotiana rusticaµcytosolic µ-GUCGAUAUGUCCGAGD--#GDD-AAGGARACAGA'U&GA`APCUGUJ-GGGC---UUC-----GCCCG-CGCAGGTPCG"ACCCUGCUGUCGACGCCA 
CµµAµµµµctgµCµSerµCAGµCandida cylindraceaµcytosolic µ-GACACCGUGLCMCAGD--#GDD-ACGGCRPUGGACGCAGAAPCCAUU-GAGC---UU------GCUCG-?GCGGGTPCG"AUCCCGUCGGUGUCUCCA 
Cµµ+µµµµtcgµCµSerµCGAµCandida cylindraceaµcytosolic µ-GGCAACUUGGCMGAGD--#GDD-AAGGCRUGACA'UCGA+APGUCAJ-GGGU---UU------ACCCG-?GCAGGTPCG"AUCCUGCAGUUGUCGCCA 
Cµµ+µµµµtcgµCµSerµCGAµDrosophila melanogasterµcytosolic µ-GCA#UCGUGGCMGAGD--#GDD-AAGGCRUCUGA'UCGA+APCAGAJ-UCCC---U'U-----GGGAG-?GUAGGTPCG"AUCCUACCGGCUGCGCCA 
Cµµ`µµµµtcgµCµSerµCGAµLupinus luteusµcytosolic µ-GUCAGUAUGGCMGAGD--#GDD-AAGGCRACAGA'UCGA`APCUGUJ-GAGAU--UU-----GCCUGG-?AGCGGTPCG"AUCCGCUUACUGACGCCA 
Cµµ`µµµµtcgµCµSerµCGAµNicotiana rusticaµcytosolic µ-GUCGAUAUGUCCGAGD--#GDD-AAGGARACAGA'UCGA`APCUGUJ-GGGC---UUU-----GCCUG-CGCAGGTPCG"AUCCUGCUGUCGACGCCA 
Cµµ+µµµµtcgµCµSerµCGAµSaccharomyces cerevisiaeµcytosolic µ-GGCACUAUGGCMGAGD--#GDD-AAGGCRAGAGA'UCGA+APCUCUJ-GGGC---UCU-----GCCCG-?GCUGGTPCAAAUCCUGCUGGUGUCGCCA 
Gµµ+µµµµagcµGµSerµGCUµCandida cylindraceaµcytosolic µ-GUUAAUGUGGCMGAGD--GGDD-AAGGCRCUUCC'UGCU+AGGAAGJ-GGGC---UCU-----GCCCG-?GCAGGTPCG"AUCCUGUCAUUAACGCCA 
GµµEµµµµagcµGµSerµGCUµDrosophila melanogasterµcytosolic µ-GACGAGGUGGCMGAGD--#GDD-AAGGCRPPGGA'UGCUEAPCCAAJ-GUGC---U'U-----GCACG-?GUGGGTPCG"AUCCCAUCCUCGUCGCCA 
Gµµ6µµµµagcµGµSerµGCUµNicotiana rusticaµcytosolic µ-GUCGCCUUGGCCGAGD--#GDD-AAGGCRPGUGC'UGCU6AGPACAJ-GGGG---UUU-----CCCCG-CGAGAGTPCG"AUCUCUCAGGCGACGCCA 
GµµEµµµµagcµGµSerµGCUµRattus norvegicusµcytosolic µ-GACGAGGUGGCMGAGD--#GDD-AAGGCRAPGGA'UGCUEAPCCAUJ-GPGC---U'U-----GCACG-?GUGGGTPCG"AUCCCAUCCUCGUCGCCA 
Gµµ6µµµµagcµGµSerµGCUµSaccharomyces cerevisiaeµcytosolic µ-GUCCCAGUGGCMGAGD--#GDD-AAGGCRAUGCCCUGCU6AGGCAUJ-GGGU---UUU-----ACCUG-?GCAGGTPCG"AUCCUGUCUGUGACGCCA 
Iµµ+µµµµtctµAµSerµIGAµCandida cylindraceaµcytosolic µ-GGCAUCUUGGCMGAGD--#GDD-AAGGCRAAAGAPUIGA+APCUUUJ-GGGC---UCU-----GCCCG-?GCAGGTPCG"GUCCUGCAGAUGUCGCCA 
Iµµ+µµµµtctµAµSerµIGAµDrosophila melanogasterµcytosolic µ-GCA#UCGUGGCMGAGC--#GDD-AAGGCRUCUGA'UIGA+APCAGAJ-UCCC---U'U-----GGGAG-?GUAGGTPCG"AUCCUACCGACUGCGCCA 
Iµµ`µµµµtctµAµSerµIGAµNicotiana rusticaµcytosolic µ-GUGGACGUGCCGGAGD--#GDD-AUCGGRCAUGA'UIGA`APCAUGJ-GGGC---UUU-----GCCCG-CGCAGGTPCG"AUCCUGCCGUCCACGCCA 
Iµµ`µµµµtctµAµSerµIGAµNicotiana rusticaµcytosolic µ-GUGGACGUGCCGGAGD--#GDD-AUCGGRCAUGA'UIGA`APCAUGJ-GGGC---UCU-----GCCCG-CGCAGGTPCG"AUCCUGCCGUCCACGCCA 
Iµµ+µµµµtctµAµSerµIGAµRattus norvegicusµcytosolic µ-GUAGUCGUGGCMGAGD--#GDD-AAGGCRAPGGA'UIGA+AZCCAUJ-GGGG---U'U-----CCCCG-?GCAGGTPCG"AUCCUGCCGACUACGCCA 
Iµµ+µµµµtctµAµSerµIGAµRattus norvegicusµcytosolic µAGUAGUCGUGGCMGAGD--GGDD-AAGGCRAPGGA'UIGA+AZCCAUJ-GGGG---U'U-----CCCCG-?GCAGGTPCG"AUCCUGCCGACUACGCCA 
Iµµ+µµµµtctµAµSerµIGAµSaccharomyces cerevisiaeµcytosolic µ-GGCAACUUGGCMGAGD--#GDD-AAGGCRAAAGAPUIGA+APCUUUJ-GGGC---UCU-----GCCCG-?GCAGGTPCAAAUCCUGCAGUUGUCGCCA 
Iµµ+µµµµtctµAµSerµIGAµSaccharomyces cerevisiaeµcytosolic µ-GGCAACUUGGCMGAGD--#GDD-AAGGCRAAAGAPUIGA+APCUUUJ-GGGC---UUU-----GCCCG-?GCAGGTPCGAGUCCUGCAGUUGUCGCCA 
Iµµ+µµµµtctµAµSerµIGAµSpinacia oleraceaµcytosolic µ-GUGGACGUGCCGGAGD--#GDD-AUCGGRCAUGA'UIGA+APCAUGJ-GGGC---UUU-----GCCCG-CGCAGGTPCG"AUCCUGCCGUCCACGCCA 
UµµHµµµµtcaµUµSerµUGAµGallus gallusµcytosolic µ-AAGAAAGA"LCAUUAAGUGGDUUGAUGCLGPUGG'UUGAHACCAACAU-------------------G-UGAGGGTPCG"UUCCUUCCUUUCUUGCCA 
UµµAµµµµtcaµUµSerµUGAµHomo sapiensµcytosolic µ-GUAGUCGUGGCMGAGD--#GDD-AAGGCGAPGGACUUGAAAPCCAUJ-GGGG---U'U-----CCCCG-?GCAGGTPCG"AUCCUGCCGACUACGCCA 
&µµ+µµµµtcaµUµSerµUGAµSaccharomyces cerevisiaeµcytosolic µ-GGCACUAUGGCMGAGD--#GDD-AAGGCRACAGA'U&GA+APCUGUJ-GGGC---UCU-----GCCCG-?GCUGGTPCAAAUCCUGCUGGUGUCGCCA 
Iµµ6µµµµactµAµThrµAGUµSaccharomyces cerevisiaeµcytosolic µ-GCUUCUAUGLCCAAGDD-GGD--AAGGCRCCACA'UIGU6APGUGGAG-------------------AD?AUCGGTPCA"AUCCGAUUGGAAGCACCA 
Iµµ6µµµµactµAµThrµAGUµSaccharomyces cerevisiaeµcytosolic µ-GCUUCUAUGLCCAAGDD-GGD--AAGGCRCCACA'UIGU6APGUGGAG-------------------AD?GUCGGTPCA"AUCCGACUGGAAGCACCA 
Iµµ6µµµµactµAµThrµIGUµBos taurusµcytosolic µ-GGCCCUGUKLCUAGCD--GGDC-AAAGCRCCUGU'UIGU6AACAGGAG-------------------AD?CUGGGUPCG"AUCCCAGCGGGGC?UCCA 
BµµKµµµµtggµCµTrpµBCAµBos taurusµcytosolic µ-GACCUCLUKLCGCAAD--#GD--AGCGCRPCUGABUBCAKAZCAGAAG-------------------7DUGCGUGPPCG"AUCACGUCGGGGUCACCA 
BµµKµµµµtggµCµTrpµBCAµGallus gallusµcytosolic µ-GACCUCGUKLCGCAAC--#GD--AGCGCRPCUGABUBCAKAZCAGAAG-------------------7CUGCGUGPPCG"AUCACGUCGGGGUCACCA 
BµµKµµµµtggµCµTrpµBCAµNicotiana tabacumµcytosolic µ-GGAUCCGUKGCGCAAD--#GD--AGCGCGPCUGABUBCAKAZCAGAAG-------------------GDNGCGUGTPCG"UUCACGPCGGGUUCACCA 
BµµKµµµµtggµCµTrpµBCAµTriticum aestivumµcytosolic µ-GGANCCGUKLCGCAADD-#GD--AGCGCRPCUGABUBCAKAZCAGAAG-------------------GDUGCGUGTPCG"UUCACGPCGGGUCCACCA 
BµµAµµµµtggµCµTrpµCCAµSaccharomyces cerevisiaeµcytosolic µ-GAAGCGGUKLCUCAAD--#GD--AGAGCPPPCGABUBCAAAPCGAAGG-------------------7DUGCAGGTPCA"UUCCUGPCCGUUUCACCA 
9µµKµµµµtacµGµTyrµ9PAµBos taurusµcytosolic µ-CCUUCLAUALCUCAGDD-GGXU-AGAGCRRAGGACU9PAKAZCCUUAG-------------------7D?GCUGGTPCG"UUCCGGCUCGAAGGACCA 
9µµKµµµµtacµGµTyrµ9PAµHomo sapiensµcytosolic µ-CCUUCLAUALCUCAGDD-GGX--AGAGCRRAGGACU9PAKA]CCUUAG-------------------7D?GCUGGTPCG"UUCCGGCUCGAAGGACCA 
9µµKµµµµtacµGµTyrµ9PAµHomo sapiensµcytosolic µ-CCUUCLAUALCUCAGCD-GGX--AGAGCRRAGGACU9PAKA]CCUUAG-------------------7D?GCUGGTPCG"UUCCGGCUCGAAGGACCA 
GµµKµµµµtacµGµTyrµGPAµLupinus albusµcytosolic µ-CCGACCUUALCUCAGDD-#GU--AGAGCRGAGGACUGPAKAPCCUUAG-------------------7XCACUGGUPCG"AUCCGGUAGGUCGGACCA 
GµµKµµµµtacµGµTyrµGPAµLupinus luteusµcytosolic µ-CCGACCUUALCUCAGDD-#GU--AGAGCRGAGGACUGPAKAPCCUUAG-------------------7XCACUGGUPCG"AUCCGGUAGGUCGGACCA 
GµµKµµµµtacµGµTyrµGPAµNicotiana rusticaµcytosolic µ-CCGACCUUALCUCAGDD-#GU--AGAGCRGAGGACUGPAKAPCCUUAG-------------------7UCACUGGUPCG"AUCCGGUAGGUCGGACCA 
GµµKµµµµtacµGµTyrµGPAµNicotiana rusticaµcytosolic µ-CCGACCUUALCUCAGDD-#GU--AGAGCRGAGGACUGPAKAPCCUUAG-------------------7UCGCUGGUPCG"AUCCGGCAGGUCGGACCA 
Gµµ+µµµµtacµGµTyrµGPAµPichia jadiniiµcytosolic µ-CUCUCGGUKLCCAAGDD-#GDDDAAGGCRPCAGACUGPA+APCUGAAC-------------------AD?GGGCGTPCG"AUCGCCCCCGAGAGACCA 
GµµKµµµµtacµGµTyrµGPAµScenedesmus obliquusµcytosolic µ-CCCCUUGUAGCUCAGDD-#GC--AGAGCRGGAGACUGPAKAPCUCUAG-------------------7.CACUGGTPCG"AUCCGGUCGAGGGGACCA 
Gµµ+µµµµtacµGµTyrµGPAµSchizosaccharomyces pombeµcytosolic µ-CUCCUGAUKGUGPAGDD-GGDD-AUCACACCCGGCUGPA+ACCGGUUG-------------------7U?GCUAGTPCG"UUCUGGCUCAGGAGACCA 
GµµKµµµµtacµGµTyrµGPAµTriticum aestivumµcytosolic µ-CCGACCUUALCUCAGDD-#GU--AGAGCRGAGGACUGPAKAPCCUUAG-------------------7UCACUGGUPCG"AUCCGGUAGGUCGGACCA 
Gµµ+µµµµtacµGµTyrµGUAµSaccharomyces cerevisiaeµcytosolic µ-CUCUCGGUALCCAAGDD-#GDDDAAGGCRCAAGACUGPA+APCUUGAG-------------------AD?GGGCGTPCG"CUCGCCCCCGGGAGACCA 
QµµKµµµµtacµGµTyrµQPAµDrosophila melanogasterµcytosolic µ-CCUUCGAUALCUCAGDD-GGX--AGAGCRGPGGACUQPAKAJCCAUAG-------------------7DCGCUGGTPCA"AUCCGGCUCGAAGGACCA 
QµµKµµµµtacµGµTyrµQPAµTriticum aestivumµcytosolic µ-CCGACCUUALCUCAGDD-#GU--AGAGCRGAGGACUQPAKAPCCUUAG-------------------7UCACUGGUPCG"AUCCGGUAGGUCGGACCA 
.µµAµµµµgt.µµValµ.ACµHomo sapiensµcytosolic µ-GUUUCCGUAGUGPAGD--GGDD-AUCACLPUCGCCU.ACACGCGAAAG-------------------7D??CCGGUPCG"AACCGGGCGGAAACACCA 
.µµAµµµµgt.µµValµ.ACµRattus norvegicusµcytosolic µ-GUUUCCGUAGUGPAGD--#GDD-AUCACLPUCGCCU.ACA?GCGAAAG-------------------7D??CCGGUPCG"AACCGGGCGGAAACACCA 
IµµAµµµµgttµAµValµAACµSaccharomyces cerevisiaeµcytosolic µ-GGUUUCGUKGUCPAGDC-GGDD-AUGGCAPCUGCPUIACACGCAGAAC-------------------7DC?CCAGTPCG"UCCUGGGCGAAAUCACCA 
CµµAµµµµgtg µCµValµCACµDrosophila melanogasterµcytosolic µ-GUUUCCGUAGUGPAGC--GGDX-AUCACGPGUGCUUCACACGCACAAG-------------------7DCCCCGGTPCG"ACCCGGGCGGGAACACCA 
CµµAµµµµgtg µCµValµCACµSaccharomyces cerevisiaeµcytosolic µ-GUUCCAAUALUGPAGC--GGCD-AUCACLPPGCCPUCACACGGCAAAG-------------------7DC?CGAGTPCG"UCCUCGGUUGGAACACCA 
IµµAµµµµgttµAµValµIACµDrosophila melanogasterµcytosolic µ-GUUJCCGUKGUGPAGC--GGDX-AUCACAPCUGCBUIACA?GCAGAAG-------------------7CC<CCGGTPCG"UCCCGGGCGGAAACACCA 
IµµAµµµµgttµAµValµIACµLupinus luteusµcytosolic µ-GGUUUCGUKGUGPAGD--GGDD-AUCACRPCAGUCUIACACACUGAAG-------------------7DCUCCGGTPCG"GUCCGGGCGAAGCCACCA 
IµµAµµµµgttµAµValµIACµMus musculusµcytosolic µ-GUUUCCGUAGUGPAGD--GGDD-AUCACLPUCGCBUIACA?GCGAAAG-------------------7D??CCGGUPCG"AACCGGGCGGAAACACCA 
IµµAµµµµgttµAµValµIACµOryctolagus cuniculusµcytosolic µ-GUUUCCGUAGUGPAGD--GGDD-AUCACLPUCGCBUIACA?GCGAAAG-------------------7D??CCGGUPCG"AACCGGGCGGAAACACCA 
IµµAµµµµgttµAµValµIACµPichia jadiniiµcytosolic µ-GGUUUCGUKGUCPAGDD-GGDC-AUGGCAPCUGCPUIACACGCAGAAC-------------------7DC?CCAGTPCG"UCCUGGGCGAAAUCACCA 
IµµAµµµµgttµAµValµIACµRattus norvegicusµcytosolic µAGUUUCCGUAGUGPAGD--GGDD-AUCACLPUCGCBUIACA?GCGAAAG-------------------7D??CCGGUPCG"AACCGGGCGGAAACACCA 
NµµAµµµµgtaµUµValµNACµDrosophila melanogasterµcytosolic µ-GGUJCCAUAGUGPAGC--GGDN-AUCAC;PCUGCPUNACACGCAGAAG-------------------7D?UCCGGTPCG"UCCCGGAUGGAACCACCA 
&µµAµµµµgtaµEucaryµValµUACµSaccharomyces cerevisiaeµcytosolic µ-GGUCCAAUGLUCCAGD--GGDDCAAGACRPCGCCPU&ACACGGCGAAG-------------------ADC?CGAGTPCG"ACCUCGGUUGGAUCACCA 
Gµµ6µµµµµmitoµAspµGUCµAedes albopictusµmitochondrial µ-AAAAAAUU"GUUUAAU--CA---AAAACCPPAGUAUGUC6AACUAAAA-------------------A-AAUUAGAUCAU--CUAAUAPPUUUUACCA 
Nµµ6µµµµµmitoµGluµNUCµAedes albopictusµmitochondrial µ-AUUUAUAU"GUUUAA---AU---AAAACAPPACAUUNUC6CUGUAAAA-------------------A-UAAAA-AUUUAU--UUUUPAUAAAUACCA 
UµµAµµµµµmitoµGlyµUCCµAedes albopictusµmitochondrial µ-AUUUAUAU"GUAUAUA--AU---UGUAUAPGN;ACUUCCAA]CACAAG-------------------G-ACUAA-AUAAUU--UUAGUAPAAAUACCA 
Gµµ6µµµµµmitoµIleµGAUµAedes albopictusµmitochondrial µ-AAUGAAUUKCCUGAU---AA---AAAGGAPPACCUUGAU6GGGUAAAU-------------------UAUAAAGAUUUAAU-ACUUPAPUCAUUACCA 
Cµµ6µµµµµmitoµLysµCUUµAedes albopictusµmitochondrial µ-CAUUAGAUKACUGAA---AG---CAAGUAAPGAUCUCUU6AAUCAUAA-------------------UAUAGUAAAUUAGC_UUACPPCUAAUGACCA 
NµµAµµµµµmitoµGlnµNUGµAedes albopictusµmitochondrial µ-UAUAUUUU"GUGUAU---GA---UGCACAAAAGPUUNUGAAACUUUUA-------------------G-AAAUAGUUUAAUUCUAUUAAAUAUAACCA 
Gµµ6µµµµµmitoµSerµGCUµAedes albopictusµmitochondrial µ-GAAAUAU--GUU-----GA--UC--AAG-AAAAGCUGCU6ABUPUUUCUU------------------UAAUGGUUUAAUUCCAUPAUAUUUCU-CCA 
Uµµ6µµµµµmitoµValµUACµAedes albopictusµmitochondrial µ-CAAUUUAA"LCUUAAUU-AGU--AAAGUAPPUCAUUUAC6PPGAAAAG-------------------A-AAUUUGUGCAAAUCAAUPPAAAUUGACCA 
Cµµ6µµµµµmitoµIniµCAUµAedes albopictusµmitochondrial µ-AAAAAGAU"AGCUAA---UU---AAGCUAPPGGGUUCAU6CCCCACUU-------------------A-UAAAGGUAAUAAUCCUUPPCUUUUUACCA 
GµµKµµµµµmitoµPheµGAAµAscaris suumµmitochondrial µ-ACUCUGUU"GUUUAUGU-UUU--AAAAPAPGACPPUGAAKAAGUUGGA-------------------A-AA----UG---------UUAGGAGUGCCA 
>µµAµµµµµmitoµMetµ>AUµAscaris suumµmitochondrial µ-AAPAAGAU"GGAUAA---GUUG-AGUCULPGAGGUU>AUACCCUCUUG-------------------G-UG----UUUUU------CUCUUAPUGCCA 
AµµKµµµµµmitoµArgµACGµAscaris suumµmitochondrial µ-GGACGUU""AUAGAU---AA---GCUAPGCCPAGPUACGKPCPGGGAA-------------------G-AG---------------AGUCGPCUUCCA 
Uµµ6µµµµµmitoµSerµUCUµAscaris suumµmitochondrial µ-GACAAAUG-----------------UUUPCAGGUCUUCU6AAPCUGUUUU--------------------GGA--GAAA-----UCCGPUUGUUUCCA 
!µµKµµµµµmitoµGluµ!UCµAscaris suumµmitochondrial µ-GAGAUAUU"GUAUAAAUUUUU--UGUAPAPUPCUPU!UCKAAGAAAAG-------------------G-U-----UUA---------UUAUCPUACCA 
!µµ6µµµµµmitoµLysµ!UUµAscaris suumµmitochondrial µ-GGGGUGUU"ACUUAAGUUU----AAAGPRPPAGAUU!UU6APCUGGAA-------------------A-UGG---GUUG------UCACAPCCUGCCA 
!µµKµµµµµmitoµGlnµ!UGµAscaris suumµmitochondrial µ-UAUACUUU"GUUUAGGA------AGAAUAPUUAPPU!UGKPGPAAAAG-------------------G-G-----UUG---------UAGUAPAGCCA 
$µµ*µµµµµmitoµTrpµ$CAµAscaris suumµmitochondrial µ-ACAGAUUU"AGUUAAGUUU----AAACUCPPGGPPU$CA*AACCAAAA-------------------A-U-----UUU---------ACUCPGUACCA 
$µµKµµµµµmitoµLeuµ$AAµAscaris suumµmitochondrial µ-GPUGUUAU"GCAUAAGA------AGUGCAPPUGPPU$AAKCGPAAAAG-------------------A-U-----AUG---------GGACAACUCCA 
QµµAµµµµµmitoµAspµQUCµAsterias amurensisµmitochondrial µ-AAGAAACU"GUUAAACUA-----AUAACACUGGAUUQUCAGACCGGAG--------------------UAACUGGUAAACAAUCAGUGUUUCUUGCCA 
QµµKµµµµµmitoµHisµQUGµAsterias amurensisµmitochondrial µGACUAAAGU"GUUUAAAU------AAAACCCPAAUPUQUGKPAUUAAAA--------------------UUAUCAGUPAA"AUCUGAUCUAUAGUCCCA 
Cµµ6µµµµµmitoµLysµCUUµAsterias amurensisµmitochondrial µ-CUUUGAUA"GCUUAUAAUGG---CAAGCAPUAAACUCUU6APUUAAAU-------------------CAAAGUGAUCUCACCACACUAUCAAAGACCA 
Gµµ+µµµµµmitoµAsnµGUUµAsterias amurensisµmitochondrial µ-UGAGUUGU"LCCUAGU--GGA--AAGGCGPPUGGCCGPU+ACPAAAAG-------------------AUAGCAAGAUCA"UACUUGCCAGCUCAGCCA 
Gµµ6µµµµµmitoµAsnµGPUµAsterias amurensisµmitochondrial µ-UGGGUUGU"GCCUAAU--GGA--AAGGCAAPUGGCCGPU6ACCAGGAG-------------------AUAACAAGAUCA"UACUUGUCAACUCAGCCA 
Gµµ*µµµµµmitoµTyrµGUAµAsterias amurensisµmitochondrial µ-GGCAGGGUKGCAGAA"--GUD--AAUGCACPAAAPUGUA*AUPUAUAA--------------------AUAAAGGUPUAAUUCCUUUUCUUGCCACCA 
∃µµAµµµµµmitoµGluµ∃UCµBos taurusµmitochondrial µ-GUUCUUGU"GUUGAA---UG---ACAACLAPGGUUU∃UCAUAPCAUUA-------------------G-U?AUGGUPAG"UUCCAUGUAAGAAUACCA 
GµµAµµµµµmitoµPheµGAAµBos taurusµmitochondrial µ-GUUGAUGU"LCUU-AA--CCC--AAAGCAAGGCACUGAAAAPGCCUAG-------------------A-UGAGU-CUCCCA--ACUCCAUAAACACCA 
UµµAµµµµµmitoµGlyµUCCµBos taurusµmitochondrial µ-AUUCUUUU"LUAUUAA--CU---AGUACAGCUGACUUCCAAPCAGCUA-------------------G-UUUCGGUCUAGU-CCGAAAAAGAAUACCA 
Gµµ6µµµµµmitoµIleµGAUµBos taurusµmitochondrial µ-AGAAAUAUKUCUGACA-------AAAGARPUACAUUGAU6GUGUAAAU-------------------AAUAGAGGUUCA"ACCCUCUUAUUUCUACCA 
∃µµ6µµµµµmitoµLysµ∃UUµBos taurusµmitochondrial µ-CACUAAGA"LCUAU---------AUAGCACPAACCU∃UU6AGUUAGAG-------------------AUUGAGAGCCAU"UACUCUCCUUGGUGACCA 
ʵµAµµµµµmitoµLeuµÊAAµBos taurusµmitochondrial µ-GUUAAGGUKLCAGAGCCCGGDA-AUUGCAPAAAACUÊAAACPUUUAUA-------------------UC?AGAGAUUCA"AUCCUCUCCUUAACACCA 
UµµKµµµµµmitoµLeuµUAGµBos taurusµmitochondrial µ-ACUUUUAA"LGAUAGU--AGDUU-AUCCLPPGGPCUUAGKAACCAAAA---------------------AAUUGGUGCAACUCCAAAUAAAAGUACCA 
UµµAµµµµµmitoµArgµUCGµBos taurusµmitochondrial µ-UGGUACUU"GUUUAA---AAU--AAAAUAAAUGAUUUCGACPCAUUAG-------------------A-UUAUGAUUUAAU-UCAUAAUUACCAACCA 
Gµµ6µµµµµmitoµSerµGCUµBos taurusµmitochondrial µ-GAAAAAG-U----------------AUGCAAGAACUGCU6AUUC_UGCUC--------------------?CAUAUCUAAU_UAUGGCUUUUUCGCCA 
Uµµ+µµµµµmitoµSerµUGAµBos taurusµmitochondrial µ-GAGAGAG-A-CAUAGA--GGD--UAUGAPGPPGG'UUGA+ACCAAUAG-------------------U-AGGGGGUPCG"UUCCUUCCUUUCUUACCA 
Uµµ6µµµµµmitoµThrµUGUµBos taurusµmitochondrial µ-GUCUUUGU"GUACAU---CU---AAUAUACUGGU'UUGU6AACCAGAG-------------------A-AGGAGAACAACU_CCUCCCPAAGA?UCCA 
UµµAµµµµµmitoµValµUACµBos taurusµmitochondrial µ-CAAGAUAU"LCUUAA---AC---AAAGCAPCCAGUUUACACCUAGAAG-------------------A-CUUCA-UUCAUUA-UGAAUAUCUUGACCA 
ʵµ*µµµµµmitoµTrpµÊCAµBos taurusµmitochondrial µ-AGGAAUUU"LGUUAA---AC---AGACCAAGAGCCUÊCA*AGCCCUAA-------------------G-?AAGUACAAUU--UACUUAAUUCCUGCCA 
>µµAµµµµµmitoµIniµ>AUµBos taurusµmitochondrial µ-AGUAAGGUCAGCUAAUU------AAGCUAPCGGGCC>AUACCCCGAAA-------------------A-UGPUGGUUUAUAUCCUUCCCGUACUACCA 
UµµAµµµµµmitoµAlaµUGCµBos taurusµmitochondrial µ-GAGGAUUU"LCUUAA---UU---AAAGULGPUGAUUUGCAUPCAAUUG-------------------A-UGUAAGGUGPAGUCUUGCAAUCCUUACCA 
Gµµ+µµµµµmitoµCysµGCAµBos taurusµmitochondrial µ-AGCCCUGUKGUGAAUU-------UACACGPPGAAPUGCA+APUCAGAG-------------------A-AGCAGCUUCA"U-UCUGCCGGGGCUUCCA 
QµµAµµµµµmitoµAspµQUCµBos taurusµmitochondrial µ-GAGGULUU"GUAAAAC-------AUUAUAPAAUPUUQUCAAAGUUAAG-------------------U-UACAAGUGAAAGUCCUGUACACCUCACCA 
QµµAµµµµµmitoµHisµQUGµBos taurusµmitochondrial µGGUAAAUAU"LUUUAA---CA---AAAACAPUAGAUUQUGAAPCUAACA-------------------A-UAGAAACUCAUU_CUUCUUAUUUACCCCA 
Qµµ6µµµµµmitoµAsnµQUUµBos taurusµmitochondrial µ-UAGAUUGA"LCCAGUU--AGCU-AGGGUGPPUAGCUQUU6ACUAAAGU-------------------UU?GUGGGGGUGGAGCCCACCAGUCUAGCCA 
UµµKµµµµµmitoµProµUGGµBos taurusµmitochondrial µ-CAGGGAAU"LUUUAA---AU---AGAACUPCAGCUUUGGKGGUUGAUG-------------------G-UGAGAC-UGCA--GUUUCUUCCUUGACCA 
Qµµ*µµµµµmitoµTyrµQUAµBos taurusµmitochondrial µ-GGUAAAAUKLCUGAGC-------AAAGCAUPAGACUQUA*APCUAAAG-------------------A-UAGAGGUPUGACUCCUCUUUUUACCACCA 
∃µµKµµµµµmitoµGlnµ∃UGµBos taurusµmitochondrial µ-UAGAAUUUKGUGUAAUU-GGG--AGCACGAAGAGUU∃UGKAPPCUUAG-------------------G-AGUAGGUPCGAUUCCUAUAGUUCUAGCCA 
QµµAµµµµµmitoµAspµQUCµDidelphis virginianaµmitochondrial µ-AAGAUAUU"LUAAAA---UUC--AUUACAPAACUPUQUCAUAGUUAAA-------------------U-UAUAGGUPUAACUCCUAUAUAUCUUACCA 
>µµAµµµµµmitoµMetµ>AUµGallus gallusµmitochondrial µ-AGUAAGGUCAGCUAA---CU---AAGCUAPCGGGCC>AUACCCCGAAA-------------------A-UGAUGGTPUAACCCCUUCCCCUACUACCA 
ʵµAµµµµµmitoµGlyµÊCUµHalocynthia roretziµmitochondrial µ-GCGUULAU"GUUUAA---GU---AAAAUAGAUUCUUÊCUAGGPAUAAG---------------------UUAGGGUUGG---UCCCUUUGAUGCACCA 
UµµAµµµµµmitoµGlyµUCCµHalocynthia roretziµmitochondrial µ-GCUGUGUU"GUAUAAA--GU---AAUAPAPGUGAPUUCCAAPCAUGGG---------------------AUCCUU-------UAGGGACGUAGUACCA 
GµµAµµµµµmitoµSerµGCUµHalocynthia roretziµmitochondrial µ-AAGGGUGAUUAGGAA---------UGUUAGAAAGPUGCUAPPUUUUUG-------------------AUAUPGAGUUCGAAUCUCGAGGCUCUUGCCA 
ʵµUµµµµµmitoµMetµÊAUµHalocynthia roretziµmitochondrial µ-GGUAAUAU"LGUUAAUA--U---AAACCAGAAAGUUÊAUUPCUUUCUA-------------------A-UAACGAA-------UGPUUAUUACUUCCA 
ʵµ*µµµµµmitoµTrpµÊCAµHalocynthia roretziµmitochondrial µ-AGGAGAUU"LUUUAAGU--U---AAAUCAAUUGUUUÊCA*AACAGUAG-------------------U-UAUAUAGAAUGAUUAUAUAUUUCCUGCCA 
CµµKµµµµµmitoµMetµCAUµHalocynthia roretziµmitochondrial µ-ACAACAGU"AACUAUGAA-AA--AGUUUGUGGGGUUCAUKGUCCUGAU----------------AAUGUGAUAUUAAAAUAUAUUGCCUGUUGAACCA 
Gµµ6µµµµµmitoµIleµGAUµHomo sapiensµmitochondrial µ-AGAAAUAUKUCUGAUA-------AAAGARPPACUUUGAU6GAGUAAAU-------------------AAUAGGAGCUUAAACCCCCUUAUUUCUACCA 
ʵµAµµµµµmitoµLeuµÊAAµHomo sapiensµmitochondrial µ-GUUAAGAUKLCAGAGCCCGGDA-AUCGCAPAAAACUÊAAAACUUUACA-------------------GU?AGAGGTPCA"UUCCUCUUCUUAACACCA 
Gµµ6µµµµµmitoµSerµGCUµHomo sapiensµmitochondrial µ-GAGAAAG-C----------------UCACAAGAACUGCU6ACUCAUGCCC--------------------CCAUGUCUA"C_CAUGGCUUUCUCACCA 
∃µµ6µµµµµmitoµLysµ∃UUµHomo sapiensµmitochondrial µ-CACUGUAA"LCUAAC--------UUAGCAPPAACCU∃UU6AGUUAAAG-------------------AUUAAGAGAACCAA_CUCUUUACAGUGACCA 
UµµKµµµµµmitoµProµUGGµHomo sapiensµmitochondrial µ-CAGAGAAU"GUUUAAA--UU---AGAAUCPPAGCPUUGGKPGCUAAUG-------------------G-UGGAG-TPAAAGA-CUUUUUCUCUGACCA 
QµµAµµµµµmitoµAspµQUCµHomo sapiensµmitochondrial µ-AAGGUAUU"LAAAAA---CC---AUUUCAPAACUUUQUCAAAGUUAAA-------------------U-UAUAGGCUAAAU-CCUAUAUAUCUUACCA 
UµµKµµµµµmitoµLeuµUAGµHomo sapiensµmitochondrial µ-ACUUUUAA"LGAUAAC--AGC--UAUCCAPPGGPCUUAGKCCCCAAAA-------------------A-UUUUGGUGCAACUCCAAAUAAAAGUACCA 
>µµAµµµµµmitoµMetµµHomo sapiensµmitochondrial µ-AGUAAGGUCAGCUAAAU------AAGCUAPCGGGCC>AUACCCCGAAA-------------------A-UGPUGGUUAUAC-CCUUCCCGUACUACCA 
.µµ.µµµµµmitoµLysµ.UUµLoligo bleekeriµmitochondrial µ-GCCUCCAUALCUCAGDC-GGU--AGAGCAPCAGACU.UU.ANCUGAGG-------------------7D?UGGGGUPCG"GUCCCCAULUGGG?UCCA 
Cµµ6µµµµµmitoµLysµCUUµLoligo bleekeriµmitochondrial µ-UCCCGLCUALCUCAGDC-GGU--AGAGCACGAGA<UCUU6APCUCGGG-------------------7D?GUGGGTPCG"GCCCCACGUUGGGAGCCA 
.µµAµµµµµmitoµLysµ.UUµLoligo bleekeriµmitochondrial µ-GCCUUCAUALCUCAGDC-GGU--AGAGCAPCAGACU.UUAANCUGAGG-------------------7D?UGGGGTPCG"GUCCCCAULCGGG?UCCA 
7µµ6µµµµµmitoµSerµ7CUµLoligo bleekeriµmitochondrial µ-AAAGGUAAUUAGGAA---------UAAAAPAAAGCU7CU6ACPUUAUU------------------UUGAGCAACUCAAAACUGUUCUACCUUUUCCA 
GµµAµµµµµmitoµAspµGUCµMesocricetus auratusµmitochondrial µ-AAGAUAUU"GUAAAA---UC---AUUACAPAACUUUGUCAGAGUUAAA-------------------U-UAUAGACUAAUC-UCUAUAUAUCUUACCA 
Nµµ6µµµµµmitoµLysµNUUµMesocricetus auratusµmitochondrial µ-CACUAUGA"LCUC----------AGAGCLPUAACCUNUU6AGUUAAAA-------------------U-UGAGAGACUUCUAGUCUCCAUGGUGACCA 
UµµAµµµµµmitoµArgµUCGµMesocricetus auratusµmitochondrial µ-UGGUGAUU"GUUUAA---CU---AAAAUUAAUGAPUUCGACPCAUUAG-------------------A-UUAUGACAUAUC-UCAUAAUCACCAACCA 
Gµµ6µµµµµmitoµSerµGCUµMesocricetus auratusµmitochondrial µ-GAGAAUG-U----------------AUGCAAGAGCUGCU6ACUCCUGCUA--------------------CCAUGUAUAAU_CAUGGCUUUCUUACCA 
UµµUµµµµµmitoµAlaµUGCµNeurospora crassaµmitochondrial µ-GGGGGUAUAGUAUAADU-GGD--AGUACAGCAAUCUUGCUCANUGCUU-------------------G-U?AAGGTPCAAAUCCUUGUAUCUCCACCA 
NµµAµµµµµmitoµLeuµNAAµNeurospora crassaµmitochondrial µ-AUCCGAGUGAUGGAAD--GGDA-GACAUAACAUGCUNAAAACAUGUG-GGCU---UCA-----AGCUG-UGAAGGTPCAAGUCCUUCUUCGGAUACCA 
UµµKµµµµµmitoµLeuµUAGµNeurospora crassaµmitochondrial µ-AUAGGUGUGCUGGAADU-GGDA-GACAGGUUCCGPUUAGKCCGGAAU-GGUUU--AA-----AAACUG-UACAAGTPCAAGUCUUGUCAUCUAUACCA 
Uµµ6µµµµµmitoµThrµUGUµNeurospora crassaµmitochondrial µ-GCCUGGUUAGCAUAAA--AGD--AAUGCAAUUGPUUUGU6APCAAUAG-------------------A-AGCAAGTGCGAUACUUGCACUGGGCUCCA 
UµµAµµµµµmitoµValµUACµNeurospora crassaµmitochondrial µ-GAGAGAUUAGCUCAGUU-GGD--AGAGCAACCGUUUUACACACGGAAG-------------------GUUGGGUGTPCGAAUCACCCAUUUCUCACCA 
NµµHµµµµµmitoµTrpµNCAµNeurospora crassaµmitochondrial µ-AAGAGUAUAGUUUAAU--GGD--AAAACAGAAAGCUNCAHCCUUUAAA-------------------U-UCUUAGTPCGAGUCUAAGUACUCUUGCCA 
CµµKµµµµµmitoµIniµCAUµNeurospora crassaµmitochondrial µ-UGCGGAUUAUUGUAAD--AGD--AACAUAUUUGGCUCAUKPCCGAAUG-------------------A-CAUAGGUGCAAAUCCUGUAUCCGCAUCCA 
GµµHµµµµµmitoµTyrµGUAµNeurospora crassaµmitochondrial µ-AGGAGGGUUCCGUUUGUUGGDAUGACGGRPUAAGCUGUAHACUUAAU-GACUA--AU-----UAGU?GU<GAAGGTPCAAUUCCUUUCUCUCCUACCA 
GµµHµµµµµmitoµPheµGAAµOenothera sp.µmitochondrial µ-GUUUAGGUAGCUCAUCD-GGCD.AGAGCAAAGGACUGAAHAUCCUUGU-------------------7XCAGUGGTPCGAAUCCACUUCUAAGCACCA 
Gµµ.µµµµµmitoµPheµGAAµPhaseolus vulgarisµmitochondrial µ-GUUUAGGUAGCUCAGCD-#GD--AGAGCAAAGGACUGAA.APCCUUGU-------------------7XCAGUGGTPCGAAUCCACUUCUAAGCGCCA 
.µµKµµµµµmitoµLeuµ.AAµPhaseolus vulgarisµmitochondrial µ-GUCAGGAUGLCMGAGD--#GDCXAAGGCRCCAGACU.AAKPPCUGGJ-CUUC---GAGA----GAGGG-?GUGGGTPCA"AUCCCACUUCUGACACCA 
.µµKµµµµµmitoµLeuµ.AAµPhaseolus vulgarisµmitochondrial µ-GUCAGGAUGLCMGAGD--#GDCXAAGGCRCCAGACU.AAKPPCUGGJ-CUUC---GAAA----GAGGG-?GUGGGTPCA"AUCCCACUUCUGACACCA 
.µµKµµµµµmitoµLeuµ.AGµPhaseolus vulgarisµmitochondrial µ-GAUAGUUUGLCMGAGD--#GDCXAAGGCRCCAGAPU.AGKCPCUGGJ-CCG----AAA------.GGG-?GUGGGTPCA"AUCCCACAGCUGUCACCA 
.µµKµµµµµmitoµLeuµ.AAµPhaseolus vulgarisµmitochondrial µ-GCUGGUUUGGCMGAGA--#GDD-AAGGCRGAAGACU.AAKAPCUUCJ-GCAG---UCAA----CUGCG-?AUGGGTPCG"ACCCCAUAGCCAGCACCA 
Cµµ=µµµµµmitoµMetµCAUµPhaseolus vulgarisµmitochondrial µ-ACCUACUUGACUCAGC--#GDD-AGAGUAPCGCPUUCAU=CGGCGAGA-------------------7XCAUUGGTPCAAAUCCAAUAGUAGGUACCA 
UµµKµµµµµmitoµProµUGGµPhaseolus vulgarisµmitochondrial µ-CGAGGUGUAGCGCAGUCD#GDC-AGCGCAUCUGUUUUGGKPACAGAGG-------------------7CCAUAGGTPCGAAUCCUGUCACCUUGACCA 
BµµHµµµµµmitoµTrpµBCAµPhaseolus vulgarisµmitochondrial µ-GCGCUCUUAGUUCAGUUC#GD--AGAACRCGGGPCUBCAHAACCCGAU-------------------7.CGUAGGTPCAAAUCCUACAGAGCGUGCCA 
CµµAµµµµµmitoµIniµCAUµPhaseolus vulgarisµmitochondrial µ-AGCGGGGUAGAGUAGUD-#GUD-AACUCAPCAGGCUCAUAAPCUGAAG-------------------AUDGCAGGTPCGAAUCCUGCCCCCGCCACCA 
.µµHµµµµµmitoµTyrµ.UAµPhaseolus vulgarisµmitochondrial µ-GGGAGAGUGGCCGAGD--#GDCAAAAGCLACAGACU.UAHAPCUGUU-GAAG---UU------UUUCUACGUAGGTPCGAAUCCUGCCUCUCCCACCA 
QµµAµµµµµmitoµAspµQUCµRattus norvegicusµmitochondrial µ-GAGAUAUU"GUAAAA---UA---AUUACAPAACCUUQUCAAGGUUAAG-------------------U-UAUAGACUUAAA-UCUAUAUAUCUUACCA 
GµµAµµµµµmitoµAspµGUCµRattus norvegicusµmitochondrial µAGAGAUAUU"GUAAAA---UA---AUUACAPAACCUUGUCAAGGUUAAG-------------------U-UAUAGACUUAAA-UCUAUAUAUCUUACCA 
Gµµ*µµµµµmitoµPheµGAAµRattus norvegicusµmitochondrial µAGUUAAUGU"GCUUAUA--AU---AAAGCAAAGCACUGAA*APGCUUAG-------------------A-UGGAU-UCAAAA--AUCCCAUAAACACCA 
Nµµ6µµµµµmitoµLysµNUUµRattus norvegicusµmitochondrial µ-CAUUGCGA"LCUU----------AGAGCLPUAACCUNUU6AGUUAAAG-------------------UUAGAGA-CAACAAA-UCUCCACAAUGACCA 
UµµKµµµµµmitoµLeuµUAGµRattus norvegicusµmitochondrial µ-ACUUUUAU"LGAUAGA--AGD--AAUCCAPUGGUCUUAGKAACCAAAA-------------------A-C?UUGGUGCAACUCCAAAUAAAAGUACCA 
UµµKµµµµµmitoµLeuµUAGµRattus norvegicusµmitochondrial µAACUUUUAU"LGAUAGA--AGD--AAUCCAPUGGUCUUAGKAACCAAAA-------------------A-C?UUGGUGCAACUCCAAAUAAAAGUACCA 
UµµKµµµµµmitoµLeuµUAGµRattus norvegicusµmitochondrial µAACUUGUAU"LGAUAGA--AGD--AAUCCAPUGGUCUUAGKAACCAAAA-------------------A-C?UUGGUGCAACUCCAAAUAAAAGUACCA 
UµµAµµµµµmitoµArgµUCGµRattus norvegicusµmitochondrial µAUGGUAAUU"GUUUAA---AU---AAAAUUAAUGAPUUCGACPCAUUAG-------------------A-UUAUGAUAAUAA-UCAUAAUUACCAACCA 
UµµAµµµµµmitoµValµUACµRattus norvegicusµmitochondrial µ-CAUAGUGU"LCUUAAUC-AC---AAAGCAPCUGGCCUACACCCAGAAG-------------------A-AUUCA-UAAAAA--UGAACACUUUGACCA 
UµµAµµµµµmitoµValµUACµRattus norvegicusµmitochondrial µACAGAUUGU"LCUUAAUC-AC---AAAGCAPCUGGCCUACACCCAGAAG-------------------A-AUUCA-UAAAAA--UGAACACUUUGACCA 
Nµµ*µµµµµmitoµTrpµNCAµRattus norvegicusµmitochondrial µAAGAAGUUU"GGAUAU---AC---AGUCCAAGAGCCUNCA*AGCCCUUA-------------------G-AAAAC-AAACAA--GUUUAACUUCUGCCA 
Gµµ6µµµµµmitoµIleµGAUµSaccharomyces cerevisiaeµmitochondrial µ-GAAACUAUAAUUCAADD-GGDU-AGAAUAGUAUPUUGAU6AGGUACAA-------------------A-UAUAGGTPCAAUCCCUGUUAGUUUCACCA 
!µµKµµµµµmitoµLeuµ!AAµSaccharomyces cerevisiaeµmitochondrial µ-GCUAUUUUGGUGGAADU-GGDA-GACACRAUACPCU!AAKAPGUAUU-ACU----UUAC-----AGUA-UGAAGGTPCAAGUCCUUUAAAUAGCACCA 
$µµ6µµµµµmitoµLysµ$UUµSaccharomyces cerevisiaeµmitochondrial µ-GAGAAUAUUGUUUAAD--GGD--AAAACAGPUGPCU$UU6AGCAACCC-------------------A-UGC_GGTPCAACUCCAGCUAUUCUCACCA 
Cµµ6µµµµµmitoµMetµCAUµSaccharomyces cerevisiaeµmitochondrial µ-GCUUGUAUAGUUUAADD-GGDU-AAAACAUUUGPCUCAU6AAUAAAUA-------------------AUGUAAGGTPCAAUUCCUUCUACAAGUACCA 
GµµAµµµµµmitoµSerµGCUµSaccharomyces cerevisiaeµmitochondrial µ-GGAAAAUUAACUADA---GGD--AAAGU_AUUAPPUGCUAAGUAAUU-GAAUU--GUA----AAUUCU-UAUGAGTPCGAAUCUCAUAUUUUCCGCCA 
Gµµ+µµµµµmitoµTyrµGUAµSaccharomyces cerevisiaeµmitochondrial µ-GGAGGGAUUUUCAAUGUDGGDAGUUGGALPUGAGCUGUA+ACUCAAU-GACU---UA------GGUCUUCAUAGGTPCAAUUCCUAUUCCCUUCACCA 
CµµKµµµµµmitoµIniµCAUµSaccharomyces cerevisiaeµmitochondrial µ-UGCAAUAUGAUGUAADU-GGDU-AACAUUUUAGGGUCAUKACCUAAUU-------------------A-UAUACGTPCAAAUCGUAUUAUUGCPACCA 
GµµKµµµµµmitoµPheµGAAµSaccharomyces cerevisiaeµmitochondrial µ-GCUUUUAUAGCUUAGD--GGD--AAAGCRAUAAAPUGAAKAPUUAUUU-------------------A-CAU_AGUPCGAUUCUCAUUAAGGGCACCA 
Nµµ+µµµµµmitoµGlyµNCCµSaccharomyces cerevisiaeµmitochondrial µ-AUAGAUAUAAGUUAAUD-GGD--AAACURGAUGPCUNCC+AACAUUGA-------------------A-UGCGAGTPCGAUUCUCGCUAUCUAUACCA 
GµµKµµµµµmitoµHisµGUGµSaccharomyces cerevisiaeµmitochondrial µGGUGAAUAUAUUUCAAD--GGD--AGAAAAPACGCPUGUGKPGCGUUAA-------------------A-UCUGAGTPCGAUUCUCAGUAUUCACCCCA 
UµµKµµµµµmitoµProµUGGµSaccharomyces cerevisiaeµmitochondrial µ-CAGAUAGAAGCCAAAA--GGD--CAGGCLCUUUCPUUGGKAGAAAGAC-------------------CUAGUUAGTPCGAGUCUAUCCUAUCUGACCA 
AµµAµµµµµmitoµArgµACGµSaccharomyces cerevisiaeµmitochondrial µ-AUAUCUUUAAUUUAAD--GGD--AAAAUAPUAGAAUACGAAPCUAAUU-------------------A-UAUAGGTPCAAAUCCUAUAAGAUAUUCCA 
Nµµ6µµµµµmitoµArgµNCUµSaccharomyces cerevisiaeµmitochondrial µ-GCUCUCUUAGCUUAAD--GGDU-AAAGCAPAAUACUNCU6APAUUAAU-------------------AUUCCAUGTPCAAAUCAUGGAGAGAGUACCA 
UµµKµµµµµmitoµSerµUGAµSaccharomyces cerevisiaeµmitochondrial µ-GGAUGGUUGACUGAGD--GGDUUAAAGULPGAUAPUUGAKCPAUCAU-UAGUCU-UUAU--UGGCUA--CGUAGGTPCAAAUCCUACAUCAUCCGCCA 
UµµKµµµµµmitoµSerµUGAµSaccharomyces cerevisiaeµmitochondrial µ-GGAUGGUUGACUGAGD--GGDUUAAAGULUGAUAPUUGAKCPAUCAU-UAGUCU-UUAU--UGGCUA--CGUAGGTPCAAAUCCUACAUCAUCCGCCA 
UµµKµµµµµmitoµThrµUAGµSaccharomyces cerevisiaeµmitochondrial µ-GUAAAUAUAAUUUAAD--GGD--AAAAULPAUGP_UUAGKPGCAUAUU-------------------A-UCUAAGTPCAAAUCUUAGUAUUUACACCA 
!µµHµµµµµmitoµTrpµ!CAµSaccharomyces cerevisiaeµmitochondrial µ-AAGGAUAUAGUUUAAD--GGD--AAAACAGUUGAPU!CAHAPCAAUCA-------------------U-UAGGAGTPCGAAUCUCUUUAUCCUUGCCA 
<µµAµµµµµmitoµIleµµSolanum tuberosumµmitochondrial µ-GGGCUUAUAGUUPAADD-#GDD-GAAACGPACCGCU<AUAACGGUGAU-------------------AUUGUAGGTPCGAGCCCUACUAAGCCUACCA 
.µµAµµµµµmitoµIleµ.AUµSolanum tuberosumµmitochondrial µ-GGGC_UAUAGUUPAADD-#GDD-GAAACGPACCGCU.AUAACGGUGAU-------------------AUUGUAGGTPCGAGCCCUACUAAGCCUACCA 
.µµKµµµµµmitoµLeuµ.AAµSolanum tuberosumµmitochondrial µ-GUCAGGAUGGCMGAGD--#GDCXAAGGCRCCAGACU.AAKUPCUGGJ-CUUC---GUAA----GAGGG-?GUGGGTPCA"AUCCCACUUCUGACACCA 
CµµPµµµµµmitoµMetµCAUµTetrahymena pyriformisµmitochondrial µ-GCUGCUU--GAA--U---GGD----UUC_GUGGGCUCAUPPCCCAUUA-------------------CUAUAAAGTPCGAUUCUUUAAAGCGGCCCCA 
GµµHµµµµµmitoµPheµGAAµTetrahymena pyriformisµmitochondrial µUGCUUAAGUALCUCAGU--GGD--AGAGCRUCAGGCUGAAHACCPGAAG-------------------GUCAUUGGUCCGAUUCCAUUCUUAGGCACCA 
QµµHµµµµµmitoµTyrµQUAµTetrahymena pyriformisµmitochondrial µ-GAGAUGGUGLCUGAGU--GGDD-AAAGCRGPAGACUQUAHAPCPAUJ-GGG----UA-------UCCGUCGUCGGTPCGAGUCCGAUCCAUCUCACCA 
!µµ+µµµµµmitoµTrpµ!CAµTetrahymena thermophilaµmitochondrial µ-GGGGGAAUALUUUAAU--GGD--AGAACAACGGUCU!CA+AAPCGUUA-------------------G-CGUGGGUUCGAUUCCUGCUUCUCUCGCCA 
NµµAµµµµµmitoµGluµNUCµChlamydomonas reinhardtiiµplastidic µ-GCCCCCAUCGUCUAGA--#GCCDAGGACACCUCCCUNUCACGGAGAAA-------------------A-?GCGGATPCGAAUUCCGCUGGGGGUACCA 
UµµKµµµµµmitoµLeuµUA7µChlamydomonas reinhardtiiµplastidic µ-GCCUUCGUGAUC-GGAAU#GDAGA-GAUCCUGGUCUUA7KAACCAGCUG------CUGAA------AGGCGGCGGTPCAAAUCCGCCCGAAGGCACCA 
UµµAµµµµµmitoµGlyµUCCµCodium fragileµplastidic µ-GCAGUACUGGUGUAAD--#GDD-AGCGCCUUAGAPUUCCAAPCUAAAG-------------------G-UAGGGGTPCGAUUCCCCUGUACUGCUCCA 
Nµµ6µµµµµmitoµLysµNUUµCodium fragileµplastidic µ-GGGUUACUAACUCAAD--#GD--AGAGUAAPCGGCUNUU6ACCGAUAA-------------------7DUCUGGGTPCAAUUCCCAGGUAACUCACCA 
CµµHµµµµµmitoµMetµCAUµCodium fragileµplastidic µ-GCCUAUUUALCUCAGDD-#GDD-AGAGCAPCCGPCUCAUHCGCGGGAA-------------------7DGACUAGTPCAAAUCUAGUAAUAGGCACCA 
IµµHµµµµµmitoµArgµICGµCodium fragileµplastidic µ-GGGUAUAUAACUCAGD--#GADUAGAGUPPAUGGCUICGHACCAUAAA-------------------7DCGGGGGTPCGAAUCCCUCUAUACUCACCA 
Gµµ*µµµµµmitoµPheµGAAµEuglena gracilisµplastidic µ-GCUGGGAUAGCUCAGDU-G#D--AGAGCGGAGGACUGAA*APCCUUGU-------------------7.CACCAGTPCAAAUCUGGUUCCUAGCACCA 
BµµHµµµµµmitoµLeuµBAAµGlycine maxµplastidic µ-GCCUUGGUGGUGAAAU--#GDA-GCCACGCGAGACUBAAHAPCUCGU-GCU----ACAG-----AGCG-UGGAGGTPCGAGUCCUCUUCAAGGCACCA 
JµµHµµµµµmitoµLeuµJAAµGlycine maxµplastidic µ-GGGGAUAUGGCGAAAUU-#GDA-GACGCPACGGACUJAAHAPCCGUC-GACUU--AAG----AAAUCA-UGAGGGTPCAAGUCCCUCUAUCCCCACCA 
UµµKµµµµµmitoµLeuµUA7µGlycine maxµplastidic µ-GCCGCUAUGGUGAAAUU-#GDA-GACACGCUGCUCUUA7KAAGCAGU-GCU----AG-------AGCA-UCUCGGTPCGAGUCCGAGUAGCGGCACCA 
GµµHµµµµµmitoµAspµGUCµHordeum vulgareµplastidic µ-GGGAUUGUAGUUCAAUU-#GDC-AGAGCACCGCCCUGUCHAGGCGGAA-------------------G<UGCGGGTPCGAGCCCCGUCAGUCCCGCCA 
QµµHµµµµµmitoµAspµQUCµHordeum vulgareµplastidic µ-GGGAUUGUAGUUCAAUU-#GDC-AGAGCACCGCCCUQUCHAGGCGGAA-------------------G<UGCGGGTPCGAGCCCCGUCAGUCCCGCCA 
SµµAµµµµµmitoµGluµSPCµHordeum vulgareµplastidic µ-GCCCCUAUCGUMUAGU--GGDDCAGGACAUCUCPCUSPCAAGGAGGCA-------------------G-?GGGGATPCGACUUCCCCPGGGGGUACCA 
!µµHµµµµµmitoµGlnµ!UGµHordeum vulgareµplastidic µ-UGGGGCGUGGCCAAGU--#GD--AAGGCAGCGGGUU!UGHUCCCGUUA-------------------UDCGGAGGTPCGAAUCCUUCCGUCCCAGCCA 
NµµKµµµµµmitoµGlnµNUGµNicotiana rusticaµplastidic µ-UGGGGCGUGGCPAAGU--#GD--AAGGCAACGGGUUNUGKUCCCGCUA-------------------UUCGGAGGTPCGAAUCCUUCCGUCCCAGCCA 
Gµµ+µµµµµmitoµCysµGCAµNicotiana rusticaµplastidic µ-GGCGACAUGGCCGAGU--#GD--AAGGCAGAGGACUGCA+APCCUUUU-------------------UUCCCCAGTPCAAAUCCGGGUGUCGCCUCCA 
BµµAµµµµµmitoµTrpµBCAµNicotiana tabacumµplastidic µ-GCGCUCUUAGUUCAGUUC#GD--AGAACGPGGGPCUBCAAAACCCGAU-------------------GNCGUAGGTPCAAAUCCUACAGAGCGUGCCA 
Gµµ*µµµµµmitoµPheµGAAµPhaseolus vulgarisµplastidic µ-GUCGGGAUAGCUCAGUD-#GD--AGAGCAGAGGACUGAA*APCCUCGU-------------------7XCACCAGTPCAAAUCUGGUUCCUGGCACCA 
BµµHµµµµµmitoµLeuµBAAµPhaseolus vulgarisµplastidic µ-GGCUUGAUGGUGAAAUU-#GDA-GACACGCGAGACUBAAHAUCUCGU-GCU----AAAG-----AGCG-UGGAGGTPCGAGUCCUCUUCAAGUCACCA 
NµµHµµµµµmitoµLeuµNAAµPhaseolus vulgarisµplastidic µ-GGGGAUAUGGCGAAAUU-#GDA-GACGCPACGGACUNAAHAPCCGUC-GACUU--AAU----AAAUCA-UGAGGGTPCAAGUCCCUCUAUCCCCACCA 
UµµKµµµµµmitoµLeuµUA7µPhaseolus vulgarisµplastidic µ-GCCGCUAUGGUGAAAUU-#GDA-GACACGCUGCUCUUA7KAAGCAGU-GCU----AG-------AGCA-UCUCGGTPCGAGUCCGAGUAGCGGCACCA 
BµµHµµµµµmitoµTrpµBCAµPhaseolus vulgarisµplastidic µ-ACGCUCUUAGUUCAGUUC#GC--AGAACGPGGGPCUBCAHAACCCGAU-------------------7UCGUAGGTPCAAAUCCUACAGAGCGUGCCA 
CµµAµµµµµmitoµIniµCAUµPhaseolus vulgarisµplastidic µ-CGCGGAGUAGAGCAACUU#GD--AGCUCGCAAGGCUCAUAACCUUGAA-------------------7XUACGGGTPCAAAUCCCGUCUCCGCAACCA 
Cµµ/µµµµµmitoµMetµCAUµScenedesmus obliquusµplastidic µ-GCCUGCUPAGCUCAGUD-#GCC-AGAGCAUCCGPPUCAU/CGCGGAAA-------------------7DCACUAGTPCGAAUCUAGUAGCAGGCACCA 
CµµAµµµµµmitoµIniµCAUµScenedesmus obliquusµplastidic µ-CGCAGGAUAGAGCAGUCU#GD--AGCUCRPGGGGCUCAUAAPCCCAAU-------------------7DCGCAGGTPCAAAUCCUGCUCCUGCAACCA 
Gµµ*µµµµµmitoµTyrµGUAµScenedesmus obliquusµplastidic µ-GGGCCGAUGCCGAAGUN-#GDU-AAUGGGGCGGAPUGUA*APCCGCU-GGU----UAC------GCCUACGUUGGTPCGAAUCCGACUCGGCCCACCA 
Gµµ*µµµµµmitoµPheµGAAµSpinacia oleraceaµplastidic µ-GUCGGGAUAGCUCAGCU-#GD--AGAGCAGAGGACUGAA*AUCCUCGU-------------------7XCACCAGTPCAAAUCUGGUUCCUGGCACCA 
Gµµ6µµµµµmitoµIleµGAUµSpinacia oleraceaµplastidic µ-GGGCUAUUAGCUCAGU--#GD--AGAGCRCGCCCCUGAU6AGGGCGAG-------------------7XCUCUGGTPCAAGUCCAGGAUGGCCCACCA 
<µµ6µµµµµmitoµIleµµSpinacia oleraceaµplastidic µ-GCAUCCAUGGCUGAAU--#GDD-AAAGCRCCCAACU<AU6APPG_GAA-------------------UUCGUAGGTPCAAUUCCUACUGGAUGCACCA 
UµµKµµµµµmitoµLeuµUA7µSpinacia oleraceaµplastidic µ-GCCGCUAUGGUGAAAUU-#GDA-GACACGCUGCUCUUA7KAAGCAGU-GC-----GAGA------GCA-UCUCGGTPCGAGUCCGAGUAGCGGCACCA 
CµµAµµµµµmitoµMetµCAUµSpinacia oleraceaµplastidic µ-ACCUACUUAACUCAGC--#GDD-AGAGPAPPGCPUUCAUACGGCGGGA-------------------7XCAUUGGTPCAAAUCCAAUAGUAGGUACCA 
NµµHµµµµµmitoµProµNGGµSpinacia oleraceaµplastidic µ-AGGGAUGUA;CGCAGCUU#GD--AGCGCPPUUGUPUNGGHPACAAAAU-------------------7UCACGGGTPCAAAUCCUGUCAUCCCUACCA 
GµµEµµµµµmitoµThrµGGUµSpinacia oleraceaµplastidic µ-GCCCCUUUAACUCAGU--#GD--AGAGUAACGCCAUGGUEAGGCGUAA-------------------7DCAUCGGTPCAAAUCCGAUAAGGGGCUCCA 
NµµAµµµµµmitoµValµNACµSpinacia oleraceaµplastidic µ-AGGGCUAUAGCUCAGUUA#GD--AGAGCACCUCGUUNACACCGAGAAA-------------------7.CUACGGTPCGAGUCCGUAUAGCCCUACCA 
CµµHµµµµµmitoµTrpµCCAµSpinacia oleraceaµplastidic µ-GCGCUCUUAGUUCAGUUC#GD--AGAACLPGGGPCUCCAHAACCCGAU-------------------G.CGUAGGTPCAAGUCCUACAGAGCGUGCCA 
CµµAµµµµµmitoµIniµCAUµSpinacia oleraceaµplastidic µ-CGCGGGGUAGAGCAGUUU#GD--AGCUCGCAAGGCUCAUAACCUUGAG-------------------7UCACGGGTPCAAAUCCUGUCUCCGCAACCA 
SµµAµµµµµmitoµGluµSPCµTriticum aestivumµplastidic µ-GCCCCUAUCGUMUAGU--GGDDCAGGACAUCUCPCUSPCAAGGAGGCA-------------------G-?GGGGATPCGACUUCCCCPGGGGGUACCA 
Gµµ6µµµµµmitoµIleµGAUµZea maysµplastidic µ-GGGCUAUUAGCUCAGU--#GD--AGAGCRCGCCCCUGAU6AGGGCGAG-------------------7XCUCUGGTPCAAGUCCAGGAUGGCCCACCA 
CµµAµµµµgcgµBacterµAlaµCGCµStreptomyces griseusµprokaryotic cytosol µ-GGGCCUGUGGCGCAGUCUGGD-DAGCGCACCUCGUUCGCAUCGAGGGG-------------------GUCUGGGGUUCA"AUCCCCACAGGUCCA--- 
GµµAµµµµgccµGµAlaµGGCµEscherichia coliµprokaryotic cytosol µ-GGGGCUAUAGCUCAGCD-GGG--AGAGCGCUUGCAUGGCAUGCAAGAG-------------------7UCAGCGGTPCGAUCCCGCUUAGCUCCACCA 
GµµAµµµµgccµGµAlaµGGCµBacillus subtilisµprokaryotic cytosol µ-GGGGCCAUAGCUCAGCD-GGG--AGAGCGCUACGCUGGCAGCGUAGAG-------------------7UCAGGGGTPCGAGCCCCCUUGGCUCCACCA 
GµµAµµµµgccµGµAlaµGGCµStreptomyces griseusµprokaryotic cytosol µ-GGGGCUAUAGCUBAGUDDGGD-DAGAGCGCCUGCAUGGCAUGCAGGAG-------------------7UCAGGAGUUCA"UUCUCCUUAGCUCCACAA 
GµµAµµµµgccµGµAlaµGGCµStreptomyces griseusµprokaryotic cytosol µ-GGGGCUAUAGCUBAGUDDGGD-DAGAGCGCCUGCAUGGCAUGCAGGAG-------------------7UCAGGAGUUCA"UUCUCCUUAGCUCCA--- 
5µµ=µµµµgcaµUµAlaµUGCµBacillus subtilisµprokaryotic cytosol µ-GGAGCCUUAGCUCAGCD-GGG--AGAGCGCCUGCUU5GC=CGCAGGAG-------------------7UCAGCGGTPCGAUCCCGCUAGGCUCCACCA 
5µµ6µµµµgcaµUµAlaµUGCµLactococcus lactisµprokaryotic cytosol µ-GGGGCCU4AGCUCAGCU-GGG--AGAGCGCCUGCUU5GC6CGCAGGAG-------------------7UCAGCGGUUCGAUCCCGCUAGGCUCCA--- 
Uµµ=µµµµgcaµUµAlaµUGCµMycoplasma capricolumµprokaryotic cytosol µ-GGGCCCU4AGCUCAGCD-GGG--AGAGCACCUGCCUUGC=CGCAGGGG-------------------7UCGACGGUPCGAUCCCGUUAGGGUCCACCA 
Uµµ=µµµµgcaµUµAlaµUGCµMycoplasma mycoidesµprokaryotic cytosol µ-GGGCCCUUAGCUCAGCD-GGG--AGAGCACCUGCCUUGC=CGCAGGGG-------------------7UCGACGGUUCGAUCCCGUUAGGGUCCACCA 
CµµGµµµµgcaµUµAlaµUGCµStreptomyces griseusµprokaryotic cytosol µ-GGGGCCUUAGCUBAGUDGGDA-GAGCGCUGCCUUUGCAAGGCAGAU---------------------GUCAGGAGUUCGAAUCUCCUAGGCUCCA--- 
VµµAµµµµgcaµUµAlaµVGCµEscherichia coliµprokaryotic cytosol µ-GGGGCUAUAGCUCAGCD-GGG--AGAGCGCCUGCUUVGCACGCAGGAG-------------------7UCUGCGGTPCGAUCCCGCAUAGCUCCACCA 
!µµ6µµµµagaµUµArgµ!CUµMycoplasma capricolumµprokaryotic cytosol µ-GCCCAUGUAGCUCAGUA-GGAD-AGAGCACGCGCCU!CU6AGCGUGAG-------------------7UCGGAAGUPCGAGCCUUCUCGUGGGCACCA 
IµµAµµµµcgtµAµArgµACGµLactococcus lactisµprokaryotic cytosol µ-GCAGGCGUGGCUCAACDDGGADDAGAGUACCUGACUICGAAUCAGGCG-------------------GUUGUAGGUUCGAAUCCUACCGCUUGCA--- 
IµµKµµµµcgtµAµArgµACGµStreptomyces griseusµprokaryotic cytosol µ-GCACUCGUAGCUJAAC--GGADDAGAGCAUCUGACUICGKAUCAGAAG-------------------7UUGCAGGUUCG"AUCCUGCCGAGUGCA--- 
CµµKµµµµcggµCµArgµCCGµEscherichia coliµprokaryotic cytosol µ-GCGCCCGUAGCUCAGCD-GGAD-AGAGCGCUGCC%UCCGKAGGCAGAG-------------------7UCUCAGGTPCGAAUCCUGUCGGGCGCGCCA 
CµµKµµµµcggµCµArgµCCGµBacillus subtilisµprokaryotic cytosol µ-GCGCUCGUAGCUCAGUU-GGAD-AGAGCGGUGGUUUCCGKUACCACGGUCG----------------UCCGGGGGTPCGAAUCCCUCCGAGCGCGCCA 
CµµKµµµµcggµCµArgµCCGµStreptomyces griseusµprokaryotic cytosol µ-GCCCCCGUAGCUBAG#-#GGADDAGAGCAUCGGCCUCCGKAGCCGGGU--------------------GCGCAGGUUCG"AUCCUGCCGGGGGCA--- 
Cµµ6µµµµaggµCµArgµCCUµBacillus subtilisµprokaryotic cytosol µ-GCUCUAGUAGCACAGC--GGAD-AGUGCAGCAGUUUCCU6AACUGCAG-------------------7UCGGGAGTPCGAAUCUCUCCUAGAGCGCCA 
Cµµ6µµµµaggµCµArgµCCUµStreptomyces griseusµprokaryotic cytosol µ-GCCUUCGUAGCUBAG#-#GGADDAGAGCACCGCUCUCCU6AAGCGGGU-------------------GUCGCAGGUUCG"AUCCUGCCGGGGGCA--- 
Iµµ/µµµµcgtµAµArgµICGµEscherichia coliµprokaryotic cytosol µ-GCAUCCG4AGCUCAGCD-GGAD-AGAGUACUCGG%UICG/ACCGAGCG-------------------7XCGGAGGTPCGAAUCCUCCCGGAUGCACCA 
IµµKµµµµcgtµAµArgµICGµBacillus subtilisµprokaryotic cytosol µ-GCGCCCGUAGCUCAAU--GGAD-AGAGCGUUUGACUICGKAUCAAAAG-------------------7UUAGGGGTPCGACUCCCCUCGGGCGCGCCA 
IµµKµµµµcgtµAµArgµICGµMycoplasma capricolumµprokaryotic cytosol µ-GCGCCCG4AGAUCAAUD-GGAD-AGAUCGCUUGACUICGKAPCAAAAG-------------------7UUGGGGGUPCGAGUCCCUCCGGGCGCACCA 
{µµ6µµµµagaµUµArgµUCUµEscherichia coliµprokaryotic cytosol µ-GCGCCCUUAGCUCAGUU-GGAU-AGAGCAACGAC%U{CU6AGPCGUGG-------------------GCCGCAGGTPCGAAUCCUGCAGGGCGCGCCA 
Uµµ6µµµµagaµUµArgµUCUµBacillus subtilisµprokaryotic cytosol µ-GUCCCAGUAGCUCAGCD-GGAD-AGAGCAACGGCCUUCU6AGCCGUCG-------------------7UCGGGAGTPCGAAUCUCUCCUGGGACGCCA 
UµµAµµµµagaµUµArgµUCUµLactococcus lactisµprokaryotic cytosol µ-GGUCCGAUAGCUCAGCU-GGADDAGAGCAUUCGCCUUCUAAGCGAACG-------------------7UCGAGGGUUCGAAUCCCCCUCGGAUCA--- 
UµµAµµµµagaµUµArgµUCUµStreptomyces griseusµprokaryotic cytosol µ-GCCCCCGUAGCUBAGU--GGADDAGAGCAGGCGCCUUCUAAGCGCUUG-------------------GcCGCAGGUUCGAGUCCUGCCGGGGGCG--- 
Qµµ6µµµµaacµGµAsnµGUUµEscherichia coliµprokaryotic cytosol µ-UCCUCUG4AGUUCAGDC-GGD--AGAACGGCGGACUQUU6APCCGUAU-------------------7UCACUGGTPCGAGUCCAGUCAGAGGAGCCA 
Gµµ6µµµµaacµGµAsnµGUUµLactococcus lactisµprokaryotic cytosol µ-UGCGGAU4AGCUCAGUU-GGUA-GUAGCGCAUGACUGUU6AUCAUGAU-------------------7UCGUCAGUUCGAGUCUGACAUCCGCAG--- 
Gµµ6µµµµaacµGµAsnµGUUµMycoplasma capricolumµprokaryotic cytosol µ-GGCUUUU4AGCUCAGCA-GGD--AGAGCAACCGGCUGUU6ACCGGUUU-------------------7UCACAGGUPCGAGCCCUGUAAAAGCCGCCA 
Gµµ6µµµµaacµGµAsnµGUUµStreptomyces griseusµprokaryotic cytosol µ-UCCCCUGUAGCUBAAU--DGGC-AGAGCAGCCGGCUGUU6ACCGGCAG-------------------7UUACUGGUUCGAGUCCAGUCGGGGGAG--- 
Gµµ6µµµµaacµGµAsnµGUUµStreptomyces griseusµprokaryotic cytosol µ-UCCCCUGUAGCUBAAU--DGGC-AGAGCAUUCGGCUGUU6ACCGGAGG-------------------7UUACUGGUUCGAGUCCAGUCGGGGGAG--- 
Qµµ6µµµµaacµGµAsnµQUUµAzospirillum lipoferumµprokaryotic cytosol µ-UUCACAGUAGCUCAGU--GGD--AGAGCUAUCGGCUQUU6ACCGAUCG-------------------AUCGUAGGTPCGAGUCCUACCUGUGAAUCCA 
Qµµ6µµµµaacµGµAsnµQUUµAzospirillum lipoferumµprokaryotic cytosol µ-UUCACAGUCGCUCAGU--GGD--AGAGCUAUCGGCUQUU6ACCGAUCG-------------------AUCGUAGGTPCGAGUCCUACCUGUGAAUCCA 
⊄µµ/µµµµgacµGµAspµ⊄UCµEscherichia coliµprokaryotic cytosol µ-GGAGCGG4AGUUCAGDC-GGDD-AGAAUACCUGCCU⊄UC/CGCAGGGG-------------------7UCGCGGGTPCGAGUCCCGPCCGUUCCGCCA 
GµµAµµµµgacµGµAspµGUCµLactococcus lactisµprokaryotic cytosol µ-GGUUCUGUAGUGUAGC--GGDDDAUCACGUCGCCCUGUCACGGCGAAG-------------------AUCGCGGGUUCGAUUCCCGUCAGAACCG--- 
GµµAµµµµgacµGµAspµGUCµMycoplasma capricolumµprokaryotic cytosol µ-GGCCCCA4AGCGAAGUD-GGDD-AUCGCGCCUCCCUGUCACGGAGGAG-------------------AUCACGGGUPCGAGUCCCGUUGGGGUCGCCA 
GµµAµµµµgacµGµAspµGUCµThermus thermophilusµprokaryotic cytosol µ-GGCCCCG4GGUGPAGUU-#GDD-AACACACCCGCCUGUCACGPGGGAG-------------------AUCGCGGGFPCG"GUCCCGUCGGGGCCGCCA 
Gµµ*µµµµtgcµGµCysµGCAµEscherichia coliµprokaryotic cytosol µ-GGCGCGU4AACAAAGC--GGD--DAUGUAGCGGAPUGCA*APCCGUCU-------------------A-GUCCGGTPCGACUCCGGAACGCGCCUCCA 
Gµµ=µµµµtgcµGµCysµGCAµMycoplasma capricolumµprokaryotic cytosol µ-GGCAACA4GGCCAAGC--GGCD-A"GGCAUGGGUCUGCA=CACCCUGA-------------------U-CAUCGGUPCGAAUCCGAUUGUUGCCUCCA 
GµµAµµµµtgcµGµCysµGCAµStreptomyces griseusµprokaryotic cytosol µ-GACCGUGUGCCCGAGA--GGCU-BAGGGGCUCGABUGCAACUCGAGUU-----------------ACACCGGUUCG""UCCGGUCACGGUCUCCG--- 
Gµµ*µµµµtgcµGµCysµGCAµStreptomyces griseusµprokaryotic cytosol µ-GGUGGAGUGGCCKAGA--GGC--GAGGCAACGGCCUGCA*AGCCGUCU-------------------A-CACGGGUUCAAAUCCCGUCUCCACCUCCA 
Gµµ≠µµµµtgcµGµCysµGCAµStreptomyces griseusµprokaryotic cytosol µ-GGUGGAGUGGCCKAGA--GGC--GAGGCAACGGCCUGCA≠AGCCGUCU-------------------A-CACGGGUUCAAAUCCCGUCUCCACCUCCA 
$µµ=µµµµcaaµUµGlnµ$UGµMycoplasma capricolumµprokaryotic cytosol µ-UGGGCUA4AGCCAAGC--GGD--A"GGCAAGGGACU$UG=CUCCCUCA-------------------UGCGCCGGUPCGAAUCCUGCUAGCCCAACCA 
Cµµ/µµµµcagµCµGlnµCUGµEscherichia coliµprokaryotic cytosol µ-UGGGGUA4CGCCAAGC--#GD--AAGGCACCGGAJUCUG/PPCCGGCA-------------------UUCCGAGGTPCGAAUCCUCGUACCCCAGCCA 
CµµGµµµµcagµCµGlnµCUGµStreptomyces griseusµprokaryotic cytosol µ-UGGGCUAUGBUGUAAUDDGGC--AACACUACGGUUUCUGGUACCGUCA-------------------U-UCUAGGUUCGAGUCCUGGUAGCCCAG--- 
$µµ/µµµµcaaµUµGlnµUUGµEscherichia coliµprokaryotic cytosol µ-UGGGGUA4CGCCAAGC--#GD--AAGGCACCGGUJU$UG/PACCGGCA-------------------UUCCCUGGTPCGAAUCCAGGUACCCCAGCCA 
UµµAµµµµcaaµUµGlnµUUGµLactococcus lactisµprokaryotic cytosol µ-UGGGGUA4AGCCAAGCG-GDA--AGGCAAGGGACUSUUGACUCCCUCA-------------------UGCGUUGGUUCGAAUCCAGCUACCCCAG--- 
UµµGµµµµcaaµUµGlnµUUGµStreptomyces griseusµprokaryotic cytosol µ-UCCCCCAUGKUGUAAUCAGGC--AGCACUGCGGUUUUUGGUACCGUCU-------------------G-UUCAGGUUCA"AUCCUGAUGGGGGAG--- 
Sµµ/µµµµgaaµUµGluµ{UCµEscherichia coliµprokaryotic cytosol µ-GUCCCCU4CGUCPAGA--GGCCCAGGACACCGCCCUSUC/CGGCGGUA-------------------A-CAGGGGTPCGAAUCCCCUAGGGGACGCCA 
$µµAµµµµgaaµUµGluµ$UCµMycoplasma capricolumµprokaryotic cytosol µ-GGCCUGUUGGUGAAGC--GGDD-A"CACACACGGUU$UCAUCCGUGGA-------------------CACACGGGUPCGAACCCCGUACAGGCUACCA 
CµµAµµµµgagµCµGluµCUCµStreptomyces griseusµprokaryotic cytosol µ-GCCCCCGUUGUGJAGC--GGCCUAGCACGCUGCCCUCUCACGGCAGUA-------------------G-CGCCGGUUCG""UCCGGUCGGGGGUACAA 
CµµAµµµµgagµCµGluµCUCµStreptomyces griseusµprokaryotic cytosol µ-GCCCCCGUUGUGJAGC--GGCCUAGCACGCUGCCCUCUCACGGCAGUA-------------------G-CGCCGGUUCG""UCCGGUCGGGGGUA--- 
NµµAµµµµgaaµUµGluµNUCµSynechocystis sp.µprokaryotic cytosol µ-GCCCCCAUCGUCUAGA--GGCCDAGGACACCUCCCUNUCACGGAGGCG-------------------A-CAGGGATPCGAAUUCCCUUGGGGGUACCA 
Sµµ/µµµµgaaµUµGluµSUCµEscherichia coliµprokaryotic cytosol µ-GUCCCCUUCGUCPAGA--GGCCCAGGACACCGCCCUSUC/CGGCGGUA-------------------A-CAGGGGTPCGAAUCCCCUAGGGGACGCCA 
UµµAµµµµgaaµUµGluµUUCµLactococcus lactisµprokaryotic cytosol µ-GGUCCGUUGGUC"AGG--GGUU-AAGACACCGCCUUUUCACGGCGGUA-------------------A-CACGGGUUCGAAUCCCGUACGGACUA--- 
!µµAµµµµggaµUµGlyµ!CCµBacillus subtilisµprokaryotic cytosol µ-GCGGGUGUAGUUUAGU--GGD--AAAACCUCAGCCU!CCAAGCUGAUG-------------------U-CGUGAGTPCGAUUCUCAUCACCCGCUCCA 
{µµAµµµµggaµUµGlyµ{CCµEscherichia coliµprokaryotic cytosol µ-GCGGGCAUCGUAUAAU--GGCU-AUUACCUCAGCCU{CCAAGCUGAUG-------------------A-UGCGGGTPCGAUUCCCGCUGCCCGCUCCA 
Uµµ=µµµµggaµUµGlyµ{CCµMycoplasma capricolumµprokaryotic cytosol µ-GCAGGUG4AGUUUAAU--GGD--AGAACUUCAGCCUUCC=AGCUGAUU-------------------G-UGAGGGUPCGAUUCCCUUCACCUGCUCCA 
Uµµ=µµµµggaµUµGlyµ{CCµMycoplasma mycoidesµprokaryotic cytosol µ-GCAGGUG4AGUUUAAU--GGC--AGAACUUCAGCCUUCC=AGCUGAUU-------------------G-UGAGGGUPCGAUUCCCUUCACCUGCUCCA 
UµµCµµµµggaµUµGlyµ{CCµStaphylococcus epidermidisµprokaryotic cytosol µ-GCGGGAG4AUUUCAACU-UUD--AGAAUACGUUCCUUCCCGGAACGAG-------------------A-UAUAGGUGCAAAUCCUAUCUUCCGCUCCA 
UµµCµµµµggaµUµGlyµ{CCµStaphylococcus epidermidisµprokaryotic cytosol µ-GCGGGAG4AGUUCAAU--UUD--AGAACACAUUCCUUCCCGGAAUGAG-------------------G-UAUAGGUGCAAGUCCUAUCUUCCGCUCCA 
CµµAµµµµgggµCµGlyµCCCµEscherichia coliµprokaryotic cytosol µ-GCGGGCG4AGUUCAAU--GGD--AGAACGAGAGCUUCCCAAGCUCUAU-------------------A-CGAGGGTPCGAUUCCCUUCGCCCGCUCCA 
CµµAµµµµgggµCµGlyµCCCµSalmonella typhimuriumµprokaryotic cytosol µ-GCGGGCGUAGUUCAAU--#GD--AGAACGAGAGCUUCCCAAGCUCUAU-------------------A-CGAGGGTPCGAUUCCCUUCGCCCGCUCCA 
CµµAµµµµgggµCµGlyµCCCµStreptomyces coelicolor A3(2)µprokaryotic cytosol µ-GCGGGUGUAGUUCAAU--GGD--AGAACAUCAGCUUCCCAAGCUGAGA-------------------G-CGCGAGTPCGAUUCUCGUCACCCGCUCCA 
CµµAµµµµgggµCµGlyµCCCµStreptomyces griseusµprokaryotic cytosol µ-GCGGKUGUAGUUUAAU--GGD-DAGAACAUGAGCUUCCCAAGCUCAGA-------------------G-CGCGAGUUCGAUUCUCGUCACCCGCU--- 
GµµAµµµµggcµGµGlyµGCCµEscherichia coliµprokaryotic cytosol µ-GCGGGAA4AGCUCAGDDDGGD-DAGAGCACGACCUUGCCAAGGUCGGG-------------------7UCGCGAGTPCGAGUCUCGUUUCCCGCUCCA 
GµµAµµµµggcµGµGlyµGCCµBacillus subtilisµprokaryotic cytosol µ-GCGGAAGUAGUUCAGU--GGD--AGAACACCACCUUGCCAAGGUGGGG-------------------7UCGCGGGTPCGAAUCCCGUCUUCCGCUCCA 
GµµAµµµµggcµGµGlyµGCCµLactococcus lactisµprokaryotic cytosol µ-GCGAACGUAGUUCAGG--GGU--AGAACACAACCUUGCCAUGGUUGGG-------------------7UCGCGAGUUCGAAUCUCGUCGUUCGCU--- 
GµµAµµµµggcµGµGlyµGCCµStreptomyces griseusµprokaryotic cytosol µ-GCGKACGUAGCUBAGUDDGGD-DAGAGCGCAACCUUGCCAAGGUUGAG-------------------GUCGCCAGUUCGAACCUGGUCGUCCGCUCCA 
GµµAµµµµggcµGµGlyµGCCµStreptomyces griseusµprokaryotic cytosol µ-GCGKACGUAGCUBAGUDDGGD-DAGAGCGCAACCUUGCCAAGGUUGAG-------------------GUCGCCAGUUCGAACCUGGUCGUCCGCU--- 
NµµAµµµµggaµUµGlyµNCCµSalmonella typhimuriumµprokaryotic cytosol µ-GCGGGCAUCGUAUAAU--GGCU-AUUACCUCAGCCUNCCAAGCUGAUG-------------------A-UGCGGGTPCGAUUCCCGCUGCCCGCUCCA 
Uµµ=µµµµggaµUµGlyµUCCµLactococcus lactisµprokaryotic cytosol µ-GCGGAUGUAGUUUAAU--GGU--AGAACCCCAGCCUUCC=AGCUGGCU-------------------A-CGCGAGUUCGAUUCUCGUCAUCCGCU--- 
5µµ=µµµµggaµUµGlyµUCCµLactococcus lactisµprokaryotic cytosol µ-GCGGAUGUAGUUUAAU--GGU--AGAACCCCAGCCU5CC=AGCUGGCU-------------------A-CGCGAGUUCGAUUCUCGUCAUCCGCU--- 
UµµAµµµµggaµUµGlyµUCCµStreptomyces griseusµprokaryotic cytosol µ-GCGGGCGUAGCUCAAU--GGD-DAGAGCCCUAGUCUUCCAAACUAGCU-------------------A-CGCGGGUUCG"UUCCCGUCGCCCGCUCCA 
Qµµ/µµµµcacµGµHisµGUGµEscherichia coliµprokaryotic cytosol µGGUGGCUA4AGCUCAGDD-GGD--AGAGCCCUGGAUUQUG/PPCCAGUU-------------------7UCGUGGGTPCGAAUCCCAUUAGCCACCCCA 
GµµKµµµµcacµGµHisµGUGµStreptomyces griseusµprokaryotic cytosol µ-GUGGGUAUAGCUBAGCU-GGC--AGAGCACCUGGUUGUGKUUCAGGAU-------------------7UCGCGGGUUCA"GUCCCGUUACUCACC--- 
GµµKµµµµcacµGµHisµGUKµMycoplasma capricolumµprokaryotic cytosol µGGCGUAGGUGGUGAAGU--GGDD-A"CACAUCAGGUUGUGKCPCUGACA-------------------UACGCGGGUPCGAUCCCCGUUCUACGCCCCA 
Qµµ/µµµµcacµGµHisµQUGµSalmonella typhimuriumµprokaryotic cytosol µGGUGGCUA4AGCUCAGDD-GGD--AGAGCCCUGGAUUQUG/PPCCAGUU-------------------7UCGUGGGTPCGAAUCCCAUUAGCCACCCCA 
}µµ6µµµµatcµGµIleµ}AUµBacillus subtilisµprokaryotic cytosol µ-GGACCUUUAGCUCAGUU-GGUU-AGAGCAGACGGCU}AU6ACCGUCCG-------------------7UCGUAGGTPCGAGUCCUACAAGGUCCACCA 
}µµ=µµµµatcµGµIleµ}AUµMycoplasma capricolumµprokaryotic cytosol µ-GGACCUU4AGCUCAGUD-GGDD-AGAGCAUCCGGCU}AU=ACCGGACG-------------------7UCAUUGGUPCAAGUCCAAUAAGGUCCACCA 
}µµ6µµµµatgµCµIleµCAUµEscherichia coliµprokaryotic cytosol µ-GGCCCCU4AGCUCAGU--#GDD-AGAGCAGGCGACU}AU6APCGCUUG-------------------7XCGCUGGTPCAAGUCCAGCAGGGGCCACCA 
Gµµ6µµµµatcµGµIleµGAUµEscherichia coliµprokaryotic cytosol µ-AGGCUUGUAGCUCAGGD-GGDD-AGAGCGCACCCCUGAU6AGGGUGAG-------------------7XCGGUGGTPCAAGUCCACPCAGGCCUACCA 
Gµµ6µµµµatcµGµIleµGAUµLactococcus lactisµprokaryotic cytosol µ-GGGAGUU4AGCUCAGUU-GGDDDAGAGCACUGUGUUGAU6ACGCAGGG-------------------7UCCCAGGUUCGAAUCCUGGAAUUCCCA--- 
Gµµ6µµµµatcµGµIleµGAUµMycoplasma capricolumµprokaryotic cytosol µ-CGGAAUAUAGCUCAGCD-GGDD-AGAGCAUUCCGCUGAU6ACGGAGAG-------------------7UCGUUGGUPCAAGUCCAAUUAUUCCGACCA 
Gµµ6µµµµatcµGµIleµGAUµMycoplasma mycoidesµprokaryotic cytosol µ-CGGAAUA4AGCUCAGCD-GGDD-AGAGCAUUCCGCUGAU6ACGGAGAG-------------------7UCGUUGGUPCAAGUCCAAUUAUUCCGACCA 
Gµµ6µµµµatcµGµIleµGAUµStreptomyces griseusµprokaryotic cytosol µ-GGGGCUAUAGCUBAGUDDGGDDDAGAGCGCAUCCCUGAU6AGGAUGAG-------------------------GGUUCA"AUCCUGUUAGCCCCACCA 
Gµµ6µµµµatcµGµIleµGAUµThermus thermophilusµprokaryotic cytosol µ-GGGCGAUUAGCUCAGCU-#GUD-AGAGCGCACGCCUGAU6AGCGUGAG-------------------7UCGGUGGFPCA"GUCCACCAUCGCCCACCA 
CµµAµµµµatgµCµIniµCAUµEscherichia coliµprokaryotic cytosol µ-CGCGGGG4GGAGCAGCCUGGD--AGCUCGUCGGGBUCAUAACCCGAAG-------------------7UCGUCGGTPCAAAUCCGGCCCCCGCAACCA 
CµµAµµµµatgµCµIniµCAUµEscherichia coliµprokaryotic cytosol µ-CGCGGGG4GGAGCAGCCUGGD--AGCUCGUCGGGBUCAUAACCCGAAG-------------------AUCGUCGGTPCAAAUCCGGCCCCCGCAACCA 
CµµAµµµµatgµCµIniµCAUµBacillus subtilisµprokaryotic cytosol µ-CGCGGGGUGGAGCAGUUCGGD--AGCUCGUCGGGCUCAUAACCCGAAG-------------------GUCGCAGGTPCAAAUCCUGCCCCCGCAACCA 
CµµAµµµµatgµCµIniµCAUµMycobacterium smegmatisµprokaryotic cytosol µ-CGCGGGGUGGAGCAGCUCGGD--AGCUCGCUGGGCUCAUAACCCAGAG-------------------7UCGCAGGUPCG"AUCCUGUCCCCGCUACCA 
CµµAµµµµatgµCµIniµCAUµMycoplasma capricolumµprokaryotic cytosol µ-CGCGGGGUAGAGCAGUD-GGD--AGCUCGCCGGGCUCAUAACCCGGAG-------------------GUCGCAGGUPCGAGUCCUGCCCCCGCAACCA 
CµµAµµµµatgµCµIniµCAUµMycoplasma mycoidesµprokaryotic cytosol µ-CGCGGGG4AGAGCAGUD-GGD--AGCUCGCCGGGCUCAUAACCCGGAG-------------------GCCGCAGGUPCGAGUCCUGCCCCCGCAACCA 
CµµAµµµµatgµCµIniµCAUµStreptomyces griseusµprokaryotic cytosol µ-CGCGGGGUGGAGCAGCUCGGD--AGCUCGCUGGGCUCAUAACCCAGAG-------------------GUCGCAGGUPCA"AUCCUGUCCCCGCUACCA 
CµµAµµµµatgµCµIniµCAUµSynechococcus elongatus PCC 6301µprokaryotic cytosol µ-CGCGGGGUAGAGCAGCCUGGD--AGCUCGUCGGGBUCAUAACCCGAAG-------------------7UCAGAGGTPCAAAUCCUCUCCCCGCCACCA 
CµµAµµµµatgµCµIniµCAUµThermus thermophilusµprokaryotic cytosol µ-CGCGGGG4GGAGCAGCCU#GD--AGCUCGUCGGGBUCAUAACCCGAAG-------------------7UCGCCGGFPCA"AUCCGGCCCCCGCAACCA 
CµµAµµµµatgµCµIniµCAUµThermus thermophilusµprokaryotic cytosol µ-CGCGGGG4GGAGCAGCCU#GD--AGCUCGUCGGGBUCAUAACCCGAAG-------------------7UCGCGGGFPCA"AUCCCGCCCCCGCAACCA 
)µµ*µµµµttaµUµLeuµ)AAµEscherichia coliµprokaryotic cytosol µ-GCCCGGA4GGUGGAADC-#GDA-GACACAAGGGAPU)AA*APCCCUC-GGCG---UUCG----CGCUG-UGCGGGTPCAAGUCCCGCUCCGGGUACCA 
)µµ=µµµµttaµUµLeuµ)AAµMycoplasma capricolumµprokaryotic cytosol µ-CCCCAAG4GGCGGAAUA-GGDA-G"CGCAUUGGACU)AA=APCCAACGGGC----UUAAU---AUCCUGUGCCGGUPCAAGUCCGGCCUUGGGGACCA 
Bµµ*µµµµttgµCµLeuµBAAµEscherichia coliµprokaryotic cytosol µ-GCCGAAG4GGCGAAADC-#GDA-GACGCAGUUGAPUBAA*APCAACC-GUA----GAAA-----UACG-UGCCGGTPCGAGUCCGGCCUUCGGCACCA 
Bµµ*µµµµttgµCµLeuµBAAµGeobacillus stearothermophilusµprokaryotic cytosol µ-GCCGAUG4GGCGGAAUD-GGCA-G"CGCGCACGACUBAA*APCGUGU-GGGC---UUU-----GCCCG-UGUGGGTPCGACUCCCACCAUCGGCACCA 
Bµµ=µµµµttgµCµLeuµBAAµMycoplasma capricolumµprokaryotic cytosol µ-GCCUUUUUGGCGGAAUD-GGCA-G"CGCAUUAGACUBAA=APCUAACGAA-----GAAA------UUCGUAUCGGUPCGAAUCCGAUAAAGGGCACCA 
CµµHµµµµttgµCµLeuµCAAµRhodospirillum rubrumµprokaryotic cytosol µ-GCCUUUGUAGCGGAAD--GGD--AACGCGGCAGACUCAAHAPCUGCU-UUGG---UAAC----CCAGG-UGGUAGTPCGACUCUCCCCAAAGGCACCA 
CµµHµµµµttgµCµLeuµCAAµSynechococcus elongatus PCC 6301µprokaryotic cytosol µ-GGGCAAGUGGCGGAAUD-GGDA-GACGCAGCAGACUCAAHAPCUGCC-GCUA---GCGA----UAGUG-UGUGGGTPCGAGUCCCACCUUGCCCACCA 
CµµKµµµµctgµCµLeuµCAGµEscherichia coliµprokaryotic cytosol µ-GCGAAGGUGGCGGAADD-#GDA-GACGCGCUAGCUUCAGKPGPUAGU-GUCC---UUAC----GGACG-UGGGGGTPCAAGUCCCCCCCCUCGCACCA 
CµµKµµµµctgµCµLeuµCAGµBacillus subtilisµprokaryotic cytosol µ-GCGGGUGUGCGGGAAUD-GGDA-GACCGGCUAGAUUCAGKAPCUAGGGUCU----UUAU----GGACC-UGAGGGTPCA"GUCCCUUCACCCGCACCA 
Cµµ;µµµµctgµCµLeuµCAGµSalmonella typhimuriumµprokaryotic cytosol µ-GCGAAGGUGGCGGAADD-#GDA-GACGCGCUAGCUUCAG;PGPUAGU-GUCC---UUAC----GGACG-UGGGGGTPCAAGUCCCCCCCCUCGCACCA 
CµµKµµµµctgµCµLeuµCAGµStreptomyces griseusµprokaryotic cytosol µ-GCGCGAGUGGCGGAAC--GGCA-GACGCGCUGGCUUCAGKUGCCAGUGUCC-----UUAG----GGACGUGGGGGUUCAAAUCCCCCCUCGCGCACGA 
CµµKµµµµctgµCµLeuµCAGµSynechococcus elongatus PCC 6301µprokaryotic cytosol µ-GCGGAACUGGCGGAAUD-GGDA-GACGCGCUAGAUUCAGKPPCUAGU-GGUU---UCAC----GACUG-UCCGGGTPCAAGUCCCGGGUUCCGCACCA 
GµµKµµµµctcµGµLeuµGAGµEscherichia coliµprokaryotic cytosol µ-GCCGAGGUGGUGGAADD-#GDA-GACACGCUACCUUGAGKPGGUAGU-GCCC---AAUA----GGGCU-UACGGGTPCAAGUCCCGUCCUCGGUACCA 
GµµKµµµµctcµGµLeuµGAGµStreptomyces griseusµprokaryotic cytosol µ-GUCCGGKUGGCGGAAU--GGCA-GACGCGCUAGCJUGAGKUGCUAGUGCCCU----UUAU---CGGGCGUGGGGGUUCA"GUCCCCCCUCGGACACCA 
UµµAµµµµttaµUµLeuµUAAµStreptomyces griseusµprokaryotic cytosol µ-GCCCGGAUGKUGGAAC--GDA--GACACGGCGAGCUUAAACCUCGCUGCCCCU---CGG----GGGCG-UGCCGGUUCGAGUCCGGCUCCGGGCACUA 
VµµKµµµµctaµUµLeuµUAGµEscherichia coliµprokaryotic cytosol µ-GCGGGAGUGGCGAAADD-#GUA-GACGCACCAGAUUVAGKPUCUGGCGCC------GCAA-----GGUGUGCGAGTPCAAGUCUCGCCUCCCGCACCA 
UµµKµµµµctaµUµLeuµUAGµBacillus subtilisµprokaryotic cytosol µ-GCGGGUGUGGCGGAAUD-GGCA-GACGCGCUAGACUUAGKAPCUAGUGUUUU---AUGA-------CGUUGGGGGTPCAAGUCCCUUCACCCGCACCA 
UµµKµµµµctaµUµLeuµUAGµMycoplasma capricolumµprokaryotic cytosol µ-GGGGGAU4GGCGGAAUD-GGCA-G"CGCACUAGACUUAGKAPCUAGCGUC-----UUU-------GACGUAAGGGUPCAAGUCCCUUAUCCCCCACCA 
$µµ[µµµµaaaµUµLysµ$UUµBacillus subtilisµprokaryotic cytosol µ-GAGCCAUUAGCUCAGUD-GGD--AGAGCAUCUGACU$UU[APCAGAGG-------------------7UCGAAGGTPCGAGUCCUUCAUGGCUCACCA 
$µµ6µµµµaaaµUµLysµ$UUµMycoplasma capricolumµprokaryotic cytosol µ-GACUCGUUAGCUCAGCC-GGD--AGAGCAACUGGCU$UU6ACCAGUGG-------------------7UCCGGGGUPCGAAUCCCCGACGAGUCACCA 
Cµµ6µµµµaagµCµLysµCUUµLactococcus lactisµprokaryotic cytosol µ-GGCCCGGUAGCUCAGUU-GGU--AGAGCAGUAGACUCUU6AUCUAUGG-------------------7UCCAGGGUUCGAGCCCCUGCCGAGCCA--- 
Cµµ6µµµµaagµCµLysµCUUµMycoplasma capricolumµprokaryotic cytosol µ-GUCUGAUUAGCGCAACD-GGC--AGAGCAACUGACUCUU6APCAGUGG-------------------7UUGUGGGUPCGAUUCCCACAUCAGGCACCA 
Cµµ6µµµµaagµCµLysµCUUµStreptomyces griseusµprokaryotic cytosol µ-GCGCCKUUAGCUBAGUDDGGDDDAGAGCAGCUGACUCUU6AUCAGCGG-------------------7UCCGGGGUUCGAGUCCCUGACGGCGCACGA 
Cµµ6µµµµaagµCµLysµCUUµStreptomyces griseusµprokaryotic cytosol µ-GCGCCKUUAGCUBAGUDDGGDDDAGAGCAGCUGACUCUU6AUCAGCGG-------------------7UCCGGGGUUCGAGUCCCUGACGGCGCA--- 
Sµµ6µµµµaaaµUµLysµSUUµEscherichia coliµprokaryotic cytosol µ-GGGUCGUUAGCUCAGDD-GGD--AGAGCAGUUGACUSUU6APCAAUUG-------------------7XCGCAGGTPCGAAUCCUGCACGACCCACCA 
$µµ6µµµµaaaµUµLysµUUUµLactococcus lactisµprokaryotic cytosol µ-GACUCGU4AGCUCAGUU-GGU--AGAGCAUUUGACU$UU6AUCAAAGG-------------------7UCGCUGGUUCGAGCCCAGC=CGGGUCACUA 
$µµ6µµµµaaaµUµLysµUUUµLactococcus lactisµprokaryotic cytosol µ-GACUCGU4AGCUCAGUU-GGU--AGAGCAUUUGACU$UU6AUCAAAGG-------------------7UCGCUGGUUCGAGCCCAGC=CGGGUCA--- 
UµµAµµµµaaaµUµLysµUUUµStreptomyces griseusµprokaryotic cytosol µ-GGGCCKUUAGCUBAAUDDGGU-CAGAGCAGCGGACUUUUAAUCCGUUG-------------------7UUGUGGGUUCGAGUCCCACACGGCCUACCG 
Cµµ=µµµµatgµCµMetµCAUµBacillus subtilisµprokaryotic cytosol µ-GGCGGUGUAGCUCAGC--GGCD-AGAGCGUACGGUUCAU=CCCGUGAG-------------------7DCGGGGGTPCGAUCCCCUCCGCCGCUACCA 
}µµ=µµµµatgµCµMetµCAUµLactococcus lactisµprokaryotic cytosol µ-GGAUCUUUAGCUCAGUU-GGDDDAGAGCUAUCGGCU}AU=ACCGAUCG-------------------7UCGCUGGUUCGAAUCCAGCAAGAUCCA--- 
Mµµ=µµµµatgµCµMetµCAUµLactococcus lactisµprokaryotic cytosol µ-GGCGGUGUAGCUCAGCU-GGCU-AGAGCGUUCGGUUMAU=CCCGAGAG-------------------7UCGGGGGUUCGAUCCCCUUCGCCGCUA--- 
CµµAµµµµatgµCµMetµCAUµLactococcus lactisµprokaryotic cytosol µ-CGCGGGAUGGAGCAGCU-AGGU-AGCUCGUCGGGCUCAUAACCCGAAG-------------------7UCAUAGGTUCAAAUCCUAUUCCCGCAA--- 
CµµAµµµµatgµCµMetµCAUµMycoplasma capricolumµprokaryotic cytosol µ-GGCGGGG4AGCUCAGUD-GGDD-AGAGCGUUCGGUUCAUACCCGAAAG-------------------7UCGAGAGUPCAAAUCUCUCCCCCGCUACCA 
CµµAµµµµatgµCµMetµCAUµStreptomyces griseusµprokaryotic cytosol µ-GGGGCGGUAGCUBAGCC-LGDDDAGAGCAGCGGACUCAUAAUCCGUCG-------------------GCCGUGGGUUCGAGUCCCACCCGCCCCACCG 
CµµAµµµµatgµCµMetµCAUµStreptomyces griseusµprokaryotic cytosol µ-CGCGGGGUGGAGCAGCU-CGGDDAGCUCGCUGGGCUCAUAACCCAGAG-------------------GUCGCAGGUUCA"AUCCUGUCCCCGCUA--- 
Cµµ6µµµµatgµCµMetµCAUµStreptomyces griseusµprokaryotic cytosol µ-AGCGGUGUAGCUBAGUC-GGD-DAGAGCAAGCGGCUCAU6AUCGCUGU-------------------7UCACCGGUUCA"GUCCGGUCACCGCUACUA 
CµµAµµµµatgµCµMetµCAUµThermus thermophilusµprokaryotic cytosol µ-CGCGGGG4GGAGCAGCCU#GD--AGCUCGUCGGGBUCAUAACCCGAAG-------------------7UCGCGGGFPCA"AUCCCGCCCCCGCAACCA 
Mµµ6µµµµatgµCµMetµMAUµEscherichia coliµprokaryotic cytosol µ-GGCUACG4AGCUCAGDD-#GDD-AGAGCACAUCACUMAU6APGAUGGG-------------------7XCACAGGTPCGAAUCCCGUCGUAGCCACCA 
#µµ*µµµµttcµGµPheµ#AAµBacillus subtilisµprokaryotic cytosol µ-GGCUCGGUAGCUCAGUD-GGD--AGAGCAACGGACU#AA*APCCGUGU-------------------7UCGGCGGTPCGAUUCCGUCCCGAGCCACCA 
#µµ*µµµµttcµGµPheµ#AAµGeobacillus stearothermophilusµprokaryotic cytosol µ-GGCUCGG4AGCUCAGUC-GGD--AGAGCAAAGGACU#AA*APCCUUGU-------------------7UCGGCGGTPCGAUUCCGUCCCGAGCCACCA 
Gµµ*µµµµttcµGµPheµGAAµEscherichia coliµprokaryotic cytosol µ-GCCCGGA4AGCUCAGDC-GGD--AGAGCAGGGGAPUGAA*APCCCCGU-------------------7XCCUUGGTPCGAUUCCGAGUCCGGGCACCA 
GµµGµµµµttcµGµPheµGAAµLactococcus lactisµprokaryotic cytosol µ-GGCUCGGUAGCUCAGUU-GGU--AGAGCAAUGGAUUGAAGCUCCAUGU-------------------7UCGGCGGUUCGAUUCCGUCUCGCGCCA--- 
GµµKµµµµttcµGµPheµGAAµMycoplasma capricolumµprokaryotic cytosol µ-GGUCGUGUAGCUCAGUC-GGD--AGAGCAGCAGACUGAAKCPCUGCGU-------------------7UCGGCGGUPCAAUUCCGUCCACGACCACCA 
Gµµ*µµµµttcµGµPheµGAAµRhodospirillum rubrumµprokaryotic cytosol µ-GCCCGGGUAGCUCAGCD-GGD--AGAGCACGUGACUGAA*APCACGGU-------------------7UCGGUGGTPCGACUCCGCCCCCGGGCACCA 
Gµµ≠µµµµttcµGµPheµGAAµStreptomyces griseusµprokaryotic cytosol µ-GGCUGGGUAGCUBAGUDDGGUA-CGAGCGAUCGCCUGAA≠AGCGAUAG-------------------GUCGCCGGUUCGAUCCCGGCCCCAGCCACCA 
Gµµ*µµµµttcµGµPheµGAAµStreptomyces griseusµprokaryotic cytosol µ-GGCUGGGUAGCUBAGUDDGGUA-CGAGCGAUCGCCUGAA*AGCGAUAG-------------------GUCGCCGGUUCGAUCCCGGCCCCAGCCACCA 
Gµµ*µµµµttcµGµPheµGAAµSynechococcus sp. PCC 7002µprokaryotic cytosol µ-GCCAGGAUAGCNCAGUD-#GD--AGAGCAGAGGACUGAA*APCCUCGU-------------------7UCGGCGGTPCAAUUCCGCCUCCCGGCACCA 
Gµµ+µµµµttcµGµPheµGAAµThermus thermophilusµprokaryotic cytosol µ-GCCGALG4AGCUCAGUU-#GD--AGAGCAUGCGACUGAA+APCGCAGU-------------------7UCGGCGGTPCGAUUCCGCUCCUCGGCACCA 
5µµKµµµµccaµUµProµ5GGµBacillus subtilisµprokaryotic cytosol µ-CGGGAAGUAGCUCAGCUUGGD--AGAGCACAUGGPU5GGKACCAUGGG-------------------7UCGCAGGTPCGAAUCCUGUCUUCCCGACCA 
CµµKµµµµccgµCµProµCGGµEscherichia coliµprokaryotic cytosol µ-CGGUGAUUGGCGCAGCCUGGD--AGCGCACUUCGUUCGGKACGAAGGG-------------------7UCGGAGGTPCGAAUCCUCUAUCACCGACCA 
CµµKµµµµccgµCµProµCGGµSalmonella typhimuriumµprokaryotic cytosol µ-CGGUGAU4GGCGCAGCCUGGD--AGCGCACUUCGJUCGGKACGAAGGG-------------------7UCGGAGGTPCGAAUCCUCUAUCACCGACCA 
CµµKµµµµccgµCµProµCGGµStreptomyces griseusµprokaryotic cytosol µ-CGGGGUGUAGCGCAGCUUGGC--AGCGCGCUUCGUUCGGKACGAAGAG-------------------GUCGUGGGUUCAAAUCCCGCCACCCCGA--- 
GµµKµµµµcccµGµProµGGGµSalmonella typhimuriumµprokaryotic cytosol µ-CGGCACG4AGCGCAGCCUGGD--AGCGCACCGUCBUGGGKUPGCGGGG-------------------7UCGGAGGTPCAAAUCCUCUCGUGCCGACCA 
GµµGµµµµcccµGµProµGGGµStreptomyces griseusµprokaryotic cytosol µ-CGGGACGUGGCGCAGCUUGGD-DAGCGCACUUGABUGGGGGUCAAGGG-------------------GUCGCAGGUUCA"AUCCUGUCGUCCCGA--- 
5µµKµµµµccaµUµProµUGGµLactococcus lactisµprokaryotic cytosol µ-CGGGAAGUAGCUCAGCUUGGU--AGAGUACUUGGUU5GGKACCAAGGU-------------------7UCGCAGGUUCGAAUCCUGUCUUCCCGA--- 
UµµKµµµµccaµUµProµUGGµMycoplasma capricolumµprokaryotic cytosol µ-CGGGAAGUGGCUCAGUUUGGD--AGAGCAUUCGGUUUGGKACCGAAGG-------------------7UCGCAGGUPCAAAUCCUGUCUUCCCGACCA 
UµµKµµµµccaµUµProµUGGµMycoplasma mycoidesµprokaryotic cytosol µ-CGGGAAGUGGCUCAGUUUGGD--AGAGCAUUCGGUUUGGKACCGAAGG-------------------GUCGCAGGUUCAAAUCCUGUCUUCCCGACCA 
UµµKµµµµccaµUµProµUGGµStreptomyces griseusµprokaryotic cytosol µ-CGGGGUGUGGCGCAGCUUGGD-DAGCGCGUCCGCUUUGGKAGCGGAAG-------------------GUCGUCGGUUCG""UCCGGCCACCCCGACCA 
VµµKµµµµccaµUµProµVGGµSalmonella typhimuriumµprokaryotic cytosol µ-CGGCGAG4AGCGCAGCUUGGD--AGCGCAACUGGJUVGGKACCAGUGG-------------------7UCGGAGGTPCGAAUCCUCPCUCGCCGACCA 
Uµµ+µµµµtgaµUµSecµUCAµEscherichia coliµprokaryotic cytosol µ-_AAGAUCG4CGUCUCC--GGDG-AGGCGGCUGGACUUCA+AUCCAGU-UGGGGCCGC_GCGGUCCCG--GGCAGGTPCGACUCCUGUGAUCUU_GCCA 
5µµ+µµµµtcaµUµSerµ5GAµBacillus subtilisµprokaryotic cytosol µ-GGAGGAA4ACCCAAGUCUGGCDGA"GGGAUCGGUCU5GA+AACCGACAGGGUG--UCAA---AGCCCG-CGGGGGTPCGAAUCCCUCUUCCUCCGCCA 
Cµµ*µµµµtcgµCµSerµCGAµEscherichia coliµprokaryotic cytosol µ-GGAGAGAUGCCGGAGC--#GCDGAACGGACCGGUCUCGA*AACCGGA-GUAGGG-GCAA--CUCUAC--CGGGGGTPCAAAUCCCCCUCUCUCCGCCA 
Cµµ`µµµµtcgµCµSerµCGAµStreptomyces griseusµprokaryotic cytosol µ-GGJAGCGUGUCCGAGC--GGCC#AAGGAGCUCGCCUCGA`AGCGAGUGUGGC----GUAA---CCCGU-CACCGUGGGUUCAAAUCCCACCGCUACCG 
Cµµ≠µµµµtcgµCµSerµCGAµStreptomyces griseusµprokaryotic cytosol µ-GGJAGCGUGUCCGAGC--GGCC#AAGGAGCUCGCCUCGA≠AGCGAGUGUGGC----GUAA---CCCGU-CACCGUGGGUUCAAAUCCCACCGCUACCG 
Cµµ+µµµµtcgµCµSerµCGAµStreptomyces griseusµprokaryotic cytosol µ-GGJAGCGUGUCCGAGC--GGCC#AAGGAGCUCGCCUCGA+AGCGAGUGUGGC----GUAA---CCCGU-CACCGUGGGUUCAAAUCCCACCGCUACCG 
Cµµ*µµµµtcgµCµSerµCGAµStreptomyces griseusµprokaryotic cytosol µ-GGJAGCGUGUCCGAGC--GGCC#AAGGAGCUCGCCUCGA*AGCGAGUGUGGC----GUAA---CCCGU-CACCGUGGGUUCAAAUCCCACCGCUACCG 
Gµµ6µµµµagcµGµSerµGCUµEscherichia coliµprokaryotic cytosol µ-GGUGAGG4GGCCGAGA--GGCDGAAGGCGCUCCC%UGCU6AGGGAGU-AUGCGGUCAAAAGCUGCAU--CCGGGGTPCGAAUCCCCGCCUCACCGCCA 
Gµµ6µµµµagcµGµSerµGCUµBacillus subtilisµprokaryotic cytosol µ-GGAGAAGUACUCAAGU--GGCDGA"GAGGCGCCCCUGCU6AGGGUGUAGGUCGC-GUAA---GCGGCG-CGAGGGTPCAAAUCCCUCCUUCUCCGCCA 
Gµµ6µµµµagcµGµSerµGCUµLactococcus lactisµprokaryotic cytosol µ-GGGGGGUUACUCAAGA--GGCUGAAGAGGACGGUU5GCU6AAAUCGU4AG7UCGG-GAA--ACCGGCG-CGAGGGUUCGAAUCCCUUACCCCCCU--- 
Gµµ6µµµµagcµGµSerµGCUµMycoplasma capricolumµprokaryotic cytosol µ-GGGUUAA4ACUCAAGUD-GGDG-A"GAGGACACCCUGCU6AGGUGUUAGGUCGG-UCU-----CCGGCGCGAGGGUPCGAGUCCCUCUUAACCCGCCA 
Gµµ6µµµµagcµGµSerµGCUµStreptomyces griseusµprokaryotic cytosol µ-GGAGGCGUCGCCUAGUCCGGUCU/UGGCGCCGCACUGCU6AUGCGGUUUGGGUC--UUAA-AGCCCAU-CGAGGGUUCA"AUCCCUCCGCCUCCG--- 
GµµAµµµµtccµGµSerµGGAµEscherichia coliµprokaryotic cytosol µ-GGUGAGG4GUCCGAGU--#GDDGAAGGAGCACGCCUGGAAAGPGUGU-AUACG--GCAA---CGUAU--CGGGGGTPCGAAUCCCCCCCUCACCGCCA 
GµµAµµµµtccµGµSerµGGAµBacillus subtilisµprokaryotic cytosol µ-GGAGAGC4GUCCGAGU--GGDCGA"GGAGCACGAUUGGAAAPCGUGUAGGCGGU-CAAC--UCCGUCU-CAAGGGTPCGAAUCCCUUGCUCUCCGCCA 
GµµAµµµµtccµGµSerµGGAµLactococcus lactisµprokaryotic cytosol µ-GGAGAAGUGUCCGAGU--GGCCGAAGGAGC=CGCCUGGAAAGUGUGUAUACGUCA-----CAAGCGUAUCGGGGGUUCGAAUCCCCUCUUCUCCU--- 
Gµµ`µµµµtccµGµSerµGGAµStreptomyces griseusµprokaryotic cytosol µ-GGAGGAUUCGCCUAGU--GGCCUAGGGCGCACGCJUGGA`AGCGUGUUGGGG----GCAA---CCCCU-CACGAGUUCG""UCUCGUAUCCUCCGCCA 
Gµµ≠µµµµtccµGµSerµGGAµStreptomyces griseusµprokaryotic cytosol µ-GGAGGAUUCGCCUAGU--GGCCUAGGGCGCACGCJUGGA≠AGCGUGUUGGGG----GCAA---CCCCU-CACGAGUUCG""UCUCGUAUCCUCCGCCA 
Gµµ+µµµµtccµGµSerµGGAµStreptomyces griseusµprokaryotic cytosol µ-GGAGGAUUCGCCUAGU--GGCCUAGGGCGCACGCJUGGA+AGCGUGUUGGGG----GCAA---CCCCU-CACGAGUUCG""UCUCGUAUCCUCCGCCA 
Gµµ*µµµµtccµGµSerµGGAµStreptomyces griseusµprokaryotic cytosol µ-GGAGGAUUCGCCUAGU--GGCCUAGGGCGCACGCJUGGA*AGCGUGUUGGGG----GCAA---CCCCU-CACGAGUUCG""UCUCGUAUCCUCCGCCA 
Vµµ*µµµµtcaµUµSerµUGAµEscherichia coliµprokaryotic cytosol µ-GGAAGUG4GGCCGAGC--#GDDGAAGGCACCGGUBUVGA*AACCGGC-GACCC--GAAA---GGGUU--CCAGAGTPCGAAUCUCUGCGCUUCCGCCA 
Uµµ=µµµµtcaµUµSerµUGAµMycoplasma capricolumµprokaryotic cytosol µ-GGAAGAU4ACCCAAGUCCGGCDGA"GGGAUCGGUCUUGA=AACCGAGAGUCGG--GGAAA----CCGAGCGGGGGUPCGAAUCCCUCAUCUUCCGCCA 
Uµµ=µµµµtcaµUµSerµUGAµMycoplasma mycoidesµprokaryotic cytosol µ-GGAAGAUUACCCAAGUCCGGCDGA"GGGAUCGGUCUUGA=AACCGAGAGUCGGG-GAAA--CCCGAG--CGGGGGUUCGAAUCCCUCAUCUUCCGCCA 
Uµµ*µµµµtcaµUµSerµUGAµStreptomyces griseusµprokaryotic cytosol µ-GGUGGGUUGCCCGAGC--GGCCUAAGGGAACGGUCUUGA*AACCGUCGUGGCA---GCGA--UGUCAC-CGUGGGUUCAAAUCCCACACCCACCG--- 
5µµ6µµµµacaµUµThrµ5GUµBacillus subtilisµprokaryotic cytosol µ-GCC