Recherche:Corrélation entre les gènes de tRNAs des 3 domaines/Annexe/Tableur

Une page de Wikiversité, la communauté pédagogique libre.
Aller à la navigation Aller à la recherche
Image logo représentative de la faculté
Annexe 2
Recherche : Corrélation entre les gènes de tRNAs des 3 domaines
Précédent :Sommaire
Suivant :Tableaux
Icon falscher Titel.svg
En raison de limitations techniques, la typographie souhaitable du titre, « Annexe : Tableur
Corrélation entre les gènes de tRNAs des 3 domaines/Annexe/Tableur
 », n'a pu être restituée correctement ci-dessus.

Paris le 01.04.19

Introduction[modifier | modifier le wikicode]

Tableau des effectifs des gènes de tRNAs[modifier | modifier le wikicode]

  • Lien Tableaux: Tableau des effectifs des gènes de tRNAs
  • Légende: Décompte des gènes tRNAs par codon suivant la base de données gtRNAdb [1].
    1.   5   : nombre de tRNAs d'un codon se terminant par t. Ce sont les plus faibles.
    2.   113   : nombre de tRNAs d'un codon se terminant par t: Changement de t en c chez les archées et de c en t chez les eucaryotes.
    3. 4 366: Effectif élevé de tRNAs d'un codon se terminant par g chez les procaryotes.
    4. 2622: Effectif faible de tRNAs supérieurs à   t   et à   c   .
    5. 160: Changement de codon   g   Chez les archées et les eucaryotes.
  • Tableaux:
    1. Nombre de tRNAs, tableaux I II III, décompte de la base gtRNAdb.
    2. Pour 100 000 tRNAs, tableaux I100 II100 III100, décomptes rapportés à 100 000 tRNAs pour comparaison.
    3. tRNAs pour 1 génome, tableaux I1 II1 III1, indice de la multiplicité = nombre de tRNAs / nombre des génomes du domaine.
  • Tableaux non formatés:
- Nombres de tRNAs
I;Nombres de tRNAs. 4032 bactéries ;;;;;;;;II;Nombres de tRNAs. 184 archées;;;;;;;;III;Nombres de tRNAs. 155 eucaryotes;;;;;;
ttt;10;tct;5;tat;4;tgt;3;;ttt;0;tct;0;tat;0;tgt;0;;ttt;66;tct;1 863;tat;155;tgt;233
c;6105;c;4520;c;6420;c;4473;;c;215;c;190;c;190;c;299;;c;1 933;c;113;c;2 216;c;2 755
a;4749;a;5299;a;−;a;1315;;a;191;a;184;a;-;a;18;;a;890;a;1 041;a;-;a;279
g;3999;g;2622;g;−;g;4366;;g;163;g;152;g;-;g;184;;g;1 249;g;749;g;-;g;1 982
ctt;369;cct;10;cat;4;cgt;7478;;ctt;1;cct;0;cat;0;cgt;2;;ctt;1 576;cct;1 638;cat;47;cgt;1 587
c;3849;c;2742;c;4715;c;333;;c;214;c;171;c;185;c;187;;c;37;c;34;c;1 879;c;57
a;4940;a;5453;a;6388;a;887;;a;185;a;184;a;196;a;185;;a;872;a;1 641;a;2 289;a;2 337
g;5186;g;2183;g;2389;g;3355;;g;160;g;151;g;165;g;139;;g;1 296;g;735;g;1 849;g;522
att;5;act;103;aat;5;agt;1;;att;0;act;0;aat;0;agt;0;;att;2 428;act;2 201;aat;149;agt;53
c;9 203;c;4513;c;8 764;c;4422;;c;212;c;189;c;214;c;187;;c;99;c;154;c;3 524;c;1 895
a;55;a;5878;a;9 105;a;4804;;a;2;a;198;a;197;a;186;;a;851;a;1 494;a;2 640;a;1 762
g;18 026;g;2760;g;2427;g;3452;;g;589;g;169;g;166;g;165;;g;3 862;g;833;g;6 064;g;1 285
gtt;9;gct;2;gat;0;ggt;1;;gtt;1;gct;0;gat;0;ggt;1;;gtt;2 101;gct;2 962;gat;100;ggt;132
c;4430;c;4166;c;9 023;c;9 273;;c;212;c;184;c;218;c;243;;c;109;c;405;c;2 799;c;3 279
a;8 859;a;10 185;a;9 679;a;5515;;a;186;a;256;a;230;a;189;;a;1 088;a;7 639;a;7 079;a;5 538
g;1313;g;1224;g;1388;g;2266;;g;170;g;159;g;160;g;155;;g;3 123;g;4 737;g;3 754;g;7 052
- Pour 100 000 tRNAs
I 100;Nombres de tRNAs. 4032 bactéries ;;;;;;235027;;II 100;Nombres de tRNAs. 184 archées;;;;;;8749;;III 100;Nombres de tRNAs. 155 eucaryotes;;;;;;115111
- tRNAs pour 1 génome
I 1;Nombres de tRNAs. 4032 bactéries ;;;;;;;;II 1;Nombres de tRNAs. 184 archées;;;;;;;;III 1;Nombres de tRNAs. 155 eucaryotes;;;;;;

Ordre des codons pour 100 000 tRNAs[modifier | modifier le wikicode]

  • Lien Tableaux: Ordre des codons pour 100 000 tRNAs
  • Légende: B bactéries, A archées, E eucaryotes.
    1. gac: Chez les bactéries le codon se terminant par g n'est pas dernier.
    2. cag: changement chez les archées par rapport aux bactéries.
    3. tag: chez les eucaryotes le codon se terminant par g est dernier.
    4. cag: différence très faible mais toujours non nulle.
  • Tableau non formaté
- Ordre des codons

Moyennes et variances pour 100 000 tRNAs des codons[modifier | modifier le wikicode]

  • Lien Tableaux: Moyennes et variances pour 100 000 tRNAs des codons
  • Légende:
    1. Moyenne et écart type sont faits sur les carrés, sauf certains carrés.
    2. % :rapport de l'écart type par la moyenne en pourcent.
    3. moyenne par génome: celle du codon pour calculer l'indice de multiplicité. Elle est égale à dom*moyenne/100 000, dom étant le nombre de tRNAs par domaine, 8 731 pour les archées, 119 380 pour les eucaryotes et 239 000 pour les bactéries. Voir les statistiques de la base de données.
    4. multiplicité moyenne: rapport "moyenne par génome" du codon divisé par le nombre d'espèces du domaine de la base de données, 184 pour les archées, 155 pour les eucaryotes et 4 032 pour les bactéries.
  • Tableau non formaté
- Moyennes sur 100 000 tRNAs
t;2;1.4;74;13;ct ac cg;;-;-
a;2,524;1,193;47;14;ta at;;5,933;1.47
g;1,183;501;42;14;ta at;;2,781;0.69
a;2,257;246;11;13;ta at tg;;197;1.07
g;1,843;120;7;14;ta at;;161;0.88
a;2,306;2,027;88;14;ta tg;;2,654;17.12

Comparaison des 3 domaines avec les nombres des tRNAs[modifier | modifier le wikicode]

Comparaison globale[modifier | modifier le wikicode]

Codons par ordre de valeurs dans les carrés[modifier | modifier le wikicode]
  • Lien Tableaux: Codons par ordre de valeurs dans les carrés
  • Légende: classement des codons par leur ordre des effectifs de gène tRNA, dans les doublets des bactéries (B), des archées (A) et des eucaryotes (E). Les ordres sont ceux des tableaux I100, II100, III100.
  • Tableau non formaté
Codons par ordre de valeurs dans les carrés;;;;;;;;;;;;;;;
Groupes de codons[modifier | modifier le wikicode]
  • Lien Tableaux: Groupes de codons
  • Légende: Les effectifs sont ceux des tableaux I100, II100, III100 sauf pour les faibles effectifs des tableaux I II III quand ils sont indiqués.
    Groupe: Par exemple le groupe 111, est celui des codons classés en 1er dans chaque carré (doublet) des 3 domaines, bactéries (B), archées (A) et eucaryotes (E). L'attribution du groupe à chaque codon est faite dans le tableau des ordres.
    − Les paires de codons qui se ressemblent beaucoup sont soulignés en jaune.
  • Tableau non formaté
;Groupes de codons ;;;;;
111;Tableaux I II III  100.;;;;;
444;Tableaux I II III.;;;;;
333;Tableaux I II III  100.;;;;;
224;Tableaux I II III  100.;;;;;
332;Tableaux I II III  100.;;;;;
223;Tableaux I II III  100.;;;;;
214;Tableaux I II III  100.;;;;;
;Tableaux I II III  100.;;;;;
Comparaison par tri sur E et différences successives en %[modifier | modifier le wikicode]
Comparaison par tri sur E et différences successives en %;;;;;;;
;B;A;E;;E%;;Max B%
Diagramme de comparaison globale[modifier | modifier le wikicode]
Diagramme B et E en fonction de A;;;;

Similitude des comportements des codons dans les 3 domaines[modifier | modifier le wikicode]

Corrélations entre nombre de tRNAs des 3 domaines A B E[modifier | modifier le wikicode]

  1. Coefficient R 80.9 77.7: coefficient de corrélation respectivement de toute la colonne, des codons colorés en cyan.
  2. Domaine A B E, Ba Eb Ea: domaine respectivement des archées bactéries eucaryotes, diagramme respectivement de la corrélation AB BE AE.
  3. permutation: permutation entre le nombre de tRNAs du codon xyt et xyc pour le domaine E, 7 permutations, et le domaine B, 1 permutation. En supposant que les tRNAs des codons xyt de E se comportement relativement de la même façon que les codons xyc de B.
  4. Retraits:retrait des codons gxa,g et cga aag qui sont surexprimés dans le domaine E.
  5. X10: multiplication des nombres des tRNAs des domaines A et B pour adapter à l'échelle de E.
;Sans permuter;;1 permutation;;codons xya,g;;Diagramme AB  x10;;;;;Sans permuter;;7 permutations;;X10;retraits;Diagramme BE  x10;;;;;Sans permuter;;8 permutations;;X10;retraits;Diagramme AE  x10;;
coeff. R;80.9;;86.6;;84.0;;;86.6;77.7;;;35.6;;52.4;;90.4;;;90.4;75.4;;;34.8;;59.8;;87.4;;;87.4;76.2

Rapport E/B des codons[modifier | modifier le wikicode]

  • Lien Tableaux: Rapport E/B des codons
  • Légende: Valeur du codon se terminant par x de E / Valeur du codon se terminant par x de B
  1. 0.8: t de E / c de B
  2. Tableau rapport E/B pour 100 000: d'après les valeurs des tableaux III100 / I100
  3. Tableau rapport E/B par génome: d'après les valeurs des tableaux III1 / I1
  • Tableau non formaté
rapport E/B;;Pour 100 000;;;;;
rapport E/B;;Par génome;;;;;

Totaux des carrés pour 100 000 tRNAs[modifier | modifier le wikicode]

- Totaux des carrés
t;6 219;5 208;2 688;4 250
c;6 002;4 346;5 647;5 043
a;11 418;5 546;8 494;5 305
g;6 113;6 518;8 406;7 136
t;6 517;6 025;2 176;5 738
c;6 414;5 795;6 254;5 876
a;9 197;6 368;6 609;6 162
g;6 517;6 861;6 964;6 735
t;3 466;3 155;1 986;4 397
c;3 167;3 391;5 080;3 772
a;6 065;3 922;10 368;4 184
g;5 379;13 187;11 503;13 403

Variation en % entre la 1ère et la 2ème valeur[modifier | modifier le wikicode]

  1. -17, variation en % des 2 1ères valeurs; 779 différence en valeur absolue de la base de données de référence. La variation est calculée entre le nombre de codons contenu dans la cellule affichant la variation en % (-17) et celui contenu dans la cellule affichant la différence en valeur absolue (779).
  2.     : 4ème valeur sans changement entre B et A ou E
  3.     : 3ème valeur sans changement entre B et A ou E
  4.     : 4ème valeur après changement entre B et A ou E
  5.     : 3ème valeur après changement entre B et A ou E
  • Moyenne des valeurs absolues des variations:
	B	A	E
Moy	48.1	18.2	39.1
Ecart	47.4	21.0	24.5
%	98.5	115.2	62.7
  • Tableau non formaté
I 100;Nombres de tRNAs. 4032 bactéries ;;;;;;;;II 100;Nombres de tRNAs. 184 archées;;;;;;;;III 100;Nombres de tRNAs. 155 eucaryotes;;;;;;
a;1 356;a;779;a;-;a;;;a;24;a;6;a;-;a;;;a;;a;822;a;-;a;
a;-5;a;2 711;a;1 673;a;;;a;29;a;13;a;11;a;2;;a;;a;3;a;410;a;750
g;246;g;;g;;g;4 123;;g;;g;;g;;g;;;g;280;g;;g;;g;
a;;a;1 365;a;341;a;382;;a;;a;9;a;17;a;1;;a;;a;707;a;;a;133
g;8 823;g;;g;;g;;;g;377;g;;g;;g;;;g;1 434;g;;g;2 540;g;
a;4 429;a;6 019;a;656;a;3 758;;a;26;a;72;a;12;a;54;;a;;a;61;a;89;a;-21
g;;g;;g;;g;;;g;;g;;g;;g;;;g;1 022;g;2 902;g;3 325;g;1 514

Nombres de tRNAs des 4032 bactéries[modifier | modifier le wikicode]

  • Lien Tableaux: Nombres de tRNAs des 4032 bactéries
  • Base de données gtRNAdb [2]
  • Légende:
    1. I. Nombres de tRNAs. 4032 bactéries.
        5   : nombre de tRNAs d'un codon se terminant par t. Ils sont tous inférieurs à 11 sauf ctt cgt act.
      4 366: Effectif élevé de tRNAs d'un codon se terminant par g.
      2622: Effectif faible de tRNAs.
    2. II. Nombre de bactéries à tRNAs solitaires de 4 codons (1ère et 2ème base). Total d’une requête: Comptage fait pour les carrés. C’est un nombre de bactéries ayant x tRNAs pour un seul et même codon.
      Total d'une requête: Le 1er codon se terminant par t n'a pas de solitaire sauf ici pour Arg, et il est remplacé par le total de la requête.
      a,g,c : Nombre de bactéries à tRNAs solitaires pour les carrés de 4 codons.
      106*: solitaires du codon cgt. Le carré de Arg étant complet le total de la requête est représenté par *, il est de 3946.
      Note: le total des bactéries de la base des tRNA est de 4032. Cependant le total des bactéries comptées est compris entre 3832-3947. Est-ce que ce qui manque est du aux bactéries sans tRNAs pour les codons demandés? Cela ne serait pas vrai pour les aas à 2 codons.
      − Méthode pour compter, cas de la Thr, anti-codons xGT:
      • Sélectionner les anticodons pour la requête (ne pas oublier de mettre Bacteria dans Domain). Copier le résultat, ctrl+A, ctrl+C.
      • Dans calc ctrl+V, supprimer le dessin en le sélectionnant, supprimer toutes les colonnes sauf la colonne des anticodons, sélectionner le 1er anticodon puis ctrl+schift+fin ce qui sélectionne tous les anticodons et les cellules à blanc. Il n'y a pas de cellule intercalée entre 2 anticodon de la même bactérie.
      • Copier,ctrl+v, dans writer (texte non formaté), ctrl+h (expression régulière, $ en ; tout remplacer), ctrl+h (décocher expression régulière, ;; en *;;* tout remplacer). Le tout rechercher de * ;;* donne le total de la requête (nombre total de bactéries moins 1). Mettre un * à la fin mais pas début (le logiciel déplace tout le texte pour insérer *, ce qui prend beaucoup de temps). Repérer le motif du début avant * ;;*. Si le motif concerne une recherche ultérieure, en tenir compte.
      • ctrl+h (*GGT* tout rechercher donne 2916, *AGT* donne 41, *GGT;GGT donne 754 . . . ).
    3. III. Nombre de bactéries à tRNAs solitaires des codons a,g et t,c. Total d’une requête: tRNAs solitaires pour les codons se terminant par a ou g et t ou c; total des bactéries d'une requête de la base de données suivant les codons demandés.
      stc,sag, tt (1ère et 2ème base d'un carré) , tc . . . : Total des bactéries respectivement de la requête pour 2 codons se terminant par t ou c, pour 2 codons se terminant par a ou g.
      a,g,t,c : Nombre de bactéries à tRNAs solitaires pour les codons se terminant par a,g,t,c.
      − Trp-Sec: Les solitaires de Sec sont en fait des Trp (tga).
    4. IV. Pourcentage des bactéries à tRNAs solitaires: calculés à partir des tableaux II et III précédents.
      tt (1ère et 2ème base d'un carré) , tc . . .
      %4: Pourcentage des bactéries à 1 seul codon à tRNA dans les carrés de 4; toujours a est à plus de 90% sauf pour cgt (Arg) et atg (Met).
      %2: Pourcentage des bactéries à 1 seul codon à tRNA pour les codons se terminant par a ou g. Toujours a est à plus de 90% sauf pour R (cg), L (tt), M et W.
      1a1g: Nombre de bactéries ayant 1 tRNA pour le codon se terminant par a et 1 tRNA pour le codon se terminant par g. Permet de mettre en exergue les autres bactéries ayant des tRNAs multiples.
    5. V. Multiplicité des tRNAs en %: Voir les calculs.
;I. Nombres de tRNAs. 4032 bactéries ;;;;;;

II. Nombre de bactéries à tRNAs solitaires des carrés à 4 codons.;;;;;Total d’une requête.

III. Nombre de bactéries à tRNAs solitaires des codons ag.;;;;;;;

IV. Pourcentage des bactéries à tRNAs solitaires;;;;
1a1g;1 051;562;602;1973

V. Multipilcité;;;;;;;

Calcul de la multiplicité des tRNAs[modifier | modifier le wikicode]

  • Lien Tableaux: Calcul de la multiplicité des tRNAs
  • Légende: tRNAs, nombre affiché par la requête. lignes, nombre de lignes affiché dans calc après nettoyage. bactéries=lignes - tRNAs. multiplicité= tRNAs / bactéries.
  • Tableau non formaté
;;tRNAs;lignes;bactéries;multiplicité; ;tRNAs;lignes;bactéries;multiplicité; ;tRNAs;lignes;bacteries;multiplicité; ;tRNAs;lignes;bactéries;multiplicité

Comparaison des codons par les 2 1ères bases[modifier | modifier le wikicode]

total tRNAs;;;;;;;;;;;;;;;;;;;;;;;;;
;c;8 764;9 023;4715;;4430;4166;;4520;4513;;2742;9 273;;333;;3849;;6105;4422;;9 203;4473;;6420
;a;9 105;9 679;6388;;8 859;10 185;;5299;5878;;5453;5515;;887;;4940;;4749;4804;;55;1315;;−
;g;2427;1388;2389;;1313;1224;;2622;2760;;2183;2266;;3355;;5186;;3999;3452;;18 026;4366;;−
codon solitaire;;;;;;;;;;;;;;;;;;;;;;;;;
solitaire  a,g;;;;;;;;;;;;;;;;;;;;;;;;;
moyenne codon;;;;;;;;;;;;;;;;;;;;;;;;;
;t/c %;4;7;-17;;11;-41;;4;-56;;5;-17;;-25;;-7;;-2;-35;;-7;-15;;8
;a/g %;20;27;-39;;-48;-32;;-15;-8;;-54;49;;-73;;-144;;39;84;;-59;-191;;103
ordre corrélation;;;;;;;;;;;;;;;;;;;;;;;;;

Au niveau de l'ADN le code génétique est structuré par doublets.[modifier | modifier le wikicode]

Lignes et colonnes[modifier | modifier le wikicode]

  • Lien Tableaux: Lignes et colonnes
  • Légende: Les moyennes des codons de la 3ème base appartenant aux doublets ayant la même 1ère base (ligne) ou ayant la même 2ème base (colonne) sont faites sur 4 codons ou sur 3 codons seulement quand on rencontre les codons stop (taa tag) ou le codon ata lorsqu'il est trop faible ( sauf celui des eucaryotes) ou le codon atg à effectif très élevé (sauf celui des eucaryotes). La moyenne des lignes et colonnes est faite sur 12 codons ou seulement 10 quand on rencontre les codons taa tag ata atguand les codons xyt ont des effectifs élevés ils sont permutés avec les codons xyc ( 1 permutation chez les bactéries et 8 chez les eucaryotes). Aussi les lignes et colonnes xyt contiennent les valeurs faibles après permutation et les lignes et colonnes xyc contiennent les valeurs fortes après permutation.
    n pour nombre de codons, mcod pour moyenne des codons, Lig. pour ligne, Col. pour colonne et car. pour carré ou doublet.
    txt, c, a, g pour respectivement les 4 codons "ttt tct tat tgt" de la 3ème base t, les 4 codons "ttc tcc tac tgc" de la 3ème base c . . . etc. (Ligne Lig.)
    xtt, c, a, g pour respectivement les 4 codons "ttt ctt att gtt" de la 3ème base t, les 4 codons "ttc ctc atc gtc" de la 3ème base c . . . etc. (colonne Col.)
  • Tableaux non formatés: voir tableur
− Lignes et colonnes
III LC;Nombres de tRNAs. 155 eucaryotes;;;;;;I LC;Nombres de tRNAs. 4032 bactéries;;;;;;II LC;Nombres de tRNAs. 184 archées;;;;
Lignes;;;Colon;;115 111;;Lignes;;;Colon;;235 027;;Lignes;;;Colon;;8749

Demi-doublets[modifier | modifier le wikicode]

  • Lien Tableaux: Demi-doublets
  • Légende:
    Domaine E: ensemble des 155 eucaryotes avec un total de tRNAs de 115 111.
    Domaine B: ensemble des 4032 bactéries avec un total de tRNAs de 235 027.
    Domaine A: ensemble des 184 archées avec un total de tRNAs de 8 749.
    g/a: rapport des codons xyg sur xya de la ligne x et de la colonne y du tableau des effectifs,   1.4  rapport inverse de g/a.
    t/c: rapport des codons xyc sur xyt de la ligne x et de la colonne y du tableau des effectifs,   16  rapport inverse de t/c.
    t c a g: colonnes du tableau des effectifs
III 100;Nombres de tRNAs. 155 eucaryotes;;;;;III 100;Nombres de tRNAs. 4032 bactéries;;;;;III 100;Nombres de tRNAs. 184 archées;;;

Codons identiques par classement des 3 bases[modifier | modifier le wikicode]

1ère base;;;;;;;;;2ème base;;;;;;;
II 100;Nombres de tRNAs. 184 archées;;;;;;8749;;II 100;Nombres de tRNAs. 184 archées;;;;;;8749
I 100;Nombres de tRNAs. 4032 bactéries ;;;;;;235027;;I 100;Nombres de tRNAs. 4032 bactéries ;;;;;;235027
III 100;Nombres de tRNAs. 155 eucaryotes;;;;;;115111;;III 100;Nombres de tRNAs. 155 eucaryotes;;;;;;115111

Tableau des effectifs élevés des gènes de tRNAs eucaryotes[modifier | modifier le wikicode]

Callorhinchus milii;;;;;;;;;Danio rerio (Zebrafish) ;;;;;;;
Balaenoptera acutorostrata scammoni ;;;;;;;;;Tursiops truncatus (Dolphin);;;;;;;
Bos taurus;;;;;;;;;Felis catus (cat);;;;;;;

Linéarité du code des gènes de tRNA chez les eucaryotes[modifier | modifier le wikicode]

Calculs pour 121 eucaryotes[modifier | modifier le wikicode]

  • Légende:
    ttt ttc . . . nombre de gènes de tRNA des codons ttt ttc . . . relevé de la base de données gtRNAdb au 29.10.17
    moy : moyenne des codons d'un eucaryote. Si la ligne contient les caractères € ou #, les codons correspondants n'entrent pas dans la moyenne comme le fait le tableur calc. Les codons faibles xyc/t ne rentrent pas dans la moyenne.
    pour nombres dépassant 100 dans une 1ère approche du coefficient de détermination R2. Il y en a 61.
    # pour nombres améliorant le coefficient de détermination. Il y en a 13.
    − Doublons: ce sont les eucaryotes qui sont dans la base mais non utilisés pour les diagrammes car ils concernent 2 individus de la même espèce ou des variantes très proches des espèces retenues (voir texte pour plus de détail).
    − Tableau des diagrammes: Il est fait de 121 espèces et de 43 codons. Ne sont pas concernés les codons à faibles effectifs xyc ou xyt.
    − Données non modifiées: Pour repérer les codons omis, en jaune ceux supérieurs à 100 () et en orange les codons d'ajustement (#). Pour comparaison j’ai mis zebrafish sans annotations.
    − codons forts: codons à effectifs élevés. Au total 45. Ne sont pas pris en compte les 16 codons xyc/t faibles et les codons stop tga taa tag.
    + total: total des effectifs restants après suppression des effectifs élevés ou d'ajustement.
    + somme calculée: pente multipliée par la somme des moyennes des eucaryotes ayant perdu le codon omis.
    + totaux + sommes calculées: est le nombre calculé des gènes de tRNA du codon.
    + R2 et pente: coefficient de détermination et pente de la courbe de tendance du diagramme du codon en fonction de la moyenne moy. J'ai opté pour une droite passant par l'origine d'après le tableur calc. R2 a été multiplié par 1000.
    − codons faibles: les 16 codons xyc/t à effectifs faibles.
    + c/t > 3: est le nombre de codons faibles ayant plus de 3 gènes de tRNA.
    + c/t > 3, total: leur total en gènes
    + reste calculé: total des gènes des autres codons plus c/t > 3. C'est la réduction des codons faibles reportés dans la ligne "Totaux des 121 réduits" ci-dessous.
    + multiplicité x 100: division de reste calculé par 121 en %.
    + c/t = 3: est le nombre de codons faibles ayant 3 gènes de tRNA (pour illustration).
    − Totaux des 121 réduits: ils sont reportés dans le tableau synthétique "IV. nombre des 121 eucaryotes".
    − KEGG [3]: nomenclature de l'eucaryote dans la base KEGG, bta par exemple. Surmonté d'un * le code n'est pas celui de KEGG, mais attribué pour homogénéité.
  • Tableau des calculs pour 121 eucaryotes sélectionnés.
Gènes de tRNA eucaryotes, doublons.;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
1327;4180;bta;Bos taurus (cow) (Baylor Btau_4.6.1 Oct 2011);;;;;86.7;7;31;10;14;10;0;5;8;17;0;8;33;23;0;23;46;14;30;6;7;12;0;9;5;15;1;10;7;30;2;36;18;11;38;0;0;4;22;19;43;0;40;83;40;7;47;456;172;156;351;26;187;14;10;12;15;4;18;45;114;20;61;401;1,327
46;758;cre*;Caenorhabditis remanei (WUGSC 15.0.1 May 2007);;;;;16.7;0;18;6;12;24;0;7;4;25;1;14;24;28;0;4;9;16;0;10;6;7;2;41;6;18;0;10;6;27;0;15;6;0;22;0;0;1;22;23;9;1;23;20;33;0;36;23;25;0;14;0;17;25;0;11;1;0;9;13;5;0;28;46;5
38;600;hsa;Homo sapiens (hg19 - NCBI Build 37.1 Feb 2009);;;;;12.8;0;15;9;12;12;0;4;11;18;6;5;20;12;1;8;17;12;1;6;4;10;1;8;4;10;0;6;7;31;1;10;5;5;32;0;0;0;10;18;22;2;34;20;24;1;17;14;10;1;38;3;8;7;0;6;4;1;8;7;5;0;15;9;13
33;508;yli;Yarrowia lipolytica WSH-Z06;;;;;11.3;0;17;1;3;21;0;2;13;26;0;1;18;24;0;2;8;21;0;2;4;21;0;3;2;22;0;3;2;29;0;4;2;0;14;0;0;0;12;3;15;0;16;4;33;0;28;6;27;0;8;0;13;1;0;25;0;0;6;4;1;0;30;11;0
34;484;yli;Yarrowia lipolytica PO1f;;;;;10.8;0;18;1;3;18;0;2;12;26;0;1;18;24;0;2;8;21;0;2;4;21;0;3;2;22;0;3;3;29;0;4;2;0;14;0;0;0;12;3;15;0;15;4;34;0;24;6;22;0;8;0;13;1;0;24;0;0;6;4;1;0;18;11;0
57;432;mmu;Mus musculus (mm9 July 2007);;;;;9.4;0;7;4;4;8;0;3;10;11;1;5;18;8;1;3;11;9;1;3;3;7;0;8;3;9;0;4;5;19;0;11;10;0;10;0;0;1;10;6;10;0;14;11;19;0;16;8;13;0;57;2;8;6;0;3;5;0;8;5;5;1;14;7;7
16;315;dwi;Drosophila willistoni (D. willistoni Feb. 2006);;;;;6.8;0;7;3;7;4;1;2;9;9;2;4;15;8;1;5;5;8;1;3;3;7;0;5;4;7;1;7;4;11;0;6;2;0;8;0;0;0;8;4;6;0;10;8;10;0;16;11;12;0;12;1;7;10;0;7;1;0;6;4;5;0;12;6;0
17;305;dan;Drosophila ananassae (D. ananassae Feb. 2006 Agencourt CAF1);;;;;6.7;0;8;2;4;5;0;2;10;11;0;2;12;7;0;2;7;6;0;3;6;4;0;4;8;9;0;7;3;10;0;4;6;0;9;0;0;0;5;4;8;0;10;7;17;0;13;6;14;1;6;1;6;12;0;8;0;0;6;3;2;0;16;6;3
18;293;dpe;Drosophila persimilis (D. persimilis Oct. 2005 Broad);;;;;6.5;0;7;1;3;5;0;2;10;11;0;2;11;7;0;2;5;9;0;2;5;6;0;6;4;8;0;8;3;11;0;2;3;0;9;0;0;0;7;4;7;0;9;4;14;0;18;6;14;0;8;1;8;13;0;5;0;0;5;2;4;0;13;6;3
18;292;dpo;Drosophila pseudoobscura (D. pseudoobscura Feb. 2006);;;;;6.5;0;7;2;4;5;0;2;9;10;0;2;11;7;0;2;6;11;0;2;3;3;0;6;4;8;0;8;4;12;0;3;3;0;9;0;0;0;5;4;7;0;9;5;12;0;14;6;18;0;11;1;8;9;0;4;0;0;5;3;5;0;14;6;3
15;291;des;Drosophila sechellia (D. sechellia Oct. 2005 Broad);;;;;6.4;0;9;4;4;5;0;2;8;10;0;2;15;8;0;2;8;8;0;2;4;7;0;5;5;9;0;6;5;13;0;2;3;0;9;0;0;0;7;2;8;0;9;4;12;0;13;5;13;0;6;1;8;9;0;7;0;0;6;3;4;0;13;6;0
14;282;der;Drosophila erecta (D. erecta Feb. 2006 Agencourt CAF1);;;;;6.2;0;9;3;4;5;0;2;7;9;0;2;12;7;0;2;7;9;0;2;4;5;0;5;5;8;0;6;3;12;0;2;3;0;8;0;0;0;6;4;8;0;8;5;11;0;14;6;13;1;6;1;8;9;0;7;0;0;6;3;4;0;14;1;6
14;268;dvi;Drosophila virilis (D. virilis Feb. 2006 Agencourt CAF1);;;;;5.9;0;8;2;5;3;0;3;7;9;0;2;12;6;0;2;7;6;0;2;4;4;0;3;5;7;0;7;4;8;0;3;3;0;10;0;0;0;5;4;7;0;7;12;12;0;13;6;10;0;8;1;6;10;0;5;0;0;5;2;2;0;14;6;1
14;262;dmo;Drosophila mojavensis (D. mojavensis Feb. 2006 Agencourt CAF1);;;;;5.8;0;8;2;6;3;0;2;6;8;0;2;12;6;0;2;6;6;0;2;4;6;0;5;3;7;0;8;4;9;0;4;3;0;7;0;0;0;5;4;7;0;8;8;11;0;12;6;11;0;7;1;6;10;0;5;0;0;5;2;2;0;14;6;1
18;259;dgr;Drosophila grimshawi (D. grimshawi Feb. 2006 Agencourt CAF1);;;;;5.7;0;9;2;4;4;0;2;7;7;0;2;10;6;0;2;6;6;0;2;4;4;0;4;5;7;0;8;4;8;0;3;3;0;10;0;0;0;5;3;12;0;7;7;12;0;12;6;10;0;6;1;6;9;0;4;0;0;3;3;2;0;18;4;0
24;296;fpu;Fusarium pseudograminearum CS3096;;;;;6.6;0;9;1;3;17;0;2;5;10;0;2;6;19;0;2;3;11;0;2;2;9;0;3;2;10;0;4;3;14;0;4;3;0;9;0;0;0;6;5;6;0;8;2;17;0;9;4;24;0;5;0;4;11;0;8;1;0;9;1;2;0;13;5;1
19;292;fpu;Fusarium pseudograminearum CS3270;;;;;6.5;0;10;1;3;13;0;2;5;13;0;2;6;17;0;2;3;11;0;2;2;10;0;3;2;10;0;4;3;13;0;4;3;0;8;0;0;0;6;5;6;0;9;2;16;0;13;4;19;0;5;0;4;11;0;9;1;0;8;1;2;0;13;5;1
17;280;sceb*;Saccharomyces sp. boulardii 17;;;;;6.2;0;11;6;9;0;1;3;0;13;0;3;10;15;0;3;2;11;0;3;1;2;0;10;0;9;0;4;1;8;0;5;0;0;9;0;0;0;7;9;1;0;9;7;15;0;17;14;2;0;4;0;6;7;0;0;1;0;4;13;1;1;17;4;2
15;263;sceb*;Saccharomyces sp. boulardii ATCC MYA-796;;;;;5.8;0;11;7;9;0;1;3;0;12;0;2;10;13;0;2;2;10;0;3;1;2;0;10;0;10;0;5;1;11;0;5;0;0;8;0;0;0;8;7;1;0;8;7;13;0;14;13;2;0;4;0;6;6;0;0;1;0;4;10;1;0;15;3;2
14;265;ndi;Naumovozyma dairenensis CBS 421;;;;;5.9;0;9;9;8;1;0;4;0;12;0;2;9;14;0;2;2;11;0;3;1;1;0;11;0;11;0;5;2;10;0;5;0;0;9;0;0;0;7;10;1;0;9;8;12;0;13;13;1;0;5;0;5;5;0;0;2;0;5;11;1;0;12;3;1
13;224;vda;Verticillium dahliae JR2;;;;;4.9;0;7;1;1;8;0;1;4;10;0;0;9;11;0;1;2;6;1;2;4;8;0;3;2;8;0;2;3;11;0;2;4;0;6;0;0;0;6;2;5;0;6;2;12;0;9;2;12;0;5;1;3;9;0;2;2;0;5;3;2;0;13;3;3
11;178;afm;Aspergillus fumigatus Af293;;;;;4.0;0;5;1;2;6;0;0;4;7;0;1;8;7;0;1;2;5;0;1;2;5;0;2;2;6;0;3;2;8;0;3;2;0;5;0;0;0;4;2;6;0;5;1;8;0;9;4;8;0;3;0;3;9;0;2;2;0;4;1;2;0;11;3;1
10;141;cgi;Cryptococcus gattii WM276;;;;;3.1;0;5;1;3;6;0;0;1;6;0;1;6;7;0;0;2;6;0;1;1;6;0;1;0;5;0;1;1;7;0;1;2;0;4;0;0;0;4;2;3;0;4;1;7;0;0;3;10;0;3;0;3;3;0;5;1;0;2;1;3;0;9;3;0
9;139;cne;Cryptococcus neoformans var. neoformans JEC21;;;;;3.1;0;5;1;3;6;0;0;1;6;0;1;6;7;0;0;2;6;0;1;1;5;0;1;0;5;0;1;1;7;0;1;2;0;4;0;0;0;4;2;3;0;4;1;7;0;0;3;9;0;3;0;3;3;0;5;1;0;2;1;3;0;9;3;0
9;137;cnb;Cryptococcus neoformans var. neoformans B-3501A;;;;;3.0;0;5;1;3;6;0;0;1;6;0;1;6;7;0;0;2;4;0;1;1;5;0;1;0;5;0;1;1;7;0;1;2;0;4;0;0;0;4;2;3;0;4;1;7;0;0;3;9;0;3;0;3;3;0;5;1;0;2;1;3;0;9;3;0
8;130;cdu;Candida dubliniensis CD36;;;;;2.9;0;5;5;5;2;0;0;1;6;0;1;4;8;0;1;1;4;0;3;1;1;0;5;0;5;0;2;1;6;0;2;0;0;4;0;0;0;3;4;1;0;4;5;3;0;6;7;1;0;2;0;2;2;0;0;1;0;1;5;1;0;6;2;1
6;123;kpa*;Komagataella pastoris GS115;;;;;2.7;0;5;1;3;2;0;1;2;5;0;1;4;5;0;1;1;4;0;2;1;2;0;4;1;5;0;1;1;5;0;2;0;0;4;0;0;0;3;3;2;0;4;3;5;0;6;5;4;0;2;0;3;2;0;1;1;0;2;4;1;0;5;3;1
2;46;ehe;Encephalitozoon hellem ATCC 50504;;;;;1.0;0;1;1;1;1;0;1;1;1;0;1;2;1;0;1;1;1;0;1;1;1;0;1;1;1;0;1;1;1;0;1;1;0;1;0;0;0;1;1;1;0;2;1;1;0;1;1;1;0;1;0;1;1;0;1;0;0;1;1;1;0;1;1;1
2;46;ein;Encephalitozoon intestinalis ATCC 50506;;;;;1.0;0;1;1;1;1;0;1;1;1;0;1;2;1;0;1;1;1;0;1;1;1;0;1;1;1;0;1;1;1;0;1;1;0;1;0;0;0;1;1;1;0;2;1;1;0;1;1;1;0;1;0;1;1;0;1;0;0;1;1;1;0;1;1;1
2;46;ero;Encephalitozoon romaleae SJ-2008;;;;;1.0;0;1;1;1;1;0;1;1;1;0;1;2;1;0;1;1;1;0;1;1;1;0;1;1;1;0;1;1;1;0;1;1;0;1;0;0;0;1;1;1;0;2;1;1;0;1;1;1;0;1;0;1;1;0;1;0;0;1;1;1;0;1;1;1
Tableau des diagrammes des pentes;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
2;35;pfa;Plasmodium falciparum;;;;;0.78;0;1;1;1;1;0;1;1;1;0;1;2;1;0;1;1;1;0;1;1;1;0;1;1;0;0;1;1;1;0;1;1;0;1;0;0;0;0;1;1;0;1;0;0;0;1;1;1;0;0;0;0;0;0;1;0;0;1;1;0;0;0;1;0
2;46;ecu;Encephalitozoon cuniculi GB-M1;;;;;1.02;0;1;1;1;1;0;1;1;1;0;1;2;1;0;1;1;1;0;1;1;1;0;1;1;1;0;1;1;1;0;1;1;0;1;0;0;0;1;1;1;0;2;1;1;0;1;1;1;0;1;0;1;1;0;1;0;0;1;1;1;0;1;1;1
2;53;ede*;Exophiala dermatitidis NIH/UT8656;;;;;1.16;0;1;1;1;1;1;1;1;2;0;1;1;2;0;1;1;1;0;1;1;0;0;1;1;2;0;1;1;2;0;1;1;0;1;0;0;0;2;1;1;0;1;1;0;0;2;1;2;0;1;0;0;2;0;2;1;0;1;0;1;0;2;1;2
4;80;opa*;Ogataea parapolymorpha DL-1;;;;;1.78;0;3;1;3;1;0;1;1;4;0;1;4;3;0;0;1;2;0;1;1;0;0;3;0;3;0;1;1;3;0;2;0;0;2;0;0;0;2;2;1;0;2;2;3;0;3;2;3;0;1;0;2;2;0;0;1;0;2;3;1;0;4;2;0
5;82;cot;Candida orthopsilosis Co 90-125;;;;;1.82;0;2;3;1;1;0;0;1;4;0;1;4;4;0;1;1;2;0;2;1;1;0;3;0;4;0;2;1;3;0;2;0;0;3;0;0;0;1;3;1;0;3;4;3;0;5;2;1;0;1;0;1;2;0;0;1;0;1;2;1;0;2;1;0
4;82;lma;Leishmania major;;;;;1.82;0;2;1;1;3;0;1;2;3;0;1;4;2;0;1;2;1;0;1;1;2;0;1;2;3;0;1;2;2;0;1;2;0;3;0;0;0;2;1;3;0;3;1;3;0;3;1;2;0;1;0;1;4;0;1;1;0;2;1;1;0;4;1;1
6;96;sre*;Sporisorium reilianum SRZ2;;;;;2.11;0;4;1;0;4;0;1;2;4;0;1;4;4;0;1;0;2;0;1;2;3;0;1;1;4;0;1;1;3;0;1;1;0;2;0;0;0;3;3;2;0;3;1;5;0;3;2;4;0;2;1;2;4;0;2;0;0;0;1;1;0;6;1;1
6;111;uma;Ustilago maydis 521;;;;;2.40;0;3;1;0;4;0;2;2;4;0;1;4;4;0;1;1;3;0;1;3;4;1;1;1;4;0;1;1;5;0;1;1;0;3;0;0;0;2;2;3;0;3;1;5;0;5;2;5;0;2;2;2;4;0;3;0;0;2;1;1;0;6;2;1
6;123;kpa*;Komagataella pastoris CBS 7435;;;;;2.73;0;5;1;3;2;0;1;2;5;0;1;4;5;0;1;1;4;0;2;1;2;0;4;1;5;0;1;1;5;0;2;0;0;4;0;0;0;3;3;2;0;4;3;5;0;6;5;4;0;2;0;3;2;0;1;1;0;2;4;1;0;5;3;1
6;125;cal;Candida albicans WO-1;;;;;2.78;0;5;5;6;2;0;0;1;6;0;1;4;6;0;1;1;4;0;3;1;1;0;4;0;4;0;2;1;6;0;2;0;0;4;0;0;0;3;5;1;0;3;5;2;0;6;6;1;0;2;0;2;2;0;0;1;0;2;5;1;0;5;2;1
10;143;cneg*;Cryptococcus neoformans var. grubii H99;;;;;3.18;0;5;1;3;6;0;0;1;6;0;1;7;7;0;0;2;6;0;1;1;6;0;1;0;5;0;1;1;8;0;1;2;0;4;0;0;0;4;2;3;0;4;1;7;0;0;3;10;0;3;0;3;3;0;5;1;0;2;1;3;0;9;3;0
10;154;ttt;Thielavia terrestris NRRL 8126;;;;;3.42;0;5;5;1;5;0;1;4;6;0;1;5;6;0;1;3;3;0;1;3;4;0;2;3;4;0;1;2;7;0;2;3;0;4;0;0;0;3;2;4;0;3;2;6;0;6;2;7;0;3;0;4;6;0;1;3;0;3;1;2;0;10;2;2
11;155;mgp;Meleagris gallopavo (turkey) (TGC Turkey_2.01 Dec 2009);;;;;3.42;0;6;1;2;1;0;1;4;3;0;1;11;3;1;2;3;5;0;3;1;7;0;2;1;4;0;2;0;7;0;6;3;0;6;0;0;0;3;1;1;0;4;4;3;0;3;5;6;0;5;0;5;2;0;1;2;0;6;3;3;0;5;4;3
9;156;vma*;Valsa mali 03-8;;;;;3.47;0;4;0;2;5;0;1;4;7;0;1;8;7;0;1;2;5;0;1;2;0;0;2;1;4;0;3;2;7;0;2;2;0;4;0;0;0;5;2;4;0;5;0;9;0;6;3;9;0;3;0;3;6;0;2;2;0;3;1;2;0;9;3;2
9;158;kna*;Kazachstania naganishii CBS 8797;;;;;3.51;0;6;3;5;1;0;3;0;7;0;2;4;7;0;1;2;7;0;1;1;1;0;6;0;7;0;2;1;7;0;1;1;0;5;0;0;0;4;4;2;0;6;4;7;0;8;5;3;0;4;0;4;3;0;0;1;0;3;6;1;0;9;1;2
9;162;kla;Kluyveromyces lactis NRRL Y-1140;;;;;3.58;0;5;3;7;0;1;2;0;7;0;1;6;7;0;1;2;6;0;2;1;1;0;7;0;6;0;2;1;7;0;3;0;0;5;0;0;0;4;6;1;0;6;4;9;0;8;8;2;0;3;0;4;3;0;0;1;0;2;7;1;0;7;2;1
9;168;spo;Schizosaccharomyces pombe 972h-;;;;;3.73;0;5;2;4;5;0;1;1;8;0;1;7;9;0;2;1;7;0;2;1;6;0;2;1;7;0;2;1;6;0;2;1;0;4;0;0;0;4;4;2;0;6;3;9;0;8;4;6;0;3;0;3;8;0;1;1;0;3;2;1;0;8;3;1
10;170;pic;Scheffersomyces stipitis CBS 6054;;;;;3.78;0;6;3;8;3;0;0;1;7;0;1;6;7;0;2;1;6;0;2;2;1;0;6;0;7;0;2;1;7;0;3;0;0;5;0;0;0;4;5;2;0;7;3;9;0;8;8;2;0;3;0;4;3;0;0;1;0;2;7;1;0;10;3;1
11;181;ani;Aspergillus nidulans FGSC A4;;;;;4.02;0;5;1;2;6;0;2;3;7;0;1;7;8;0;1;2;5;0;1;2;6;0;2;2;6;0;2;2;8;0;2;3;0;6;0;0;0;5;2;5;0;6;2;8;0;8;3;8;0;3;0;3;9;0;2;2;0;4;2;2;0;11;3;1
14;190;mgr;Magnaporthe oryzae 70-15;;;;;4.22;0;7;1;2;7;0;1;4;8;0;1;8;6;0;1;2;4;0;2;3;5;0;2;2;6;0;2;2;9;0;3;2;0;5;0;0;0;4;2;6;0;6;2;9;0;10;3;9;0;3;0;4;6;0;2;2;0;3;1;3;0;14;3;3
13;191;mun*;Melopsittacus undulatus (Budgerigar Sep. 2011 WUSTL v6.3/melUnd1);;;;;4.18;0;6;4;3;3;0;0;6;5;0;1;9;3;1;1;4;4;1;3;1;2;0;3;2;5;0;2;0;9;0;5;2;0;7;0;0;0;4;2;4;0;9;3;13;0;9;3;1;0;5;1;4;3;0;1;1;0;8;4;4;0;10;9;1
11;191;cjd*;Cyberlindnera jadinii NBRC 0988 NBRC0988;;;;;4.20;0;8;1;7;4;0;3;1;6;1;1;7;9;0;2;3;7;0;3;1;0;0;7;0;6;0;3;1;6;0;3;0;0;5;0;0;0;6;6;2;0;7;5;8;0;8;4;9;0;3;1;4;6;0;0;1;0;3;7;0;0;11;4;1
12;192;tdl;Torulaspora delbrueckii CBS 1146;;;;;4.24;0;6;3;8;0;1;4;0;8;0;1;7;12;0;1;2;7;0;2;1;1;0;6;0;9;0;2;1;8;0;4;0;0;6;0;0;0;4;6;2;0;7;5;10;0;9;8;4;0;3;0;4;4;0;0;1;0;3;7;1;0;11;2;1
12;192;pch*;Penicillium chrysogenum P2niaD18;;;;;4.22;0;5;0;0;6;1;0;3;10;0;2;10;9;0;1;3;7;0;1;2;0;0;0;1;12;0;3;2;8;0;2;2;0;5;0;0;0;11;3;5;0;6;1;9;0;9;3;10;0;3;1;0;10;0;2;2;0;4;0;2;0;11;4;1
11;192;mth*;Myceliophthora thermophila ATCC 42464;;;;;4.24;0;5;1;2;7;0;1;4;8;0;1;8;7;0;2;3;5;0;3;3;6;0;2;3;6;0;2;3;7;0;2;3;0;6;0;0;0;4;2;5;0;6;3;9;0;10;2;8;0;3;1;4;7;0;1;2;0;5;1;2;0;11;4;2
16;203;gfr;Geospiza fortis (Medium ground finch Apr. 2012 GeoFor_1.0/geoFor1);;;;;4.44;0;6;11;2;4;0;7;0;6;1;2;6;2;1;1;3;2;0;3;1;4;0;5;1;5;0;4;1;16;0;5;2;0;12;0;0;0;4;2;3;1;6;4;7;0;5;4;6;0;10;0;3;6;0;2;0;0;6;3;2;0;8;4;4
11;205;sas*;Saccharomycetaceae sp. Ashbya aceri;;;;;4.51;0;7;3;7;0;1;4;1;9;0;1;10;7;0;3;4;7;0;3;3;1;0;7;0;7;0;3;2;7;0;5;2;0;5;0;0;0;5;4;4;0;8;4;9;0;10;3;8;0;3;1;5;4;0;0;2;0;3;7;1;0;11;2;2
13;206;tpf;Tetrapisispora phaffii CBS 4417;;;;;4.56;0;9;9;2;0;1;2;0;10;0;2;8;10;0;2;1;8;0;2;1;1;0;7;0;9;0;2;1;9;0;3;0;0;6;0;0;0;5;7;1;0;9;6;9;0;12;11;1;0;4;0;4;3;0;0;1;0;3;8;1;0;13;2;1
12;207;cgr;Candida glabrata CBS 138;;;;;4.58;0;6;3;8;0;1;4;0;9;0;2;7;10;0;2;1;9;0;2;1;1;0;7;0;9;0;3;1;10;0;5;0;0;6;0;0;0;6;6;2;0;9;3;12;0;9;9;3;0;3;0;5;4;0;0;1;0;3;9;1;0;12;2;1
12;211;acs;Anolis carolinensis (lizard) (Broad AnoCar2.0 May 2010);;;;;4.64;0;5;2;2;4;0;3;4;6;0;1;12;5;0;2;3;5;0;1;2;3;1;3;2;4;0;3;1;12;0;6;3;0;6;0;0;0;5;3;5;0;10;5;6;0;8;7;5;0;12;1;7;4;0;3;1;0;5;3;3;0;7;8;2
10;212;bfu;Botrytis cinerea B05.10;;;;;4.69;0;7;2;5;6;0;1;1;8;0;1;8;8;0;2;2;7;0;3;2;4;0;7;1;6;0;3;0;8;0;5;2;0;6;0;0;0;4;6;2;0;6;3;10;0;9;6;9;0;5;0;6;6;0;4;2;0;5;5;1;1;8;2;7
11;214;dha;Debaryomyces hansenii CBS767;;;;;4.71;0;8;9;4;2;0;0;1;9;1;2;10;10;0;1;1;6;0;4;1;1;0;7;0;8;0;2;1;7;0;5;1;0;6;0;0;0;6;7;1;0;9;8;10;0;10;9;1;0;4;1;4;5;0;0;1;0;3;10;1;0;11;5;1
13;225;vda;Verticillium dahliae VdLs.17;;;;;4.93;0;7;1;1;8;0;1;4;9;0;0;9;11;0;1;2;6;1;2;4;8;0;3;2;8;0;2;3;11;0;2;4;1;6;0;0;0;6;2;5;0;6;2;12;0;10;2;12;0;5;1;3;9;0;2;2;0;5;3;2;0;13;3;3
15;229;lth;Lachancea thermotolerans CBS 6340;;;;;5.04;0;7;2;8;0;2;3;3;10;0;1;8;11;0;1;3;9;0;2;2;2;0;8;0;9;0;2;1;10;0;3;2;0;6;0;0;0;5;5;5;0;7;4;14;0;10;6;11;0;4;0;5;4;0;0;1;0;3;9;1;0;15;3;2
21;230;tgu;Taeniopygia guttata (Zebra finch Feb. 2013 WashU taeGut324/taeGut2);;;;;4.87;0;10;4;4;1;0;1;7;21;2;1;5;3;2;1;1;3;0;2;1;6;0;1;2;8;1;4;2;18;0;7;3;0;13;0;0;0;5;1;6;2;8;4;5;0;7;2;3;1;9;1;3;6;0;2;0;1;5;3;2;1;8;7;4
15;242;aor;Aspergillus oryzae RIB40;;;;;5.31;0;7;2;0;0;0;1;4;10;0;2;6;10;1;2;3;7;0;1;3;9;0;2;0;10;0;2;2;10;0;3;4;1;13;0;0;0;8;4;7;0;8;3;11;0;13;6;11;1;4;0;4;12;0;2;3;0;6;2;2;0;15;4;1
27;252;mlu*;Myotis lucifugus (Microbat Jul. 2010 Broad Institute Myoluc2.0/myoLuc2);;;;;5.49;0;5;2;3;3;0;5;2;10;0;3;14;5;0;3;5;6;0;2;2;6;0;3;3;5;0;5;3;8;0;1;3;0;5;0;0;5;7;3;7;0;9;3;11;0;8;5;6;0;27;0;4;6;0;5;2;0;5;5;5;0;8;6;3
15;256;dsi;Drosophila simulans (D. simulans Apr. 2005 WUGSC mosaic 1.0);;;;;5.67;0;8;3;4;5;0;2;9;8;0;0;12;7;0;2;6;8;0;2;3;6;0;5;5;8;0;5;4;9;0;5;0;0;10;0;0;0;6;4;8;0;6;4;11;0;6;5;10;0;7;1;9;9;0;5;0;0;3;3;3;0;15;5;0
20;258;mmr*;Microcebus murinus (Mouse lemur) (Jun 2003);;;;;5.71;0;8;3;3;5;0;2;7;4;0;3;14;4;0;2;5;7;0;2;3;7;0;4;3;3;0;3;2;11;0;5;3;0;8;0;0;0;6;4;12;0;9;5;6;0;5;9;8;1;20;0;6;6;0;3;2;0;7;5;3;0;11;7;2
15;258;lkl*;Lachancea kluyveri NRRL Y-12651;;;;;5.69;0;8;3;11;0;1;3;0;12;0;1;10;14;0;1;3;11;0;2;1;1;1;10;0;12;0;2;1;13;0;4;0;0;7;0;0;0;6;10;1;0;9;5;14;0;13;13;3;0;5;0;5;5;0;0;1;0;4;12;1;0;15;2;2
17;266;kaf;Kazachstania africana CBS 2517;;;;;5.91;0;9;14;2;2;0;2;0;13;0;2;9;13;0;2;1;11;0;4;1;1;0;10;0;11;0;3;1;12;0;5;0;0;9;0;0;0;6;9;1;0;10;8;12;0;13;15;2;0;5;0;6;4;0;0;1;0;4;11;1;0;17;3;1
14;270;ncs;Naumovozyma castellii CBS 4309;;;;;6.00;0;10;7;9;2;0;3;0;12;0;2;9;13;0;2;2;12;0;4;1;1;0;10;0;11;0;3;2;12;0;5;0;0;9;0;0;0;8;9;1;0;10;8;14;0;14;13;1;0;4;0;7;5;0;0;2;0;4;10;1;0;13;3;2
16;270;fgr;Fusarium graminearum CS3005;;;;;5.98;0;9;1;3;6;0;2;5;11;0;2;5;16;0;2;3;11;0;2;2;10;0;3;2;11;0;4;3;13;0;3;3;0;6;0;0;0;7;5;7;0;9;2;12;0;10;4;13;0;5;1;4;10;0;9;1;0;8;2;2;0;15;5;1
17;272;zro;Zygosaccharomyces rouxii CBS 732;;;;;6.00;0;8;4;10;0;1;5;0;11;1;1;9;12;0;2;4;12;0;3;2;3;0;10;0;10;0;2;2;12;0;9;0;0;7;0;0;0;6;10;3;0;9;7;14;0;14;10;4;0;4;0;6;5;0;0;1;0;5;8;2;0;17;5;2
15;273;fve*;Flammulina velutipes KACC42780;;;;;5.98;2;15;1;4;6;0;2;2;10;0;2;14;7;0;3;3;7;0;2;3;4;0;4;2;7;0;3;4;13;0;9;5;0;6;0;0;0;3;4;6;1;12;6;11;1;2;6;11;0;4;0;4;13;0;8;2;0;4;2;6;0;11;8;8
16;275;sce;Saccharomyces cerevisiae (S288c Apr 2011);;;;;6.09;0;10;7;10;0;1;3;0;13;0;2;10;14;0;2;2;11;0;3;1;2;0;10;0;11;0;4;1;11;0;5;0;0;8;0;0;0;7;9;1;0;10;7;14;0;16;14;2;0;4;0;6;6;0;0;1;0;4;11;1;0;16;3;2
24;283;gga;Gallus gallus (galGal4 Nov 2011);;;;;6.24;0;10;3;3;3;0;2;7;7;0;2;14;7;1;3;7;9;0;4;2;7;0;4;3;4;0;4;2;24;0;7;4;0;16;0;0;0;6;2;5;0;11;6;6;0;10;9;7;0;11;1;6;8;0;2;2;0;7;4;3;0;7;7;4
16;285;fvr;Fusarium verticillioides 7600;;;;;6.33;0;10;2;4;12;0;2;5;11;0;1;8;13;0;2;3;10;0;2;3;10;0;3;2;11;0;4;2;14;0;3;3;0;8;0;0;0;6;4;8;0;8;2;15;0;14;5;16;0;5;0;5;10;0;7;1;0;7;2;2;0;14;5;1
16;288;mfa*;Millerozyma farinosa CBS 7064;;;;;6.40;0;10;4;14;4;0;0;2;12;0;4;10;12;0;2;4;10;0;4;2;2;0;8;0;10;0;4;2;12;0;8;2;0;10;0;0;0;8;8;4;0;12;6;10;0;14;8;8;0;4;0;6;4;0;0;2;0;6;10;2;0;16;6;2
14;289;dme;Drosophila melanogaster (D. melanogaster Aug. 2014 BDGP Release 6 + ISO1 MT/dm6);;;;;6.40;0;8;4;4;4;0;2;8;9;0;2;12;6;0;2;7;8;0;2;4;7;0;5;5;8;0;6;3;12;0;2;3;0;9;0;0;0;5;4;8;0;10;6;13;0;14;6;13;0;7;1;8;10;0;10;0;0;6;3;3;0;14;6;0
19;305;fgr;Fusarium graminearum PH-1 NRRL 31084;;;;;6.76;0;11;2;3;13;0;2;5;13;0;2;6;19;0;2;3;11;0;2;2;10;0;3;2;11;0;4;3;14;0;4;2;0;8;0;0;0;7;5;7;0;9;3;16;0;14;5;19;0;5;1;4;10;0;9;1;0;8;2;2;0;14;6;1
21;326;oga*;Otolemur garnettii (Bushbaby Mar. 2011 Broad/otoGar3);;;;;6.96;1;6;3;5;4;0;3;9;10;9;11;13;6;0;3;5;6;0;3;3;7;0;4;3;9;0;6;3;13;0;7;3;0;8;0;0;0;8;5;9;0;12;11;9;0;13;5;8;0;21;1;6;6;0;4;3;2;7;4;5;0;12;9;3
18;326;dya;Drosophila yakuba (D. yakuba Nov. 2005 WUGSC 7.1);;;;;7.22;0;9;5;4;5;0;2;8;10;0;2;15;7;0;2;10;9;0;2;5;6;0;8;5;8;0;6;5;18;0;2;5;0;9;0;0;0;5;4;8;0;11;6;16;0;15;7;14;0;8;1;8;12;0;7;0;0;6;3;4;0;16;7;1
23;328;tbl;Tetrapisispora blattae CBS 6284;;;;;7.27;0;12;12;9;0;1;2;0;17;0;2;11;18;0;2;1;16;0;4;2;1;0;13;0;15;0;3;1;19;0;5;0;0;9;0;0;0;7;10;1;0;11;9;15;0;19;16;1;0;5;0;7;4;0;0;1;0;6;13;1;0;23;3;1
19;334;sbq;Saimiri boliviensis (Squirrel monkey Oct. 2011 Broad/saiBol1);;;;;7.27;0;9;8;5;6;0;4;5;10;1;6;14;6;1;4;7;9;1;3;3;9;0;5;4;8;0;6;5;15;0;8;5;1;8;0;0;0;8;6;10;0;11;12;9;0;9;10;5;0;19;3;6;6;0;4;3;0;7;5;5;0;10;6;4
17;338;opr*;Ochotona princeps (Pika May 2012 OchPri3.0/ochPri3);;;;;7.49;0;10;3;4;5;0;5;11;8;0;4;15;7;0;4;7;7;0;3;4;8;0;4;4;7;0;6;7;15;0;7;4;0;10;0;0;0;5;5;12;0;14;9;11;0;14;7;11;0;10;1;6;7;0;6;4;0;7;5;6;0;17;7;5
29;353;meu*;Macropus eugenii (Wallaby Sep. 2009 TWGS Meug_1.1/macEug2);;;;;7.62;1;10;3;8;5;0;4;6;6;0;6;14;8;0;1;7;8;0;4;2;7;0;4;2;8;0;6;3;13;0;6;5;1;8;0;0;1;7;4;7;0;14;10;11;0;13;12;7;0;29;7;8;7;0;3;5;0;10;7;4;0;16;10;5
46;367;hgl;Heterocephalus glaber (Naked mole-rat Jan. 2012 Broad HetGla_female_1.0/hetGla2);;;;;7.62;0;6;4;5;5;0;5;5;8;0;3;14;12;1;4;6;7;0;3;3;13;0;5;3;15;2;4;4;46;6;5;6;0;7;0;0;0;7;3;6;0;9;8;15;2;10;6;4;0;23;7;6;5;0;4;4;2;7;6;5;4;10;4;3
20;373;lcm;Latimeria chalumnae (Coelacanth Aug. 2011 Broad/latCha1);;;;;7.96;0;7;11;4;4;0;5;8;7;0;7;11;3;0;7;4;3;0;6;3;12;0;10;4;11;0;9;2;5;0;20;3;2;8;0;0;0;5;10;9;3;9;20;13;1;19;11;8;5;17;4;15;4;0;1;4;0;8;9;8;0;7;5;2
25;374;san*;Sorex araneus (Shrew Aug. 2008 Broad/sorAra2);;;;;8.24;0;10;4;4;6;1;2;13;15;0;5;15;7;0;5;7;8;0;3;4;8;0;6;2;8;0;5;5;10;0;8;3;0;9;0;0;0;7;5;7;0;12;8;13;0;19;10;14;0;25;2;6;9;0;5;3;0;8;6;6;0;22;12;2
34;383;cpo*;Cavia porcellus (Guinea pig) (Broad Feb 2008);;;;;8.36;0;8;4;6;5;0;3;6;10;0;5;15;6;1;3;6;8;0;3;4;8;0;4;3;10;0;4;3;28;4;9;5;0;15;0;0;0;8;4;8;0;18;11;26;1;10;6;5;0;34;1;8;7;0;4;3;0;10;5;5;0;11;6;6
26;396;ncr;Neurospora crassa OR74A;;;;;8.78;0;12;1;5;17;0;2;6;17;1;1;17;19;0;2;4;14;0;3;4;11;0;4;4;12;0;3;3;19;0;3;5;0;10;0;0;0;9;3;11;0;12;2;24;0;18;5;24;0;7;0;7;21;0;2;3;0;6;5;5;0;26;4;3
40;407;rno;Rattus norvegicus (rn5 Mar 2012);;;;;8.89;1;8;3;0;1;0;1;5;12;0;3;13;8;0;3;7;11;0;4;3;33;0;6;3;9;0;5;4;36;2;9;4;0;2;0;0;0;10;6;10;0;15;1;19;2;15;10;8;0;40;1;8;6;0;3;5;1;12;6;8;0;11;9;5
30;408;cjc;Callithrix jacchus (marmoset) (WUGSC 3.2 Mar 2009);;;;;8.80;0;8;9;6;7;0;3;11;9;2;5;19;6;1;4;10;9;0;5;4;7;0;6;4;9;1;6;4;15;1;5;4;0;19;0;0;1;8;4;12;0;23;14;11;1;13;11;12;0;30;2;6;6;3;4;3;0;8;5;5;0;14;9;4
28;411;pha*;Papio hamadryas (baboon) (Nov 2008);;;;;8.93;0;12;7;7;9;0;3;6;12;2;4;15;9;1;7;12;9;0;5;3;7;0;6;4;10;0;7;6;19;1;9;5;0;15;0;0;0;10;6;11;1;18;12;12;1;10;13;4;2;28;1;8;7;0;6;4;0;9;6;5;0;13;4;8
31;414;aga;Anopheles gambiae;;;;;9.20;0;9;2;3;5;0;3;10;12;0;2;18;31;0;3;29;6;0;2;8;7;0;8;13;8;0;2;5;17;0;3;6;0;22;0;0;0;21;4;11;0;11;8;17;0;20;11;15;0;5;0;6;10;0;8;0;0;6;2;2;0;15;8;0
24;418;ppp;Physcomitrella patens ;;;;;9.18;1;14;2;6;6;1;5;5;12;0;4;24;13;0;2;11;13;0;5;7;13;0;8;4;10;0;5;6;19;0;9;8;0;8;0;0;0;9;9;10;1;14;8;16;0;11;7;14;0;7;1;9;8;1;7;5;0;9;6;10;0;15;9;11
22;421;nle;Nomascus leucogenys (Gibbon Oct. 2012 GGSC Nleu3.0/nomLeu3);;;;;9.04;1;11;7;5;8;0;3;9;12;3;5;16;11;1;6;10;9;1;4;4;9;1;5;4;11;0;4;5;18;1;9;5;0;14;0;0;0;11;9;13;2;14;22;15;0;10;10;8;1;22;3;8;7;0;7;3;0;8;6;5;0;12;6;7
28;435;ggo;Gorilla gorilla gorilla (gorilla) (gorGor3.1 May 2011);;;;;9.42;0;12;8;7;8;0;4;5;11;2;6;17;9;1;8;10;10;1;4;5;8;0;7;4;9;0;6;6;22;2;6;4;1;16;0;0;0;7;7;14;1;24;13;14;0;15;14;7;0;28;3;8;7;0;6;5;0;8;5;6;0;12;3;9
45;446;shr;Sarcophilus harrisii (Tasmanian devil Feb. 2011 WTSI Devil_ref v7.0/sarHar1);;;;;9.87;0;13;6;3;9;0;4;9;11;0;4;22;8;0;4;10;10;0;5;3;10;0;6;3;9;0;7;2;18;0;7;4;0;11;0;0;0;9;45;10;0;13;14;32;0;19;15;10;0;8;2;8;4;0;5;3;0;8;5;4;0;19;9;6
64;455;tsy*;Tarsius syrichta (Tarsier Sep. 2013 Tarsius_syrichta-2.0.1/tarSyr2);;;;;9.25;0;6;#;4;6;0;5;7;8;0;4;12;6;0;4;6;7;0;5;3;7;1;32;4;9;0;4;4;12;0;4;3;0;10;0;0;1;10;64;6;1;15;10;7;1;13;9;10;1;25;1;6;6;0;5;3;0;9;6;4;0;14;6;7
27;458;mcc;Macaca mulatta (Rhesus Oct. 2010 BGI CR_1.0/rheMac3);;;;;9.80;0;9;15;8;9;0;5;6;10;5;7;18;10;3;6;11;9;2;6;4;8;0;8;3;9;0;5;4;21;1;10;5;1;23;0;0;0;14;10;12;2;19;16;13;1;14;11;6;0;27;2;8;6;0;5;4;0;8;6;7;0;14;4;8
60;469;mmu;Mus musculus (mm10 Dec 2011);;;;;10.13;0;7;7;4;5;0;4;10;12;1;5;19;8;1;3;12;10;1;3;3;8;1;8;3;11;0;4;4;23;4;11;10;0;11;0;0;1;10;7;12;0;13;14;26;0;16;8;14;1;60;1;8;6;0;5;3;0;8;6;5;2;15;8;7
27;476;pan*;Papio anubis (Baboon Mar. 2012 Baylor Panu_2.0/papAnu2);;;;;10.20;1;13;8;8;8;0;3;11;14;2;6;19;9;1;7;12;9;1;5;3;8;0;6;4;10;0;7;6;20;1;9;5;3;21;0;0;0;10;9;12;2;21;14;15;2;15;13;9;1;27;3;9;7;0;5;4;0;11;6;5;0;20;8;8
46;481;mdo;Monodelphis domestica (opossum) (Broad Oct 2006);;;;;10.58;0;12;2;4;8;0;6;11;13;0;7;25;9;0;5;9;12;0;6;3;11;0;8;3;12;0;7;3;15;0;9;6;0;15;0;0;0;9;7;11;0;13;13;19;1;24;14;13;4;46;0;9;5;0;5;4;0;9;6;5;0;24;11;8
34;485;eeu*;Erinaceus europaeus (Hedgehog May 2012 EriEur2.0/eriEur2);;;;;7.59;0;8;3;6;6;0;3;6;9;0;4;16;7;0;6;4;7;0;3;3;10;0;5;3;9;0;6;4;14;0;10;4;0;13;0;0;0;5;4;8;0;7;11;€;0;13;8;9;0;34;2;7;6;0;5;3;0;7;5;7;0;14;7;5
51;494;ecb;Equus caballus (horse) (Sep 2007);;;;;10.76;0;12;4;6;7;0;5;3;20;0;5;25;12;3;6;15;12;0;4;4;10;0;7;3;9;0;7;3;27;0;11;8;1;14;0;0;1;11;6;12;1;17;15;16;0;10;11;51;0;25;4;7;10;0;4;4;0;12;5;7;0;10;4;8
86;498;cge;Cricetulus griseus cell line CHO-K1 (Chinese hamster ovary CriGri 1.0 Aug 2011);;;;;10.96;0;8;4;4;5;0;4;10;13;0;5;16;13;0;5;9;6;0;3;3;7;0;6;3;8;1;4;4;22;1;15;6;0;11;0;0;0;14;5;11;0;17;15;86;0;15;7;20;0;41;2;6;6;0;6;3;0;9;5;6;1;14;6;7
28;499;vvi;Vitis vinifera (Grapevine 12X);;;;;10.89;0;14;7;13;10;0;9;7;13;1;7;25;14;0;5;9;13;1;7;3;13;0;16;4;10;2;6;3;11;0;28;5;1;17;0;0;1;12;9;10;1;18;11;13;1;18;14;21;0;11;1;10;8;0;5;4;0;9;6;7;0;17;12;6
30;503;ptr;Pan troglodytes (Chimp Feb. 2011 CSAC 2.1.4/panTro4);;;;;10.82;0;15;10;7;9;0;3;6;14;1;5;21;11;1;10;12;11;1;7;4;9;1;8;5;10;0;6;5;30;1;9;5;2;22;0;0;0;10;8;10;1;27;14;19;1;15;15;11;1;27;2;7;7;1;6;5;3;9;6;5;0;13;6;13
29;506;ocu;Oryctolagus cuniculus (rabbit) (Broad Apr 2009);;;;;10.67;0;14;6;3;5;0;4;16;11;1;7;18;12;0;8;14;10;0;4;5;9;0;5;4;8;1;7;5;21;0;9;4;0;12;0;0;0;9;5;15;1;26;12;29;1;23;18;19;0;25;1;10;7;0;4;5;0;10;6;6;21;0;14;16
34;510;yli;Yarrowia lipolytica CLIB122;;;;;11.33;0;17;1;3;21;0;2;13;26;0;1;18;24;0;2;8;21;0;2;4;21;0;3;2;22;0;3;2;30;0;4;2;0;14;0;0;0;12;3;15;0;16;4;34;0;28;6;27;0;8;0;13;1;0;25;0;0;6;4;1;0;30;11;0
33;517;ppy*;Pongo pygmaeus abelii (Orangutan July 2007 WUGSC 2.0.2/ponAbe2);;;;;11.18;0;13;6;6;10;0;3;11;14;4;6;20;10;1;7;18;10;1;6;5;10;0;7;5;12;0;4;7;22;1;9;4;1;19;0;0;0;10;7;13;2;33;20;22;1;13;22;8;0;30;3;6;7;0;6;7;0;8;8;7;0;14;8;10
77;518;csi*;Ceratotherium simum (White rhinoceros May 2012 CerSimSim1.0/cerSim1);;;;;11.40;0;13;5;6;6;0;4;4;13;0;5;26;11;1;7;15;13;0;5;4;10;0;7;4;10;0;8;5;23;0;13;6;0;11;0;0;0;10;5;12;2;14;15;22;1;13;11;77;0;24;1;8;10;0;5;4;0;13;6;7;0;10;4;9
32;540;tng;Tetraodon nigroviridis (tetraodon) (Genoscope 8.0 Mar 2007);;;;;11.91;1;17;5;7;15;0;6;32;16;0;5;20;10;0;4;15;12;1;7;2;11;1;11;4;26;0;10;13;20;0;10;4;0;13;0;0;0;12;9;18;0;17;9;20;0;18;15;13;0;15;1;10;14;0;6;2;0;11;9;9;0;14;14;6
36;554;cpic;Chrysemys picta bellii (Painted turtle Dec. 2011 v3.0.1/chrPic1);;;;;11.87;2;22;13;7;2;1;4;6;11;1;13;16;16;0;5;6;24;0;15;10;12;1;4;2;17;0;18;5;11;1;15;4;1;5;0;0;0;10;16;11;1;17;36;9;0;14;17;5;5;18;4;10;7;0;5;3;3;20;26;10;0;11;24;2
35;575;tru;Takifugu rubripes (Fugu Oct. 2011 FUGU5/fr3);;;;;12.64;1;18;6;9;10;0;4;21;11;0;6;35;19;0;8;25;11;0;7;3;10;0;7;6;18;0;7;7;10;0;8;6;1;13;0;0;1;19;8;12;0;20;19;19;1;22;13;20;0;15;1;16;16;1;7;4;0;17;13;10;0;18;12;4
37;578;sbi;Sorghum bicolor (Version 1.0);;;;;12.56;0;20;4;9;15;0;9;11;17;0;5;37;16;2;4;10;11;3;12;6;14;0;11;7;12;2;9;6;18;0;13;11;1;14;0;0;1;15;11;13;1;16;9;18;2;24;13;23;0;13;1;13;15;0;4;7;0;13;7;10;0;24;10;6
40;582;mtr;Medicago truncatula (March 2009 Version 3.0);;;;;12.47;0;26;7;14;9;0;10;4;19;0;10;40;17;3;7;7;12;2;8;2;7;0;11;1;10;4;10;1;25;0;16;3;1;12;0;0;0;17;17;5;9;28;18;16;0;28;19;11;0;10;1;14;12;0;5;3;0;15;8;6;1;23;15;3
34;596;cel;Caenorhabditis elegans (WS220 Oct 2010);;;;;13.18;0;15;4;7;20;0;3;5;21;0;7;19;19;0;5;6;15;0;9;6;6;0;31;4;17;0;11;7;22;0;9;4;0;19;0;0;0;19;20;7;0;20;14;30;0;27;17;24;0;13;2;12;18;0;8;1;1;9;8;4;0;14;34;3
40;618;pop;Populus trichocarpa (Jan 2010 Version 2.0) ;;;;;13.53;4;18;7;3;40;1;0;7;20;1;9;26;17;0;8;10;13;1;9;5;14;0;22;4;6;0;11;4;20;0;18;5;0;18;0;0;0;13;11;11;0;22;17;17;0;33;14;21;1;13;1;14;10;0;7;5;0;16;11;11;0;25;17;7
40;622;hsa;Homo sapiens (hg38 - GRCh38 Dec 2013);;;;;13.31;0;18;8;12;12;0;4;11;19;6;5;22;11;1;8;21;12;1;6;5;10;1;8;4;10;0;6;7;35;1;10;5;5;32;0;0;0;10;18;24;2;40;20;24;1;16;17;10;1;38;3;8;7;0;6;4;1;8;7;5;0;15;9;12
55;639;bdi;Brachypodium distachyon (JGI v1.0 8X);;;;;13.82;0;18;4;15;14;0;10;8;20;2;4;55;15;3;5;11;11;4;10;5;15;0;18;8;9;3;10;6;19;0;12;11;1;17;0;0;3;21;15;11;0;16;12;18;0;25;15;19;0;14;0;18;16;1;5;6;0;18;9;9;0;27;9;9
43;674;oni*;Oreochromis niloticus (Nile tilapia Jan. 2011 Broad oreNil1.1/oreNil2);;;;;14.80;0;23;12;7;14;0;7;16;25;0;25;27;8;0;9;9;10;0;10;6;14;0;11;4;18;1;25;8;18;0;11;12;3;18;0;0;0;23;6;11;0;9;16;43;0;10;14;15;1;42;1;12;16;0;7;6;2;10;27;18;0;13;12;9
83;684;ath;Arabidopsis thaliana (TAIR10 Feb 2011);;;;;15.00;0;17;6;12;12;1;11;3;17;2;5;32;14;2;7;8;37;3;12;7;15;0;47;5;10;1;9;5;16;0;10;7;0;83;0;0;0;12;10;9;0;19;15;17;0;29;14;13;0;17;0;16;11;0;6;4;0;16;10;8;0;25;12;5
56;738;osa;Oryza sativa;;;;;15.67;0;20;4;19;15;0;10;10;18;0;5;56;17;16;4;10;12;4;17;8;14;0;14;9;11;8;15;5;20;1;10;12;2;19;0;0;0;26;21;10;0;29;12;20;1;31;16;25;1;17;0;18;24;0;4;8;0;20;12;11;0;28;9;10
36;738;gmx;Glycine max (soybean) (Wm82.a2);;;;;16.31;0;22;9;18;16;0;10;7;31;0;8;36;22;1;9;13;15;0;11;6;21;0;27;5;9;1;10;4;24;0;17;8;0;21;0;0;0;18;13;13;2;22;20;22;0;33;16;24;0;14;0;18;13;0;9;5;0;28;18;13;0;29;18;9
42;743;cbr;Caenorhabditis briggsae (C. briggsae Jan. 2007 WUGSC 1.0/cb3);;;;;16.51;0;22;6;11;26;0;5;7;21;0;24;23;25;0;6;6;17;0;8;8;6;0;41;4;22;0;10;9;29;0;14;7;0;19;0;0;0;21;24;10;0;23;16;40;0;34;19;30;0;16;0;13;22;0;10;0;0;9;10;2;0;21;42;5
37;749;mpu*;Mustela putorius furo (Ferret Apr. 2011 MusPutFur1.0/musFur1);;;;;10.68;0;11;4;6;6;0;4;5;10;0;5;20;8;0;6;7;8;0;4;4;9;0;7;2;10;0;7;5;15;0;8;5;0;9;0;0;1;7;37;17;6;12;31;€;0;8;7;19;0;25;1;11;6;0;29;5;0;12;16;21;0;9;9;4
48;804;str*;Spermophilus tridecemlineatus (Squirrel Nov. 2011 Broad/speTri2);;;;;11.02;1;10;3;10;6;0;3;4;14;6;4;14;18;3;5;39;15;1;7;6;12;1;7;3;34;5;6;7;€;31;39;18;0;9;0;0;0;6;4;6;1;9;10;12;6;8;5;7;0;48;1;7;6;0;5;3;0;7;5;6;7;13;5;20
97;807;ssc;Sus scrofa (Pig Aug. 2011 SGSC Sscrofa10.2/susScr3);;;;;12.68;0;21;4;6;8;0;5;5;13;0;5;23;10;1;11;12;10;0;5;4;9;0;4;3;13;0;8;4;23;0;14;7;0;17;0;0;0;10;9;12;2;18;38;16;10;97;€;13;1;23;0;7;7;0;5;3;0;10;7;4;0;19;10;6
47;827;cja*;Caenorhabditis japonica (WUGSC 3.0.2 Mar 2008);;;;;18.33;1;24;5;7;26;0;6;12;26;0;7;30;23;0;7;13;19;0;7;15;9;0;43;8;24;0;12;11;31;0;11;8;0;24;0;0;0;17;14;16;0;23;30;37;0;41;20;40;0;15;1;18;21;0;11;1;0;15;12;3;0;34;47;2
83;856;oaa;Ornithorhynchus anatinus (platypus) (WUGSC 5.0.1 Mar 2007);;;;;18.56;1;24;10;10;8;0;7;18;27;0;10;32;23;1;15;10;16;4;6;8;19;4;12;7;23;1;18;10;83;0;17;11;0;28;0;0;1;24;11;19;0;21;32;25;0;27;16;27;0;37;5;14;12;0;7;14;2;18;6;9;2;40;15;9
43;906;cfa;Canis familiaris (dog) (CanFam3.1 Sept 2011);;;;;11.23;0;10;4;5;4;0;4;7;9;0;5;23;6;0;5;8;10;0;5;8;8;0;8;4;8;0;4;5;14;0;11;4;0;9;0;0;0;9;43;20;1;21;34;€;2;13;15;22;0;21;1;6;6;0;15;4;0;8;9;29;0;11;11;9
82;1065;spu;Strongylocentrotus purpuratus (Sea urchin) ;;;;;23.56;2;0;14;2;18;0;8;5;69;2;22;73;20;0;11;16;25;0;15;6;19;0;21;9;27;0;21;9;32;0;17;7;0;24;0;0;0;26;17;21;0;39;57;42;0;82;26;29;0;31;0;18;29;0;19;1;1;17;18;19;0;42;33;4
66;1095;cbr*;Caenorhabditis brenneri (WUGSC 6.0.1 Feb 2008);;;;;24.07;0;24;7;14;32;0;8;8;33;1;26;29;33;0;8;15;20;0;14;9;25;2;54;9;31;1;15;10;35;0;11;6;2;28;0;0;1;26;40;11;0;33;29;49;0;34;36;37;2;21;3;22;32;0;17;24;0;14;13;11;0;39;66;25
66;1119;dno*;Dasypus novemcinctus (Armadillo Dec. 2011 Baylor/dasNov3);;;;;15.86;0;12;8;8;5;0;3;10;12;1;6;30;12;1;16;#;10;0;6;6;7;0;7;4;11;0;8;7;23;2;66;17;0;14;0;0;1;10;5;10;0;23;18;43;0;21;20;45;0;22;1;15;10;0;8;5;0;10;9;47;24;19;€;34
61;1176;oas;Ovis aries (sheep) (Feb 2010);;;;;12.50;1;6;5;7;6;0;2;3;6;0;5;18;7;0;8;9;2;3;4;3;4;0;6;1;5;0;5;3;18;3;12;7;2;16;0;0;0;8;7;9;0;13;22;16;2;8;€;60;16;61;4;47;2;2;6;6;0;7;22;33;5;30;€;€
82;1198;zma;Zea mays (Version 5b.60);;;;;23.18;1;25;5;20;29;0;9;13;69;0;5;79;22;12;4;16;13;22;11;6;15;0;31;9;20;13;14;6;66;0;15;22;0;21;0;0;1;26;22;13;0;49;82;€;1;42;22;30;1;25;0;27;35;0;7;6;0;14;9;11;0;33;11;11
55;1463;aml;Ailuropoda melanoleuca (panda) (BGI-Shenzhen AilMel 1.0 Dec 2009);;;;;13.84;0;11;5;9;7;0;5;7;12;0;6;24;10;0;7;9;10;0;6;4;9;0;11;5;10;0;9;10;17;0;9;5;0;11;0;0;0;8;43;25;6;28;55;€;1;11;11;37;0;25;2;10;8;1;#;7;2;13;17;45;0;10;7;7
63;1492;gmo*;Gadus morhua (Atlantic cod May 2010 Genofisk GadMor_May2010/gadMor1);;;;;30.05;6;36;16;15;33;0;24;47;26;0;18;€;21;0;9;28;30;0;18;14;55;0;21;22;30;0;30;30;55;1;24;26;0;50;0;0;1;26;11;45;2;34;63;43;1;30;51;50;0;27;2;29;31;2;17;10;1;41;21;28;0;30;39;18
76;2002;lav;Loxodonta africana (elephant) (Broad/July 2009);;;;;25.95;1;32;15;17;22;0;11;10;43;0;7;50;41;1;50;35;29;0;7;4;16;0;14;3;14;1;22;10;54;0;53;15;1;19;0;0;3;27;14;28;4;51;60;36;0;20;€;24;1;28;24;23;14;0;18;3;3;76;#;16;4;33;€;#
40;2017;tma*;Trichechus manatus latirostris (Manatee Oct. 2011 Broad v1.0/triMan1);;;;;13.98;1;11;6;10;8;0;5;5;13;1;8;21;11;0;26;16;14;0;6;4;11;0;8;3;16;1;18;4;20;1;40;6;1;15;0;0;0;12;8;10;1;23;31;16;1;15;€;19;5;22;18;13;8;0;12;7;5;36;€;13;9;23;€;#
90;2485;pma*;Petromyzon marinus (Lamprey Sep. 2010 WUGSC 7.0/petMar2);;;;;34.89;2;57;5;#;€;0;40;#;€;0;10;€;€;1;26;#;22;0;20;35;54;0;43;21;62;19;19;23;€;0;31;24;0;90;0;0;1;27;44;€;0;€;24;23;2;90;12;11;0;68;1;9;85;1;26;10;0;65;18;50;1;54;17;6
99;2489;gac*;Gasterosteus aculeatus (stickleback) (Broad 1.0 Feb 2006);;;;;41.18;0;35;12;7;49;0;17;9;€;0;61;€;21;1;12;18;52;0;62;29;63;0;29;18;99;0;35;23;53;0;53;56;0;17;0;0;0;52;60;81;1;€;61;97;0;€;46;53;0;€;1;74;49;0;#;2;0;30;68;26;0;12;61;4
99;2639;xtr;Xenopus tropicalis (frog) (JGI 4.2 Nov 2009);;;;;50.41;2;58;#;22;38;2;25;32;63;5;51;€;55;0;36;53;40;3;41;23;60;1;53;36;€;0;91;29;67;0;47;36;0;€;0;0;1;42;28;40;1;47;72;97;0;59;84;51;2;92;1;33;33;3;33;8;0;99;€;27;0;85;80;€
68;3729;fca;Felis catus (cat) (Felis_catus-6.2 Sept 2011);;;;;19.40;1;12;19;8;6;0;33;5;10;0;9;24;8;0;6;9;8;1;14;5;8;1;68;7;9;0;13;9;18;1;10;7;0;10;0;0;2;16;€;47;5;28;50;€;1;9;15;44;1;32;18;23;9;9;€;24;2;12;54;53;2;10;48;6
78;4040;bta;Bos taurus (Cow Jun. 2014 Bos_taurus_UMD_3.1.1/bosTau8);;;;;22.58;6;30;10;14;11;0;5;6;18;0;8;35;20;0;21;39;13;32;7;7;13;0;9;4;14;1;10;7;31;2;35;16;11;39;0;0;4;19;20;40;0;30;78;40;6;42;€;€;143;€;29;€;13;7;12;16;4;19;44;€;20;63;€;€
74;5845;ttr*;Tursiops truncatus (Dolphin Oct. 2011 Baylor Ttru_1.4/turTru2);;;;;16.73;0;12;6;7;6;0;4;6;11;0;5;17;8;3;16;22;12;0;6;4;7;0;5;4;9;1;6;3;19;2;36;21;1;18;0;0;0;9;16;15;0;13;74;19;10;49;€;€;6;22;21;€;7;1;7;12;0;11;48;54;19;43;€;€
86;7080;bacu;Balaenoptera acutorostrata scammoni (Minke whale Oct. 2013 BalAcu1.0/balAcu1);;;;;18.77;0;13;13;8;6;0;4;7;12;1;8;21;14;1;18;32;10;1;5;4;7;0;5;4;13;0;8;4;20;0;42;20;0;14;0;0;0;11;10;20;0;24;86;29;20;45;€;€;2;24;17;€;9;0;9;21;0;13;55;#;12;64;€;€
94;13727;cmk;Callorhinchus milii (Elephant shark Dec. 2013 Callorhinchus_milii-6.1.3/calMil1);;;;;32.70;3;35;13;31;20;2;20;25;31;0;23;94;22;16;€;€;26;1;54;48;12;6;51;41;24;12;€;€;75;168;€;€;1;36;0;0;1;37;7;18;2;48;43;36;6;49;66;€;1;15;3;30;9;0;25;2;0;33;14;12;2;19;66;#
;;;total du diagramme;;;;;;45;1,461;617;774;973;22;561;782;1,592;70;675;2,065;1,377;94;645;1,007;1,266;99;715;551;1,123;25;1,244;476;1,376;83;847;535;2,162;240;1,241;682;50;1,554;0;0;34;1,239;1,175;1,210;72;1,748;1,880;2,044;93;2,061;1,303;1,656;209;1,958;249;1,088;1,153;33;656;428;36;1,265;1,051;912;138;2,017;1,185;541
Codons forts;;;pente;;;;;;;1.139;0.463;0.574;0.853;;0.504;0.627;1.334;;0.668;2.025;1.02;;0.591;0.905;0.946;;0.699;0.511;0.991;;1.062;0.469;1.188;;0.848;0.491;1.728;;1.079;0.673;;1.293;;;;0.998;0.925;1.065;;1.442;1.669;1.738;;1.69;1.233;1.375;;1.603;-;0.941;0.948;;0.606;0.321;;1.174;0.964;0.808;;1.476;1.263;0.485
;;;somme calculée;;;;;;;-;23.3;20.0244;29.8;;-;21.9;101.5;;-;317.0;35.6;;19.3;75.5;-;;-;-;-;;-;-;59.9;;27.7;16.1;79.3;;35.3;22.0;;65.2;;;;-;17.9;37.2;;109.7;-;149.3;;69.6;151.9;124.8;;102.2;-;54.6;-;;45.1;-;;-;87.1;33.4;;-;159.6;93.9
;;;Totaux + calculés;;;;;;;1,461;640;794;1,003;;561;804;1,693;;675;2,382;1,413;;664;1,083;1,266;;715;551;1,123;;1,244;476;1,436;;875;551;2,241;;1,276;704;;1,619;0;0;;1,239;1,193;1,247;;1,858;1,880;2,193;;2,131;1,455;1,781;;2,060;249;1,143;1,153;;701;428;;1,265;1,138;945;;2,017;1,345;635
Codons faibles;;;c/t nombre >3;;;;;;3;;;;;0;;;;6;;;;3;;;;5;;;;2;;;;6;;;;4;;;2;;;;2;;;;5;;;;6;;;;7;;;;;2;;;2;;;;9;;;
;;;c/t nombre >3, total;;;;;;16;;;;;0;;;;35;;;;44;;;;66;;;;10;;;;61;;;;209;;;16;;;;9;;;;30;;;;58;;;;184;;;;;16;;;9;;;;120;;;
;;;reste calculé;;;;;;32;;;;;22;;;;41;;;;53;;;;38;;;;17;;;;28;;;;35;;;36;;;;27;;;;47;;;;41;;;;32;;;;;19;;;29;;;;27;;;
;;;multiplicité X 100;;;;;;26;;;;;18;;;;34;;;;44;;;;31;;;;14;;;;23;;;;29;;;30;;;;22;;;;39;;;;34;;;;26;;;;;16;;;24;;;;22;;;
;;;c/t nombre=3;;;;;;1;;;;;0;;;;1;;;;6;;;;4;;;;0;;;;1;;;;1;;;2;;;;2;;;;1;;;;0;;;;0;;;;;2;;;3;;;;0;;;
Totaux des 121 réduits;;;;;;;;55829.6931801242;32;1,461;640;794;1,003;22;561;804;1,693;41;675;2,382;1,413;53;664;1,083;1,266;38;715;551;1,123;17;1,244;476;1,436;28;875;551;2,241;35;1,276;704;36;1,619;0;0;27;1,239;1,193;1,247;47;1,858;1,880;2,193;41;2,131;1,455;1,781;32;2,060;249;1,143;1,153;19;701;428;29;1,265;1,138;945;27;2,017;1,345;635
Données non modifiées;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
64;455;tsy*;Tarsius syrichta (Tarsier Sep. 2013 Tarsius_syrichta-2.0.1/tarSyr2);;;;;9.0;0;6;42;4;6;0;5;7;8;0;4;12;6;0;4;6;7;0;5;3;7;1;32;4;9;0;4;4;12;0;4;3;0;10;0;0;1;10;64;6;1;15;10;7;1;13;9;10;1;25;1;6;6;0;5;3;0;9;6;4;0;14;6;7
149;485;eeu*;Erinaceus europaeus (Hedgehog May 2012 EriEur2.0/eriEur2);;;;;10.7;0;8;3;6;6;0;3;6;9;0;4;16;7;0;6;4;7;0;3;3;10;0;5;3;9;0;6;4;14;0;10;4;0;13;0;0;0;5;4;8;0;7;11;149;0;13;8;9;0;34;2;7;6;0;5;3;0;7;5;7;0;14;7;5
271;749;mpu*;Mustela putorius furo (Ferret Apr. 2011 MusPutFur1.0/musFur1);;;;;16.5;0;11;4;6;6;0;4;5;10;0;5;20;8;0;6;7;8;0;4;4;9;0;7;2;10;0;7;5;15;0;8;5;0;9;0;0;1;7;37;17;6;12;31;271;0;8;7;19;0;25;1;11;6;0;29;5;0;12;16;21;0;9;9;4
256;804;str*;Spermophilus tridecemlineatus (Squirrel Nov. 2011 Broad/speTri2);;;;;16.5;1;10;3;10;6;0;3;4;14;6;4;14;18;3;5;39;15;1;7;6;12;1;7;3;34;5;6;7;256;31;39;18;0;9;0;0;0;6;4;6;1;9;10;12;6;8;5;7;0;48;1;7;6;0;5;3;0;7;5;6;7;13;5;20
235;807;ssc;Sus scrofa (Pig Aug. 2011 SGSC Sscrofa10.2/susScr3);;;;;17.6;0;21;4;6;8;0;5;5;13;0;5;23;10;1;11;12;10;0;5;4;9;0;4;3;13;0;8;4;23;0;14;7;0;17;0;0;0;10;9;12;2;18;38;16;10;97;235;13;1;23;0;7;7;0;5;3;0;10;7;4;0;19;10;6
408;906;cfa;Canis familiaris (dog) (CanFam3.1 Sept 2011);;;;;20.0;0;10;4;5;4;0;4;7;9;0;5;23;6;0;5;8;10;0;5;8;8;0;8;4;8;0;4;5;14;0;11;4;0;9;0;0;0;9;43;20;1;21;34;408;2;13;15;22;0;21;1;6;6;0;15;4;0;8;9;29;0;11;11;9
326;1119;dno*;Dasypus novemcinctus (Armadillo Dec. 2011 Baylor/dasNov3);;;;;24.2;0;12;8;8;5;0;3;10;12;1;6;30;12;1;16;81;10;0;6;6;7;0;7;4;11;0;8;7;23;2;66;17;0;14;0;0;1;10;5;10;0;23;18;43;0;21;20;45;0;22;1;15;10;0;8;5;0;10;9;47;24;19;326;34
341;1176;oas;Ovis aries (sheep) (Feb 2010);;;;;25.3;1;6;5;7;6;0;2;3;6;0;5;18;7;0;8;9;2;3;4;3;4;0;6;1;5;0;5;3;18;3;12;7;2;16;0;0;0;8;7;9;0;13;22;16;2;8;139;60;16;61;4;47;2;2;6;6;0;7;22;33;5;30;133;341
127;1198;zma;Zea mays (Version 5b.60);;;;;25.5;1;25;5;20;29;0;9;13;69;0;5;79;22;12;4;16;13;22;11;6;15;0;31;9;20;13;14;6;66;0;15;22;0;21;0;0;1;26;22;13;0;49;82;127;1;42;22;30;1;25;0;27;35;0;7;6;0;14;9;11;0;33;11;11
772;1463;aml;Ailuropoda melanoleuca (panda) (BGI-Shenzhen AilMel 1.0 Dec 2009);;;;;32.2;0;11;5;9;7;0;5;7;12;0;6;24;10;0;7;9;10;0;6;4;9;0;11;5;10;0;9;10;17;0;9;5;0;11;0;0;0;8;43;25;6;28;55;772;1;11;11;37;0;25;2;10;8;1;84;7;2;13;17;45;0;10;7;7
154;1492;gmo*;Gadus morhua (Atlantic cod May 2010 Genofisk GadMor_May2010/gadMor1);;;;;32.8;6;36;16;15;33;0;24;47;26;0;18;154;21;0;9;28;30;0;18;14;55;0;21;22;30;0;30;30;55;1;24;26;0;50;0;0;1;26;11;45;2;34;63;43;1;30;51;50;0;27;2;29;31;2;17;10;1;41;21;28;0;30;39;18
619;2002;lav;Loxodonta africana (elephant) (Broad/July 2009);;;;;43.5;1;32;15;17;22;0;11;10;43;0;7;50;41;1;50;35;29;0;7;4;16;0;14;3;14;1;22;10;54;0;53;15;1;19;0;0;3;27;14;28;4;51;60;36;0;20;114;24;1;28;24;23;14;0;18;3;3;76;90;16;4;33;619;72
1073;2017;tma*;Trichechus manatus latirostris (Manatee Oct. 2011 Broad v1.0/triMan1);;;;;43.8;1;11;6;10;8;0;5;5;13;1;8;21;11;0;26;16;14;0;6;4;11;0;8;3;16;1;18;4;20;1;40;6;1;15;0;0;0;12;8;10;1;23;31;16;1;15;114;19;5;22;18;13;8;0;12;7;5;36;123;13;9;23;1073;90
278;2485;pma*;Petromyzon marinus (Lamprey Sep. 2010 WUGSC 7.0/petMar2);;;;;53.7;2;57;5;42;112;0;40;75;110;0;10;278;166;1;26;71;22;0;20;35;54;0;43;21;62;19;19;23;106;0;31;24;0;90;0;0;1;27;44;108;0;168;24;23;2;90;12;11;0;68;1;9;85;1;26;10;0;65;18;50;1;54;17;6
286;2489;gac*;Gasterosteus aculeatus (stickleback) (Broad 1.0 Feb 2006);;;;;55.2;0;35;12;7;49;0;17;9;101;0;61;286;21;1;12;18;52;0;62;29;63;0;29;18;99;0;35;23;53;0;53;56;0;17;0;0;0;52;60;81;1;123;61;97;0;184;46;53;0;107;1;74;49;0;79;2;0;30;68;26;0;12;61;4
151;2639;xtr;Xenopus tropicalis (frog) (JGI 4.2 Nov 2009);;;;;57.2;2;58;46;22;38;2;25;32;63;5;51;138;55;0;36;53;40;3;41;23;60;1;53;36;151;0;91;29;67;0;47;36;0;107;0;0;1;42;28;40;1;47;72;97;0;59;84;51;2;92;1;33;33;3;33;8;0;99;105;27;0;85;80;105
1201;3729;fca;Felis catus (cat) (Felis_catus-6.2 Sept 2011);;;;;81.9;1;12;19;8;6;0;33;5;10;0;9;24;8;0;6;9;8;1;14;5;8;1;68;7;9;0;13;9;18;1;10;7;0;10;0;0;2;16;782;47;5;28;50;887;1;9;15;44;1;32;18;23;9;9;1,201;24;2;12;54;53;2;10;48;6
1295;4040;bta;Bos taurus (Cow Jun. 2014 Bos_taurus_UMD_3.1.1/bosTau8);;;;;83.9;6;30;10;14;11;0;5;6;18;0;8;35;20;0;21;39;13;32;7;7;13;0;9;4;14;1;10;7;31;2;35;16;11;39;0;0;4;19;20;40;0;30;78;40;6;42;435;164;143;338;29;178;13;7;12;16;4;19;44;116;20;63;391;1,295
1901;5845;ttr*;Tursiops truncatus (Dolphin Oct. 2011 Baylor Ttru_1.4/turTru2);;;;;128.5;0;12;6;7;6;0;4;6;11;0;5;17;8;3;16;22;12;0;6;4;7;0;5;4;9;1;6;3;19;2;36;21;1;18;0;0;0;9;16;15;0;13;74;19;10;49;1,901;395;6;22;21;217;7;1;7;12;0;11;48;54;19;43;833;1,766
2368;7080;bacu;Balaenoptera acutorostrata scammoni (Minke whale Oct. 2013 BalAcu1.0/balAcu1);;;;;156.1;0;13;13;8;6;0;4;7;12;1;8;21;14;1;18;32;10;1;5;4;7;0;5;4;13;0;8;4;20;0;42;20;0;14;0;0;0;11;10;20;0;24;86;29;20;45;2,368;468;2;24;17;256;9;0;9;21;0;13;55;67;12;64;987;2,148
5898;13727;cmk;Callorhinchus milii (Elephant shark Dec. 2013 Callorhinchus_milii-6.1.3/calMil1);;;;;300.1;3;35;13;31;20;2;20;25;31;0;23;94;22;16;145;1,540;26;1;54;48;12;6;51;41;24;12;206;137;75;168;5,898;3,858;1;36;0;0;1;37;7;18;2;48;43;36;6;49;66;428;1;15;3;30;9;0;25;2;0;33;14;12;2;19;66;81
1045;12258;dre;Danio rerio (Zebrafish) (Zv8 Apr 2009);;;;;268.8;10;197;73;241;270;4;244;300;258;10;75;522;232;6;230;227;336;2;209;80;315;2;205;180;359;10;290;66;92;4;368;112;5;236;0;0;10;387;105;266;24;1,045;525;953;1;150;225;245;9;136;14;44;203;24;107;59;14;424;252;104;11;836;47;268
;92530;;Total des 121 eucaryotes non réduits;;;;;;45;1461;705;816;1085;22;561;857;1803;70;675;2921;1543;94;790;2699;1266;99;715;551;1123;25;1244;476;1527;83;1053;672;2524;240;7139;4540;50;1661;0;0;34;1239;1957;1318;72;2039;1880;4658;93;2245;6609;3111;209;2403;249;1739;1153;33;2020;428;36;1265;1369;1095;138;2017;5547;6439

Lignes et colonnes 121 eucaryotes[modifier | modifier le wikicode]

  • Lien Tableaux: Lignes et colonnes 121 eucaryotes
  • Liens: Calculs pour 121 eucaryotes,  Tableau des effectifs calculés des 121 eucaryotes
  • Légende: Les moyennes des codons de la 3ème base appartenant aux doublets ayant la même 1ère base (ligne) ou ayant la même 2ème base (colonne) sont faites sur 4 codons ou sur 3 codons seulement quand on rencontre les codons stop (taa tag) ou le codon ata lorsqu'il est trop faible ( sauf celui des eucaryotes) ou le codon atg à effectif très élevé (sauf celui des eucaryotes). La moyenne des lignes et colonnes est faite sur 12 codons ou seulement 10 quand on rencontre les codons taa tag ata atg. Quand les codons xyt ont des effectifs élevés ils sont permutés avec les codons xyc ( 1 permutation chez les bactéries et 8 chez les eucaryotes). Aussi les lignes et colonnes xyt contiennent les valeurs faibles après permutation et les lignes et colonnes xyc contiennent les valeurs fortes après permutation.
    n pour nombre de codons, mcod pour moyenne des codons, Lig. pour ligne, Col. pour colonne et car. pour carré ou doublet.
    txt, c, a, g pour respectivement les 4 codons "ttt tct tat tgt" de la 3ème base t, les 4 codons "ttc tcc tac tgc" de la 3ème base c . . . etc. (Ligne Lig.)
    xtt, c, a, g pour respectivement les 4 codons "ttt ctt att gtt" de la 3ème base t, les 4 codons "ttc ctc atc gtc" de la 3ème base c . . . etc. (colonne Col.)
  • Tableaux non formatés: voir tableur
IV LC;Nombres de tRNAs. 121 eucaryotes;;;;;;V LC;Danio rerio (Zebrafish) ;;;;;;I LC;Nombres de tRNAs. 4032 bactéries;;;;
Lignes;;;Colon;;55 830;;Lignes;;;Colon;;12 258;;Lignes;;;Colon;;235 027

Demi-doublets des 121 eucaryotes[modifier | modifier le wikicode]

  • Lien Tableaux: Demi-doublets des 121 eucaryotes
  • Légende:
    155 eucaryotes, tableau des demi-doublets sur les effectifs des 155 eucaryotes avant sélection des 121.
    121 eucaryotes 92530: tableau des demi-doublets sur les effectifs des 121 eucaryotes avant calcul sur les tRNAs surexprimés.
    121 eucaryotes 55830: tableau des demi-doublets sur les effectifs des 121 eucaryotes après calcul sur les tRNAs surexprimés.
    g/a: rapport des codons xyg sur xya de la ligne x et de la colonne y du tableau des effectifs,   1.4  rapport inverse de g/a.
    t/c: rapport des codons xyc sur xyt de la ligne x et de la colonne y du tableau des effectifs,   16  rapport inverse de t/c.
    t c a g: colonnes du tableau des effectifs
155 eucaryotes;;;115 111;;;121 eucaryotes;;;92530;;;121 eucaryotes;;;55830;

Moyennes des doublets 12 23 13[modifier | modifier le wikicode]

;IV 1 121 eucaryotes;;;;;I 1 4032 bactéries;;;;;IV 1;Duplications processus E;;;;II 1;184 Archées;;
  • Doublets 13
;IV 1 121 eucaryotes;;;;;I 1 4032 bactéries;;;;;II 1;184 Archées;;
  • Doublets 12
;IV 1 121 eucaryotes;;;;;I 1 4032 bactéries;;;;;II 1;184 Archées;;

Doublets 12 23 13[modifier | modifier le wikicode]

IV 1;Nombres de tRNAs. 121 eucaryotes;;;;;55 830;12;;I 1;Nombres de tRNAs. 4032 bactéries ;;;;;235027;12;;II 1;Nombres de tRNAs. 184 archées;;;;;;12
IV 1;Nombres de tRNAs. 121 eucaryotes;;;;;55 830;23;;I 1;Nombres de tRNAs. 4032 bactéries ;;;;;235027;23;;II 1;Nombres de tRNAs. 184 archées;;;;;;23
IV 1;Nombres de tRNAs. 121 eucaryotes;;;;;55 830;13;;I 1;Nombres de tRNAs. 4032 bactéries ;;;;;235027;13;;II 1;Nombres de tRNAs. 184 archées;;;;;;13

Paires de base des codons[modifier | modifier le wikicode]

I 1.ap;Nombres de tRNAs. 4032 bactéries ;;;;;235027;;;IV 1.ap;Nombres de tRNAs. 121 eucaryotes;;;;;55 830;
I 1.apr;Nombres de tRNAs. 4032 bactéries ;;;;;rapports;;;IV 1.apr;Nombres de tRNAs. 121 eucaryotes;;;;;rapports;
I 1.pc;Nombres de tRNAs. 4032 bactéries ;;;;;codons/paire;;;IV1.pc;Nombres de tRNAs. 121 eucaryotes;;;;;codons/paire;

Moyennes des doublets à 3 codons homogènes[modifier | modifier le wikicode]


Genèse des gènes de tRNAs[modifier | modifier le wikicode]

I 1.g;Genèse de tRNAs. 4032 bactéries ;;;;;235027;;;IV 1.g;Genèse de tRNAs. 121 eucaryotes;;;;;55 830;;;IV1.265;;sensibilité relative;;;7.90;-37.3;265.0
I 1.z;Zéros de tRNAs. 4032 bactéries ;;;;;235027;;;IV 1.z;Zéros de tRNAs. 121 eucaryotes;;;;;55 830;;;I 1.zb;Bactéries. 4032 bactéries ;;;;;235027;

Genèse et sensibilité[modifier | modifier le wikicode]

;genèse constante, neutre;;;;;;;;genèse constante, négative;;;;;
III;ggc;1;0,98;2;-8;2,11;;;genèse constante, sensible;;;;;
;ccg;0,54;0,82;22;-8;0,50;;;genèse variable, sensible;;;;;
;genèse variable, neutre;;;;;;;b;gtg;0,31;0,99;1;248;1,13

Duplications entières du processus E[modifier | modifier le wikicode]

;;;;Duplications entières du processus E;;;;;;;;;;

Corrélations entre codons des 121 eucaryotes[modifier | modifier le wikicode]

  • Lien Tableaux: Calculs pour 121 eucaryotes
  • Tableau des diagrammes
  • Légende: corel pour coefficient de corrélation pour 45 codons (-1, atg), 41 codons(-5, atg aag gag tgc gct), 40 codons (-6, +gta)
;I1 B;IV1 E;;;;I1 B;IV1-I1 d;

Distribution des tRNAs de 121 eucaryotes[modifier | modifier le wikicode]

Cumul des fréquences des tRNAs/génome > 4. 121 Eucaryotes.;;;;;;;
  • Tableau des totaux Ligne/Colonne
Cumul des fréquences des tRNAs/génome > 4. 121 Eucaryotes.;;;;;;;;;;
Total colonne;;;;;;Total ligne;;;;
Base 2;938;845;990;863;;Base 1;721;830;1040;1045
  • Tableau des diagrammes et totaux des fréquences 0-4
Fréquence 1;;;;;;;;110;;79;;;81;;;;;;;151;206;;83;;;90;;;108;168;74;97;90;114;164;107;178;;84;;99;105;;;133;81;;;
Total 0-4;;10;66;51;41;84;49;10;66;11;14;72;50;17;73;89;36;39;97;15;60;78;7;38;69;15;24;43;34;13;38;8;9;23;26;34;34;29;57;93;33;35;60;7;44;68;1869;112;
Distribution c/t;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
Fréquence 1;;;;;16;32;;12;168;;;;10;143;9;;9;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;

Caractérisation des codons par les processus de genèse et de duplication des eucaryotes[modifier | modifier le wikicode]

Tableau des effectifs calculés des gènes de tRNAs 121 eucaryotes.[modifier | modifier le wikicode]

  • Lien Tableur: Tableau des effectifs calculés des gènes de tRNAs 121 eucaryotes.
  • Légende: Décompte des gènes tRNAs par codon suivant la base de données gtRNAdb [4].
    1.   5   : nombre de tRNAs d'un codon se terminant par t. Ce sont les plus faibles.
    2.   113   : nombre de tRNAs d'un codon se terminant par t: Changement de t en c chez les archées et de c en t chez les eucaryotes.
    3. 4 366: Effectif élevé de tRNAs d'un codon se terminant par g chez les procaryotes.
    4. 2622: Effectif faible de tRNAs supérieurs à   t   et à   c   .
    5. 160: Changement de codon   g   Chez les archées et les eucaryotes.
  • Tableaux:
    1. Nombre de tRNAs, tableaux IV V, décompte de la base gtRNAdb.
    2. Pour 100 000 tRNAs, tableaux IV100 III100 V100, décomptes rapportés à 100 000 tRNAs pour comparaison.
    3. tRNAs pour 1 génome, tableaux IV1 III1 , indice de la multiplicité = nombre de tRNAs / nombre de génomes.
    4. IVp, pentes; IVr, coefficients de détermination R2. Voir les calculs pour les 121 eucaryotes
IV ;Nombres de tRNAs. 121 eucaryotes;;;;;;55,830;;IV p;Pentes des tRNAs. 121 eucaryotes;;;;;;;;12,258;V;Nombres Danio rerio (Zebrafish) ;;;;;
IV 100;Nombres de tRNAs. 121 eucaryotes;;;;;;;;I 100;Nombres de tRNAs. 4032 bactéries ;;;;;235,027;24.10.17;;;V 100;Danio rerio (Zebrafish) ;;;;;
IV 1;Nombres de tRNAs. 121 eucaryotes;;;;;;;;III 1;Nombres de tRNAs. 121 eucaryotes;;;;;;;;;IV r;R2 des tRNAs. 121 eucaryotes;;;;;

Tableau des effectifs des gènes de tRNAs 121 eucaryotes.[modifier | modifier le wikicode]

  • Lien Tableaux: Tableau des effectifs des gènes de tRNAs 121 eucaryotes.
  • Liens: Sélection des 121 eucaryotestableaux synthétiques des 121
  • Utilisation de ces tableaux: Le tableau III1 92 530, est comparé au tableau III1 55 948 des tableaux synthétiques, pour l'indice de la multiplicité. Les codons en gras ont un indice multiplié par 3 à 10 par rapport à la tendance de l'ensemble des codons calculée dans III1 55 948. Le processus normal de duplication chez les eucaryotes (et non zebrafish) entre en résonance avec ces codons décuplés. Voilà encore une autre illustration de la résonance dans l'ADN.
  • Légende: Décompte des gènes tRNAs par codon suivant la base de données gtRNAdb [5].
    1.   5   : nombre de tRNAs d'un codon se terminant par t. Ce sont les plus faibles.
    2.   113   : nombre de tRNAs d'un codon se terminant par t: Changement de t en c chez les archées et de c en t chez les eucaryotes.
    3. 4 366: Effectif élevé de tRNAs d'un codon se terminant par g chez les procaryotes.
    4. 2622: Effectif faible de tRNAs supérieurs à   t   et à   c   .
    5. 160: Changement de codon   g   Chez les archées et les eucaryotes.
  • Tableaux:
    1. Nombre de tRNAs des 121 eucaryotes, tableau III 92 530.
    2. Pour 100 000 tRNAs des 121 eucaryotes, tableau III100 92 530.
    3. tRNAs pour 1 génome, tableau III1 92 530, indice de la multiplicité = nombre de tRNAs / 121.
  • Tableaux non formatés: voir tableur
III;Nombres de tRNAs. 121 eucaryotes;;;;;;92,530;;III 100;100000  tRNAs. 121 eucaryotes. 92 530;;;;;;;;III 1;tRNAs par génome de tRNAs. 121 eucaryotes;;;;;;92 530

Processus E et résonance des 121 eucaryotes[modifier | modifier le wikicode]

Processus E et résonance des 121 eucaryotes[modifier | modifier le wikicode]

IV 1;Nombres de tRNAs. 121 eucaryotes;;;;;55 830;;;I 1;Nombres de tRNAs. 4032 bactéries ;;;;;;235027;;IV1-I1;E;;;;;;
III 1;Nombres de tRNAs. 121 eucaryotes;;;;;92,530;;;IV 1;Nombres de tRNAs. 121 eucaryotes;;;;;55 830;;;III1−IV1.;;R;;;;;

Sensibilite du processus E[modifier | modifier le wikicode]

IV 1;Nombres de tRNAs. 121 eucaryotes;;;;;55 830;23;;I 1;Nombres de tRNAs. 4032 bactéries ;;;;;235027;23
IV 1.79;Nombres de tRNAs. 121 eucaryotes;;;;;55 830;23;;-37,3;265,0;;;IV1.265;;;
IV1.79p;Nombres de tRNAs. 121 eucaryotes;;;;;55 830;23;;-37,3;265,0;;;IV1.265p;;;
ttt;0,03;tct;1,32;tat;0,04;tgt;0,03;;ttt;12;tct;1 067;tat;37;tgt;44
att;1,77;act;1,50;aat;0,05;agt;0,03;;att;1 427;act;58;aat;39;agt;121
gtt;1,48;gct;2,34;gat;0,04;ggt;0,03;;gtt;661;gct;4 725;gat;-;ggt;113

Zebrafish[modifier | modifier le wikicode]

Comparaison Zebrafish, 121 Eucaryotes, Bactéries[modifier | modifier le wikicode]

IV 100;Nombres de tRNAs. 121 eucaryotes;;;;;55 830;;;;V 100;Danio rerio (Zebrafish) ;;;;12258;;;I 100;Nombres de tRNAs. 4032 bactéries ;;;;;235027;
IV100−V100;;;;;;;;;V100 − I100;;;;;;;;;IV100−I100. ;;% Processus E des 121 Eucaryotes.;;;;;

Comparaison de Zebrafish aux eucaryotes à résonance[modifier | modifier le wikicode]

;fca;;&emsp ;;;bta;;&emsp ;;;ttr*;;&emsp ;;;bacu;;&emsp ;;;cmk;;&emsp ;;;zebra;
&emsp ;;;;;;;;;;;;;;;;;;;;;;;
% e/m;85;;;;74;;;;96;;;;96;;;;63;;;;55;

Zebrafish, distributions des tRNAs sur les chromosomes[modifier | modifier le wikicode]

;2 rRNAs;;chr1;chr2;chr3;chr4;chr5;chr6;chr7;chr8;chr9;chr10;chr11;chr12;chr13;chr14;chr15;chr16;chr17;chr18;chr19;chr20;chr21;chr22;chr23;chr24;chr25;Zv8Na10776;scaffold;total;
;Mit;;;;;;1 rRNA;;;;;;;;;;;;;;;;;;;;;;;;
;−;RNAs au;326;274;362;1252;395;250;322;272;226;186;166;157;230;170;193;308;190;179;185;192;237;293;204;138;129;;1,639;8,475;
75 pb;tRNA/longueur;;0.55;3.35;2.73;75.15;4.30;0.61;1.61;3.33;1.62;0.21;0.28;3.05;0.78;0.14;2.94;0.35;1.94;1.28;0.12;4.86;9.36;6.94;0.15;0.55;1.62;;;;1/10 000

Taurus, distributions des tRNAs sur les chromosomes[modifier | modifier le wikicode]

;;GC% ;40.1;40.8;41.9;40.6;41.7;40;42;41.2;40;41.5;42.9;40.4;43.7;41.4;41.8;42.6;42.3;45.4;46;41;43.1;43.4;43.4;41.9;47.1;42.8;41.8;42.2;44.2;40.6;39.4;49.6;
;;Protein ;1981;2085;2922;1673;2753;1420;2791;1573;1068;2014;2176;886;1740;1066;1946;1452;1411;2691;2718;562;1135;1414;1393;751;1684;991;478;798;1427;1994;13;101;
;;rRNA ;-;-;-;-;-;-;-;-;-;-;-;-;-;-;-;-;-;-;-;-;-;-;-;-;1;-;-;-;-;-;2;-;
;;tRNA ;67;49;171;59;54;51;55;29;39;65;44;47;42;38;47;30;42;50;70;31;26;23;191;19;66;14;33;23;24;79;22;-;
;; RNA ;405;362;462;386;444;320;474;421;281;369;388;268;377;235;269;324;261;378;428;192;460;276;297;192;259;207;147;111;231;488;-;10;
;;Gene ;1267;1237;1832;1142;1715;953;1814;1097;821;1447;1309;660;1111;734;1491;946;893;1648;1570;508;855;762;1134;469;973;559;377;444;903;1643;13;105;
;;Pseudo ;165;163;223;123;218;134;243;142;142;151;122;72;118;95;264;102;115;156;108;67;98;67;93;61;50;62;33;64;109;328;-;4;

Distribution homogène des gènes de tRNA sur les chromosomes, Bos Taurus et Felis catus[modifier | modifier le wikicode]

bta;ggg;ggc;gga;gaa;gag;tgc;tgt;gct; ;fca;cga;aag;caa
bta 30 chromosomes;;;;;;;;;;fca  19 chromosomes;;;

Exemples de distributions des tRNAs sur les chromosomes[modifier | modifier le wikicode]

  • Lien Tableur: Exemples de distributions des tRNAs sur les chromosomes
  • Légende: Bases de données, gtRNAdb.fa [7], NCBI [orgn]
    m, moyenne par chromosome,   e, écart type.
    KEGG   gtRNAdb
    sce   Saccharomyces cerevisiae (S288c Apr 2011)
    mmu   Mus musculus (mm10 Dec 2011)
    has   Homo sapiens (hg38 - GRCh38 Dec 2013)
    oas   Ovis aries (sheep) (Feb 2010)
    dre   Danio rerio (Zebrafish) (Zv8 Apr 2009)
    bta   Bos taurus (Cow Jun. 2014 Bos_taurus_UMD_3.1.1/bosTau8)
;tRNAs;Moyenne par chromosome;;;;NCBI;gtRNAdb;
e/m %;47;130;187;81;354;74;335;36

Archives exemples NCBI[modifier | modifier le wikicode];;;;;;24.11.17 Paris ;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
uma;Ustilago maydis 521;;;;*;uma;;ecartt;3;moy;5;%;69;;ttt;;ecartt;13;moy;26;%;48;;;zro;;;ecartt;12;moy;39;%;32;;;;;;;;;;;;;;
cal;Candida albicans WO-1;;;;*;Type ;Name ;Size;GC% ;Protein ;rRNA ;tRNA ;Gene ;;Type ;Name ;Size ;GC% ;Protein ;tRNA ;Gene ;Pseudo ;;;Type ;Name ;Size ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;;;;;;;;;;;;;;
ttt;Thielavia terrestris NRRL 8126;;;;*;;;19.64;54;6783;34;111;6910;;;6;36.9;54.9;9802;156;9958;4;;;;7;9.76;39.2;4991;9;272;51;5323;;;;;;;;;;;;;;
cgr;Candida glabrata CBS 138;;;;*;Chr;1;2.48;53.9;877;5;11;892;;Chr;1;10.1;54.2;2650;39;2689;-;;;Chr;A;1.11;39.2;580;-;33;5;618;;;;;;;;;;;;;;
zro;Zygosaccharomyces rouxii CBS 732;;;;*;Chr;2;1.88;53.9;652;4;14;668;;Chr;2;9.48;55.1;2573;44;2617;4;;;Chr;B;1.39;38.8;706;-;39;8;753;;;;;;;;;;;;;;
sce;Saccharomyces cerevisiae (S288c Apr 2011);;;;*;Chr;3;1.64;53.7;632;3;6;639;;Chr;3;4.79;52.6;1180;23;1203;-;;;Chr;C;1.46;39;774;-;47;8;829;;;;;;;;;;;;;;
dme;Drosophila melanogaster (D. melanogaster Aug. 2014 BDGP Release 6 + ISO1 MT/dm6);;;;*;Chr;4;0.88;54.4;273;3;5;280;;Chr;4;4.58;55.2;1205;20;1225;-;;;Chr;D;1.5;39.1;768;-;28;7;803;;;;;;;;;;;;;;
tbl;Tetrapisispora blattae CBS 6284;;;;*;Chr;5;1.39;53.8;504;1;7;510;;Chr;5;4.4;55.7;1202;16;1218;-;;;Chr;E;0.88;39.4;416;9;32;10;467;;;;;;;;;;;;;;
ncr;Neurospora crassa OR74A;;;;*;Chr;6;1.03;54.1;335;3;7;344;;Chr;6;3.57;56.3;992;14;1006;-;;;Chr;F;1.55;39.3;806;-;30;3;839;;;;;;;;;;;;;;
mcc;Macaca mulatta (Rhesus Oct. 2010 BGI CR_1.0/rheMac3);;;;*;Chr;7;0.96;54.1;331;2;8;341;;Max Min Total;;;44;14;156;;;;;Chr;G;1.87;39.3;941;-;63;10;1014;;;;;;;;;;;;;;
mmu;Mus musculus (mm10 Dec 2011);;;;*;Chr;8;0.81;54.1;275;1;4;278;;;;;;;;;;;;Max Min Total;;;;63;28;272;;;;;;;;;;;;;;;;
ptr;Pan troglodytes (Chimp Feb. 2011 CSAC 2.1.4/panTro4);;;;*;Chr;9;0.73;53.9;259;1;3;263;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
cpic;Chrysemys picta (western painted turtle);;;;*;Chr;10;0.69;54.2;237;-;3;239;;cgr;;;ecartt;6;moy;16;%;39;;sce;;;ecartt;8;moy;17;%;47;;;;;;;;;;;;;;
cel;Caenorhabditis elegans (WS220 Oct 2010);;;;*;Chr;11;0.69;54.1;239;1;3;242;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;;;;;;;;;;;;
has;Homo sapiens (hg38 - GRCh38 Dec 2013);;;;*;Chr;12;0.65;54;221;-;0;221;;;13;12.32;38.8;5202;4;207;9;5421;;;16;12.07;38.4;5983;12;275;111;6399;18;;;;;;;;;;;;;
bdi;Brachypodium distachyon (JGI v1.0 8X);;;;*;Chr;13;0.61;54;207;-;3;209;;Chr;A;0.49;40.1;200;-;9;-;209;;Chr;I;0.23;39.3;94;-;4;2;101;1;;;;;;;;;;;;;
ath;Arabidopsis thaliana (TAIR10 Feb 2011);;;;*;Chr;14;0.61;54.1;185;1;7;193;;Chr;B;0.5;38.9;212;-;9;1;222;;Chr;II;0.81;38.3;415;-;13;4;432;-;;;;;;;;;;;;;
osa;Oryza sativa;;;;*;Chr;15;0.58;54.5;185;1;3;189;;Chr;C;0.56;39.7;230;-;7;-;237;;Chr;III;0.32;38.5;168;-;10;4;184;2;;;;;;;;;;;;;
cbr;Caenorhabditis briggsae (C. briggsae Jan. 2007 WUGSC 1.0/cb3);;;;*;Chr;16;0.55;54.1;185;-;6;191;;Chr;D;0.65;39.1;283;-;18;-;301;;Chr;IV;1.53;37.9;766;-;28;4;799;1;;;;;;;;;;;;;
ssc;Sus scrofa (Pig Aug. 2011 SGSC Sscrofa10.2/susScr3);;;;*;Chr;17;0.58;54;200;1;7;208;;Chr;E;0.69;39;278;-;9;-;287;;Chr;V;0.58;38.5;287;-;20;9;317;1;;;;;;;;;;;;;
oaa;Ornithorhynchus anatinus (platypus) (WUGSC 5.0.1 Mar 2007);;;;*;Chr;18;0.56;54.3;186;-;1;187;;Chr;F;0.93;38.1;383;-;15;-;398;;Chr;VI;0.27;38.7;128;-;10;4;143;1;;;;;;;;;;;;;
cfa;Canis familiaris (dog) (CanFam3.1 Sept 2011);;;;*;Chr;19;0.57;53.8;200;3;5;207;;Chr;G;0.99;38.6;434;-;18;-;451;;Chr;VII;1.09;38.1;539;-;36;10;585;-;;;;;;;;;;;;;
oas;Ovis aries (sheep) (Feb 2010);;;;*;Chr;20;0.52;53.9;190;2;1;193;;Chr;H;1.05;38.1;460;-;14;-;474;;Chr;VIII;0.56;38.5;290;-;11;4;305;-;;;;;;;;;;;;;
zma;Zea mays (Version 5b.60);;;;*;Chr;21;0.47;54.2;166;1;1;166;;Chr;I;1.1;38.6;462;-;26;1;489;;Chr;IX;0.44;38.9;213;-;10;3;232;6;;;;;;;;;;;;;
;;;;;;Max Min Total;;;;14;0;111;;;Chr;M;1.4;38.5;615;-;18;1;634;;Chr;XIII;0.92;38.2;469;-;21;15;505;-;;;;;;;;;;;;;
;;;;;;;;;;;;;;;Max Min Total;;;;26;7;230;;;;Chr;XV;1.09;38.2;546;-;20;11;579;2;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;;;;;;;;;;Max Min Total;;;;36;4;299;;;;;;;;;;;;;;;;
uma;5270;;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;mmu;;;ecartt;25;moy;19;%;130;;;;ptr;;;ecartt;29;moy;15;%;194;;;;;;;;;;;;
cal;5476;;;;;41;48.3;10785;212;415;176;10533;16;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;;;;;;;;;;
ptr;9598;;;Max Min Total;;;;76;36;443;;;;;Chr;9;124.6;42.9;4406;-;7;1698;2276;374;;;Chr;8;147.91;40.4;2537;-;6;788;1370;256;;;;;;;;;;;
has;9606;;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;Chr;12;120.13;42;2621;-;3;1593;2002;516;;;Chr;11;135.75;41.8;4745;-;13;774;2128;349;;cal;;;ecartt;11;moy;16;%;68;
bdi;15368;;;;;461.75;45.8;7543;0;44;3644;24356;597;;Chr;13;120.42;41.9;2536;-;105;1513;2127;476;;;Chr;12;137.16;41.1;4112;-;10;927;1832;321;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo
;;;;Chr;11;5;44.3;116;-;0;9;52;-;;Un;-;93.44;43.6;2471;2;10;1126;2899;501;;;Chr;22;37.82;48.1;1690;-;0;397;749;85;;Max Min Total;;;;30;1;126;;;
;;;;Chr;13;1.22;50;1;-;0;1;2;-;;Max Min Total;;;;105;0;435;;;;;;Chr;X;155.55;39.8;2653;-;2;515;1470;391;;;;;;;;;;;
;;;;Chr;19;9.08;48;171;-;1;10;98;1;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;;Un;-;264.05;39.9;4163;-;29;804;2678;425;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo
;;;;Chr;21;1.37;50.9;14;-;0;-;9;-;;;;3088.3;42.1;108596;17;421;46261;53816;15820;;;Max Min Total;;;;139;0;418;;;;;;;137.55;41.0;30463;117;297;3816;17640;305
;;;;Chr;24;13.19;46.3;354;-;1;27;191;2;;Chr;2;242.19;40.3;8054;-;8;3638;3862;1166;;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;Chr;2L;23.51;41.8;5683;-;41;917;3490;48
;;;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;Chr;9;138.4;42.3;4572;-;3;2135;2262;702;;;MT;;0.37;44.8;117;3;21;-;131;-;;Un;-;6.16;41.1;6;-;-;-;5;-
;;;;;;100.26;35.5;28155;21;821;25266;46721;1885;;Chr;10;133.8;41.6;5237;-;3;2053;2174;631;;;Pltd;;0.15;36.3;85;7;37;-;129;-;;Max Min Total;;;;100;0;319;;;
;;;;Chr;I;15.07;35.7;4133;6;76;1221;4187;160;;Chr;11;135.09;41.6;6187;-;13;2267;2920;835;;;Max Min Total;;;;238;77;683;;;;;;;;;;;;;;
;;;;Chr;IV;17.49;34.6;5158;-;94;16207;19687;374;;Chr;14;107.04;42.2;3252;-;18;1704;2055;583;;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ;Gene ;;
;;;;Max Min Total;;;;305;76;843;;;;;Chr;18;80.37;39.8;1812;-;1;1013;988;295;;;Chr;3;36.41;43.7;5036;-;73;818;3848;133;;Chr;3;1.78;31.5;689;-;53;742;;
;;;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;Chr;21;46.71;42.2;1240;-;1;687;756;202;;;Chr;6;31.25;43.6;3336;-;33;715;2683;140;;Chr;6;1.05;32;408;-;25;433;;
;;;;Chr;4;48.77;46.3;5464;-;93;1251;4821;368;;Un;-;165.56;44.4;5810;17;186;3064;6445;1957;;;Chr;11;29.02;42.9;2643;-;28;709;2216;182;;Max Min Total;;;;74;5;327;;;
;;;;Chr;5;28.56;47;3166;-;45;813;2790;168;;Max Min Total;;;;144;0;629;;;;;;Chr;12;27.53;43;2458;-;52;627;1968;127;;;;;;;;;;;
;;;;Max Min Total;;;;155;45;563;;;;;;;;;;;;;;;;;Plsm;B1;0;44.2;2;-;-;-;-;-;;;;;;;;;;;
;;;;cbr;;ecartt;27;moy;127;%;22;;;;;;;;;;;;;;;;Max Min Total;;;;84;28;675;;;;;;;;;;;;;;
;;;;Type ;Name ;Size  ;GC% ;Protein ;tRNA ; RNA ;Gene ;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;Max Min Total;;;176;98;774;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene 
;;;;;Chr;23;52.29;39.9;1006;-;3;512;667;124;;Max Min Total;;;;143;0;532;;;;;Chr;23;62.28;41.9;689;-;26;134;423;42;;;;MT;0.02;43.2;13;2;22;-;13
;;;;;Chr;25;51.63;41.4;1305;-;4;574;798;109;;zma;;;ecartt;30;moy;86;%;35;;;Chr;25;45.22;42.4;744;-;20;124;456;73;;;Max Min Total;;;;136;0;418;;
;;;;;Chr;26;38.96;45.4;1478;-;10;466;794;76;;Type ;Name ;Size  ;GC% ;Protein ;rRNA ;tRNA ; RNA ;Gene ;Pseudo;;Chr;26;44.05;41.8;461;-;20;102;324;33;;;;;;;;;;;
;;;;;Chr;30;40.21;41.4;1210;-;5;441;681;86;;Chr;3;235.67;46.9;6181;-;79;1254;4945;368;;Max Min Total;;;;200;19;1591;;;;;;;;;;;;;;
;;;;;Un;-;83.33;47.2;493;-;2;146;474;;;Max Min Total;;;;140;49;945;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;Max Min Total;;;;102;0;419;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;;;;;Type ;Name ;Size ;GC% ;Protein ;rRNA ;tRNA ;RNA ;Gene ;Pseudo;;Type ;Name ;Size ;GC% ;Protein ;rRNA ;tRNA ;RNA ;Gene ;Pseudo;;;;;;;;;;;;;;;;;;;;;;
;;;;;Max Min Total;;;;5723;5;9384;;;;;Chr;28;46.31;42.2;798;-;23;111;444;64;;;;;;;;;;;;;;;;;;;;;;
;;;;;;;;;;;;;;;;Max Min Total;;;;191;14;1600;;;;;;;;;;;;;;;;;;;;;;;;;

Zebrafish Taurus Catus[modifier | modifier le wikicode]

Felis_catus_;F$;Bos_taurus_;B$;Danio_rerio_;D$;;24.11.17 Paris;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;

Les introns des 121 eucaryotes[modifier | modifier le wikicode]

Champignons détail des introns[modifier | modifier le wikicode]

;ttt;ttc;tta;ttg;ctt;ctc;cta;ctg;att;atc;ata;atg;gtt;gtc;gta;gtg;tct;tcc;tca;tcg;cct;ccc;cca;ccg;act;acc;aca;acg;gct;gcc;gca;gcg;tat;tac;taa;tag;cat;cac;caa;cag;aat;aac;aaa;aag;gat;gac;gaa;gag;tgt;tgc;tga;tgg;cgt;cgc;cga;cgg;agt;agc;aga;agg;ggt;ggc;gga;ggg;&emsp ;;total;&emsp ;;DNA;Génome
;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;2;;46;Encephalitozoon cuniculi GB-M1
;0;1;1;1;1;1;1;0;2;0;1;3;0;0;1;1;1;0;1;1;0;0;1;1;2;0;0;0;2;0;1;1;0;1;0;0;0;2;1;1;0;1;1;0;0;2;1;0;0;1;2;0;1;0;2;1;0;1;0;1;0;2;0;1;;47;;53;Exophiala dermatitidis NIH/UT8656
;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;;7;;80;Ogataea parapolymorpha DL-1
;0;0;3;1;1;0;0;0;0;0;1;2;0;0;1;1;0;0;2;1;1;0;3;0;0;0;0;1;0;0;0;0;0;3;0;0;0;1;3;1;0;0;0;3;0;0;1;1;0;0;0;1;2;0;0;0;0;1;0;0;0;0;0;0;;35;;82;Candida orthopsilosis Co 90-125
;0;4;1;0;4;0;1;2;4;0;1;4;4;0;1;1;2;0;1;2;3;0;1;1;1;0;1;1;3;0;1;1;0;2;0;0;0;3;3;2;0;0;1;5;0;3;2;4;0;2;1;2;4;0;2;0;0;0;1;1;0;6;1;1;;91;;96;Sporisorium reilianum SRZ2
;0;3;1;0;4;0;1;2;4;0;1;4;4;0;1;1;3;0;1;3;4;0;1;1;0;0;1;1;5;0;1;1;0;3;0;0;0;2;2;3;0;0;1;5;0;5;2;4;0;2;2;2;4;0;3;0;0;2;1;1;0;6;2;1;;101;;111;Ustilago maydis 521
;0;5;0;3;0;0;1;1;0;0;1;2;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;4;0;0;0;0;0;0;0;0;3;0;0;0;0;0;0;0;0;3;2;0;0;0;0;2;0;0;0;0;0;0;;29;;123;Komagataella pastoris CBS 7435
;0;5;5;6;2;0;0;0;6;0;1;0;0;0;1;0;0;0;0;1;1;0;4;0;0;0;0;1;0;0;0;0;0;4;0;0;0;3;5;0;0;3;1;2;0;0;6;0;0;2;0;2;2;0;0;1;0;2;0;1;0;0;0;0;;67;;125;Candida albicans WO-1
;0;5;1;3;6;0;0;1;6;0;1;6;7;0;0;2;6;0;1;1;6;0;1;1;5;0;1;1;8;0;1;2;0;4;0;0;0;2;2;0;0;4;1;7;0;2;3;10;0;3;0;3;3;0;5;1;0;2;1;3;0;5;1;2;;136;;143;Cryptococcus neoformans var. grubii H99
;0;5;7;1;5;0;1;4;6;0;1;2;0;0;1;3;0;0;1;0;4;0;2;3;4;0;1;2;7;0;2;3;0;4;0;0;0;3;2;4;0;3;1;6;0;6;0;7;0;0;0;0;6;0;1;1;0;3;0;2;0;0;1;2;;117;;154;Thielavia terrestris NRRL 8126
;0;4;0;2;5;0;3;4;7;0;1;3;5;0;1;2;2;0;1;2;1;0;2;1;3;0;3;2;7;0;2;2;0;4;0;0;0;4;2;3;0;3;0;9;0;3;2;8;0;0;0;3;5;0;2;2;0;3;0;2;1;8;0;1;;130;;156;Valsa mali 03-8
;0;6;0;5;1;0;3;0;0;0;2;0;0;0;0;0;0;0;0;1;0;0;6;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;0;0;0;4;0;0;0;0;0;0;0;0;4;0;0;0;0;0;3;0;0;0;0;0;0;;40;;158;Kazachstania naganishii CBS 8797
;0;0;0;7;0;0;2;0;0;0;1;0;0;0;0;0;0;0;0;1;0;0;7;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;1;0;0;4;0;0;0;0;0;0;0;0;4;3;0;0;0;0;2;0;0;0;0;2;0;;39;;162;Kluyveromyces lactis NRRL Y-1140
;0;0;2;4;0;0;1;1;0;0;1;3;9;0;0;0;0;0;2;1;0;0;0;1;0;0;0;0;0;0;0;1;0;4;0;0;0;0;0;0;0;0;0;9;0;0;0;0;0;0;0;0;0;0;0;1;0;3;0;1;0;0;0;0;;44;;168;Schizosaccharomyces pombe 972h-
;0;6;0;0;0;0;0;0;0;0;1;3;0;0;1;0;0;0;0;2;1;0;6;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;0;0;0;3;9;0;0;0;0;0;0;0;0;3;0;0;0;0;2;0;0;0;0;0;0;;42;;170;Scheffersomyces stipitis CBS 6054
;0;5;1;2;6;0;2;3;4;0;1;3;0;0;0;1;0;0;1;2;6;0;2;1;1;0;2;2;0;0;0;0;0;6;0;0;0;0;2;5;0;6;2;0;0;8;2;1;0;3;0;0;0;0;2;2;0;4;0;2;0;0;2;1;;93;;181;Aspergillus nidulans FGSC A4
;0;7;1;2;7;0;1;4;8;0;1;4;6;0;1;2;4;0;2;3;5;0;2;2;4;0;2;2;9;0;3;2;0;5;0;0;0;0;2;6;0;6;0;6;0;0;1;9;0;3;0;0;6;0;2;0;0;3;1;3;0;14;3;3;;157;;190;Magnaporthe oryzae 70-15
;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;2;1;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;0;0;0;4;0;0;0;0;0;0;0;0;4;5;0;0;0;0;3;0;0;0;0;0;0;;25;;191;Cyberlindnera jadinii NBRC 0988 NBRC0988
;0;6;0;8;0;0;4;0;0;0;1;0;0;0;0;0;0;0;0;1;0;0;6;0;0;0;0;0;0;0;0;0;0;7;0;0;0;0;0;0;0;0;5;0;0;0;0;0;0;0;0;4;0;0;0;0;0;3;0;0;0;0;0;0;;45;;192;Torulaspora delbrueckii CBS 1146
;0;0;2;0;6;1;0;3;0;0;2;10;8;0;1;3;3;0;1;2;0;0;0;1;6;0;2;1;0;0;0;2;0;5;1;0;0;11;3;0;0;1;1;0;0;8;1;0;0;3;1;0;0;0;1;0;0;4;0;1;0;0;4;1;;100;;192;Penicillium chrysogenum P2niaD18
;0;5;1;2;7;0;1;4;8;0;1;4;0;0;1;3;0;0;2;0;6;0;2;3;2;0;2;2;7;0;2;3;0;6;0;0;0;4;2;3;0;0;0;9;0;8;0;8;0;0;0;2;5;0;0;2;0;5;1;2;0;0;0;2;;127;;192;Myceliophthora thermophila ATCC 42464
;0;6;0;7;0;0;4;0;0;0;1;0;0;0;0;0;0;0;0;3;0;0;7;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;4;0;0;3;0;0;0;0;0;0;0;0;5;4;0;0;0;0;3;0;0;0;0;0;0;;52;;205;Saccharomycetaceae sp. Ashbya aceri
;0;9;0;2;0;0;2;0;0;0;2;0;0;0;0;0;0;0;0;1;0;0;7;0;0;0;0;0;0;0;0;0;0;6;0;0;0;0;0;0;0;0;6;0;0;0;0;0;0;0;0;4;0;0;0;0;0;3;0;0;0;0;0;0;;42;;206;Tetrapisispora phaffii CBS 4417
;0;6;0;8;0;0;4;0;0;0;2;0;0;0;0;0;0;0;0;1;0;0;7;0;0;0;0;0;0;0;0;0;0;6;0;0;0;0;0;0;0;0;3;0;0;0;0;0;0;0;0;5;0;0;0;0;0;3;0;0;0;0;0;0;;45;;207;Candida glabrata CBS 138
;0;7;2;5;6;0;1;1;8;0;1;4;8;0;2;2;0;0;4;2;4;0;8;1;3;0;2;0;0;0;5;2;0;6;0;0;0;4;0;0;0;6;1;8;0;9;6;9;0;5;0;1;4;0;4;0;0;5;5;0;0;8;0;2;;161;;212;Botrytis cinerea B05.10
;0;8;0;0;0;0;0;0;0;0;2;4;0;0;1;0;0;0;0;1;0;0;7;0;0;0;0;0;0;0;0;0;0;6;0;0;0;0;0;0;0;0;7;10;0;0;0;0;0;0;0;0;4;0;0;1;0;3;0;0;0;0;0;0;;54;;214;Debaryomyces hansenii CBS767
;0;7;1;1;8;0;1;0;0;0;0;4;8;0;1;2;0;1;3;1;8;0;3;0;0;0;3;3;11;0;2;1;0;6;0;0;0;6;2;0;0;6;2;0;0;5;2;0;0;1;1;3;4;0;0;0;0;2;2;1;0;0;2;1;;115;;225;Verticillium dahliae VdLs.17
;0;7;0;8;0;0;3;3;0;0;1;0;0;0;0;0;0;0;0;2;0;0;8;0;0;0;0;0;0;0;3;0;0;6;0;0;0;0;0;0;0;0;4;0;0;0;0;0;0;0;0;5;4;0;0;0;0;3;0;0;0;0;0;0;;57;;229;Lachancea thermotolerans CBS 6340
;0;7;0;0;0;0;1;4;0;0;2;4;0;1;1;3;0;0;1;3;9;0;3;0;0;0;2;2;0;0;0;1;0;13;0;0;0;7;4;0;0;0;3;11;0;13;3;0;1;4;0;0;0;0;0;1;0;6;2;2;0;0;0;0;;114;;242;Aspergillus oryzae RIB40
;0;8;0;11;0;0;3;0;0;0;1;0;0;0;0;0;11;0;0;1;0;0;10;0;0;0;0;0;0;0;0;0;0;7;0;0;0;0;0;1;0;0;5;0;0;0;0;0;0;0;0;5;5;0;0;0;0;4;0;0;0;0;0;0;;72;;258;Lachancea kluyveri NRRL Y-12651
;0;9;0;2;0;0;2;0;0;0;2;0;0;0;0;0;0;0;0;1;0;0;10;0;0;0;0;0;0;0;0;0;0;9;0;0;0;0;0;0;0;0;8;0;0;0;0;0;0;0;0;6;0;0;0;0;0;4;0;0;0;0;0;0;;53;;266;Kazachstania africana CBS 2517
;0;10;0;9;0;0;3;0;0;0;2;0;0;0;0;0;0;0;0;1;0;0;10;0;0;0;0;0;0;0;0;0;0;9;0;0;0;0;0;0;0;0;8;0;0;0;0;0;0;0;0;7;0;0;0;0;0;4;0;0;0;0;0;0;;63;;270;Naumovozyma castellii CBS 4309
;0;9;1;3;6;0;2;5;11;0;3;5;0;0;1;1;0;0;2;2;10;0;3;2;0;0;0;0;12;0;3;3;0;6;0;0;0;7;5;0;0;9;2;12;0;0;4;13;0;0;1;4;0;0;9;0;0;8;2;1;0;15;4;1;;187;;270;Fusarium graminearum CS3005
;0;8;0;10;0;0;5;0;0;0;1;0;0;0;0;0;0;0;3;2;0;0;0;0;0;0;0;0;0;0;0;0;0;7;0;0;0;0;0;0;0;0;7;0;0;0;0;0;0;0;0;6;0;0;0;0;0;5;0;0;0;0;0;0;;54;;272;Zygosaccharomyces rouxii CBS 732
;2;12;1;4;6;0;2;2;0;0;2;6;0;0;2;3;3;0;2;3;4;0;4;2;5;0;2;0;2;0;8;1;0;6;0;0;0;7;4;6;1;12;6;11;1;7;4;10;0;1;0;3;11;0;5;2;0;0;0;6;0;10;3;7;;201;;273;Flammulina velutipes KACC42780
;0;10;0;10;0;0;3;0;0;0;2;0;0;0;0;0;0;0;0;1;0;0;10;0;0;0;0;0;0;0;0;0;0;8;0;0;0;0;0;0;0;0;7;0;0;0;0;0;0;0;0;6;0;0;0;0;0;4;0;0;0;0;0;0;;61;;275;Saccharomyces cerevisiae (S288c Apr 2011)
;0;10;2;4;12;0;2;5;11;0;1;5;0;0;1;1;0;0;2;3;10;0;0;2;4;0;0;0;14;0;3;3;0;8;0;0;0;6;4;0;1;8;2;15;1;0;5;16;0;0;0;5;0;0;7;0;0;7;1;0;0;14;2;0;;197;;285;Fusarium verticillioides 7600
;0;10;0;0;0;0;0;0;0;0;4;6;0;0;2;0;0;0;0;0;0;0;8;0;0;0;0;0;0;0;0;0;0;10;0;0;0;0;0;0;0;0;6;10;0;0;0;0;0;0;0;0;4;0;0;2;0;6;0;0;0;0;0;0;;68;;288;Millerozyma farinosa CBS 7064
;0;10;1;3;13;0;2;5;13;0;3;6;0;0;1;1;0;0;2;2;10;0;3;2;0;0;0;0;13;0;3;2;0;8;0;0;0;7;5;0;0;9;2;16;0;0;4;19;0;0;1;4;0;0;9;0;0;8;2;1;0;14;4;1;;209;;305;Fusarium graminearum PH-1 NRRL 31084
;0;12;0;9;0;0;2;0;0;0;2;0;0;0;0;0;0;0;0;2;0;0;13;0;0;0;0;0;0;0;0;0;0;9;0;0;0;0;0;0;0;0;9;0;0;0;0;0;0;0;0;7;0;0;0;0;0;6;0;0;0;0;0;0;;71;;328;Tetrapisispora blattae CBS 6284
;0;12;1;5;16;0;2;6;17;1;1;7;0;0;2;1;0;0;2;4;11;0;1;4;2;0;3;3;19;0;3;5;0;10;0;1;0;9;3;11;0;1;2;5;0;18;1;24;0;0;0;0;0;0;1;0;0;6;1;5;0;0;0;6;;232;;396;Neurospora crassa OR74A
;0;17;0;3;21;0;2;11;26;0;1;0;0;0;0;3;0;0;2;4;21;0;0;2;0;0;3;1;0;0;0;0;0;14;0;0;0;4;3;14;0;16;4;34;0;28;0;27;0;0;0;13;0;0;25;0;0;6;0;0;0;0;11;0;;316;;510;Yarrowia lipolytica CLIB122
&emsp ;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;

Champignons détail des tRNAs[modifier | modifier le wikicode]

;0;1;1;1;1;0;1;1;1;0;1;2;1;0;1;1;1;0;1;1;1;0;1;1;1;0;1;1;1;0;1;1;0;1;0;0;0;1;1;1;0;2;1;1;0;1;1;1;0;1;0;1;1;0;1;0;0;1;1;1;0;1;1;1;46;ecu;Encephalitozoon cuniculi GB-M1;;;;;1.02
;0;1;1;1;1;1;1;1;2;0;1;1;2;0;1;1;1;0;1;1;0;0;1;1;2;0;1;1;2;0;1;1;0;1;0;0;0;2;1;1;0;1;1;0;0;2;1;2;0;1;0;0;2;0;2;1;0;1;0;1;0;2;1;2;53;ede*;Exophiala dermatitidis NIH/UT8656;;;;;1.16
;0;3;1;3;1;0;1;1;4;0;1;4;3;0;0;1;2;0;1;1;0;0;3;0;3;0;1;1;3;0;2;0;0;2;0;0;0;2;2;1;0;2;2;3;0;3;2;3;0;1;0;2;2;0;0;1;0;2;3;1;0;4;2;0;80;opa*;Ogataea parapolymorpha DL-1;;;;;1.78
;0;2;3;1;1;0;0;1;4;0;1;4;4;0;1;1;2;0;2;1;1;0;3;0;4;0;2;1;3;0;2;0;0;3;0;0;0;1;3;1;0;3;4;3;0;5;2;1;0;1;0;1;2;0;0;1;0;1;2;1;0;2;1;0;82;cot;Candida orthopsilosis Co 90-125;;;;;1.82
;0;4;1;0;4;0;1;2;4;0;1;4;4;0;1;0;2;0;1;2;3;0;1;1;4;0;1;1;3;0;1;1;0;2;0;0;0;3;3;2;0;3;1;5;0;3;2;4;0;2;1;2;4;0;2;0;0;0;1;1;0;6;1;1;96;sre*;Sporisorium reilianum SRZ2;;;;;2.11
;0;3;1;0;4;0;2;2;4;0;1;4;4;0;1;1;3;0;1;3;4;1;1;1;4;0;1;1;5;0;1;1;0;3;0;0;0;2;2;3;0;3;1;5;0;5;2;5;0;2;2;2;4;0;3;0;0;2;1;1;0;6;2;1;111;uma;Ustilago maydis 521;;;;;2.40
;0;5;1;3;2;0;1;2;5;0;1;4;5;0;1;1;4;0;2;1;2;0;4;1;5;0;1;1;5;0;2;0;0;4;0;0;0;3;3;2;0;4;3;5;0;6;5;4;0;2;0;3;2;0;1;1;0;2;4;1;0;5;3;1;123;kpa*;Komagataella pastoris CBS 7435;;;;;2.73
;0;5;5;6;2;0;0;1;6;0;1;4;6;0;1;1;4;0;3;1;1;0;4;0;4;0;2;1;6;0;2;0;0;4;0;0;0;3;5;1;0;3;5;2;0;6;6;1;0;2;0;2;2;0;0;1;0;2;5;1;0;5;2;1;125;cal;Candida albicans WO-1;;;;;2.78
;0;5;1;3;6;0;0;1;6;0;1;7;7;0;0;2;6;0;1;1;6;0;1;0;5;0;1;1;8;0;1;2;0;4;0;0;0;4;2;3;0;4;1;7;0;0;3;10;0;3;0;3;3;0;5;1;0;2;1;3;0;9;3;0;143;cneg*;Cryptococcus neoformans var. grubii H99;;;;;3.18
;0;5;5;1;5;0;1;4;6;0;1;5;6;0;1;3;3;0;1;3;4;0;2;3;4;0;1;2;7;0;2;3;0;4;0;0;0;3;2;4;0;3;2;6;0;6;2;7;0;3;0;4;6;0;1;3;0;3;1;2;0;10;2;2;154;ttt;Thielavia terrestris NRRL 8126;;;;;3.42
;0;4;0;2;5;0;1;4;7;0;1;8;7;0;1;2;5;0;1;2;0;0;2;1;4;0;3;2;7;0;2;2;0;4;0;0;0;5;2;4;0;5;0;9;0;6;3;9;0;3;0;3;6;0;2;2;0;3;1;2;0;9;3;2;156;vma*;Valsa mali 03-8;;;;;3.47
;0;6;3;5;1;0;3;0;7;0;2;4;7;0;1;2;7;0;1;1;1;0;6;0;7;0;2;1;7;0;1;1;0;5;0;0;0;4;4;2;0;6;4;7;0;8;5;3;0;4;0;4;3;0;0;1;0;3;6;1;0;9;1;2;158;kna*;Kazachstania naganishii CBS 8797;;;;;3.51
;0;5;3;7;0;1;2;0;7;0;1;6;7;0;1;2;6;0;2;1;1;0;7;0;6;0;2;1;7;0;3;0;0;5;0;0;0;4;6;1;0;6;4;9;0;8;8;2;0;3;0;4;3;0;0;1;0;2;7;1;0;7;2;1;162;kla;Kluyveromyces lactis NRRL Y-1140;;;;;3.58
;0;5;2;4;5;0;1;1;8;0;1;7;9;0;2;1;7;0;2;1;6;0;2;1;7;0;2;1;6;0;2;1;0;4;0;0;0;4;4;2;0;6;3;9;0;8;4;6;0;3;0;3;8;0;1;1;0;3;2;1;0;8;3;1;168;spo;Schizosaccharomyces pombe 972h-;;;;;3.73
;0;6;3;8;3;0;0;1;7;0;1;6;7;0;2;1;6;0;2;2;1;0;6;0;7;0;2;1;7;0;3;0;0;5;0;0;0;4;5;2;0;7;3;9;0;8;8;2;0;3;0;4;3;0;0;1;0;2;7;1;0;10;3;1;170;pic;Scheffersomyces stipitis CBS 6054;;;;;3.78
;0;5;1;2;6;0;2;3;7;0;1;7;8;0;1;2;5;0;1;2;6;0;2;2;6;0;2;2;8;0;2;3;0;6;0;0;0;5;2;5;0;6;2;8;0;8;3;8;0;3;0;3;9;0;2;2;0;4;2;2;0;11;3;1;181;ani;Aspergillus nidulans FGSC A4;;;;;4.02
;0;7;1;2;7;0;1;4;8;0;1;8;6;0;1;2;4;0;2;3;5;0;2;2;6;0;2;2;9;0;3;2;0;5;0;0;0;4;2;6;0;6;2;9;0;10;3;9;0;3;0;4;6;0;2;2;0;3;1;3;0;14;3;3;190;mgr;Magnaporthe oryzae 70-15;;;;;4.22
;0;8;1;7;4;0;3;1;6;1;1;7;9;0;2;3;7;0;3;1;0;0;7;0;6;0;3;1;6;0;3;0;0;5;0;0;0;6;6;2;0;7;5;8;0;8;4;9;0;3;1;4;6;0;0;1;0;3;7;0;0;11;4;1;191;cjd*;Cyberlindnera jadinii NBRC 0988 NBRC0988;;;;;4.20
;0;6;3;8;0;1;4;0;8;0;1;7;12;0;1;2;7;0;2;1;1;0;6;0;9;0;2;1;8;0;4;0;0;6;0;0;0;4;6;2;0;7;5;10;0;9;8;4;0;3;0;4;4;0;0;1;0;3;7;1;0;11;2;1;192;tdl;Torulaspora delbrueckii CBS 1146;;;;;4.24
;0;5;0;0;6;1;0;3;10;0;2;10;9;0;1;3;7;0;1;2;0;0;0;1;12;0;3;2;8;0;2;2;0;5;0;0;0;11;3;5;0;6;1;9;0;9;3;10;0;3;1;0;10;0;2;2;0;4;0;2;0;11;4;1;192;pch*;Penicillium chrysogenum P2niaD18;;;;;4.22
;0;5;1;2;7;0;1;4;8;0;1;8;7;0;2;3;5;0;3;3;6;0;2;3;6;0;2;3;7;0;2;3;0;6;0;0;0;4;2;5;0;6;3;9;0;10;2;8;0;3;1;4;7;0;1;2;0;5;1;2;0;11;4;2;192;mth*;Myceliophthora thermophila ATCC 42464;;;;;4.24
;0;7;3;7;0;1;4;1;9;0;1;10;7;0;3;4;7;0;3;3;1;0;7;0;7;0;3;2;7;0;5;2;0;5;0;0;0;5;4;4;0;8;4;9;0;10;3;8;0;3;1;5;4;0;0;2;0;3;7;1;0;11;2;2;205;sas*;Saccharomycetaceae sp. Ashbya aceri;;;;;4.51
;0;9;9;2;0;1;2;0;10;0;2;8;10;0;2;1;8;0;2;1;1;0;7;0;9;0;2;1;9;0;3;0;0;6;0;0;0;5;7;1;0;9;6;9;0;12;11;1;0;4;0;4;3;0;0;1;0;3;8;1;0;13;2;1;206;tpf;Tetrapisispora phaffii CBS 4417;;;;;4.56
;0;6;3;8;0;1;4;0;9;0;2;7;10;0;2;1;9;0;2;1;1;0;7;0;9;0;3;1;10;0;5;0;0;6;0;0;0;6;6;2;0;9;3;12;0;9;9;3;0;3;0;5;4;0;0;1;0;3;9;1;0;12;2;1;207;cgr;Candida glabrata CBS 138;;;;;4.58
;0;7;2;5;6;0;1;1;8;0;1;8;8;0;2;2;7;0;3;2;4;0;7;1;6;0;3;0;8;0;5;2;0;6;0;0;0;4;6;2;0;6;3;10;0;9;6;9;0;5;0;6;6;0;4;2;0;5;5;1;1;8;2;7;212;bfu;Botrytis cinerea B05.10;;;;;4.69
;0;8;9;4;2;0;0;1;9;1;2;10;10;0;1;1;6;0;4;1;1;0;7;0;8;0;2;1;7;0;5;1;0;6;0;0;0;6;7;1;0;9;8;10;0;10;9;1;0;4;1;4;5;0;0;1;0;3;10;1;0;11;5;1;214;dha;Debaryomyces hansenii CBS767;;;;;4.71
;0;7;1;1;8;0;1;4;9;0;0;9;11;0;1;2;6;1;2;4;8;0;3;2;8;0;2;3;11;0;2;4;1;6;0;0;0;6;2;5;0;6;2;12;0;10;2;12;0;5;1;3;9;0;2;2;0;5;3;2;0;13;3;3;225;vda;Verticillium dahliae VdLs.17;;;;;4.93
;0;7;2;8;0;2;3;3;10;0;1;8;11;0;1;3;9;0;2;2;2;0;8;0;9;0;2;1;10;0;3;2;0;6;0;0;0;5;5;5;0;7;4;14;0;10;6;11;0;4;0;5;4;0;0;1;0;3;9;1;0;15;3;2;229;lth;Lachancea thermotolerans CBS 6340;;;;;5.04
;0;7;2;0;0;0;1;4;10;0;2;6;10;1;2;3;7;0;1;3;9;0;2;0;10;0;2;2;10;0;3;4;1;13;0;0;0;8;4;7;0;8;3;11;0;13;6;11;1;4;0;4;12;0;2;3;0;6;2;2;0;15;4;1;242;aor;Aspergillus oryzae RIB40;;;;;5.31
;0;8;3;11;0;1;3;0;12;0;1;10;14;0;1;3;11;0;2;1;1;1;10;0;12;0;2;1;13;0;4;0;0;7;0;0;0;6;10;1;0;9;5;14;0;13;13;3;0;5;0;5;5;0;0;1;0;4;12;1;0;15;2;2;258;lkl*;Lachancea kluyveri NRRL Y-12651;;;;;5.69
;0;9;14;2;2;0;2;0;13;0;2;9;13;0;2;1;11;0;4;1;1;0;10;0;11;0;3;1;12;0;5;0;0;9;0;0;0;6;9;1;0;10;8;12;0;13;15;2;0;5;0;6;4;0;0;1;0;4;11;1;0;17;3;1;266;kaf;Kazachstania africana CBS 2517;;;;;5.91
;0;10;7;9;2;0;3;0;12;0;2;9;13;0;2;2;12;0;4;1;1;0;10;0;11;0;3;2;12;0;5;0;0;9;0;0;0;8;9;1;0;10;8;14;0;14;13;1;0;4;0;7;5;0;0;2;0;4;10;1;0;13;3;2;270;ncs;Naumovozyma castellii CBS 4309;;;;;6.00
;0;9;1;3;6;0;2;5;11;0;2;5;16;0;2;3;11;0;2;2;10;0;3;2;11;0;4;3;13;0;3;3;0;6;0;0;0;7;5;7;0;9;2;12;0;10;4;13;0;5;1;4;10;0;9;1;0;8;2;2;0;15;5;1;270;fgr;Fusarium graminearum CS3005;;;;;5.98
;0;8;4;10;0;1;5;0;11;1;1;9;12;0;2;4;12;0;3;2;3;0;10;0;10;0;2;2;12;0;9;0;0;7;0;0;0;6;10;3;0;9;7;14;0;14;10;4;0;4;0;6;5;0;0;1;0;5;8;2;0;17;5;2;272;zro;Zygosaccharomyces rouxii CBS 732;;;;;6.00
;2;15;1;4;6;0;2;2;10;0;2;14;7;0;3;3;7;0;2;3;4;0;4;2;7;0;3;4;13;0;9;5;0;6;0;0;0;3;4;6;1;12;6;11;1;2;6;11;0;4;0;4;13;0;8;2;0;4;2;6;0;11;8;8;273;fve*;Flammulina velutipes KACC42780;;;;;5.98
;0;10;7;10;0;1;3;0;13;0;2;10;14;0;2;2;11;0;3;1;2;0;10;0;11;0;4;1;11;0;5;0;0;8;0;0;0;7;9;1;0;10;7;14;0;16;14;2;0;4;0;6;6;0;0;1;0;4;11;1;0;16;3;2;275;sce;Saccharomyces cerevisiae (S288c Apr 2011);;;;;6.09
;0;10;2;4;12;0;2;5;11;0;1;8;13;0;2;3;10;0;2;3;10;0;3;2;11;0;4;2;14;0;3;3;0;8;0;0;0;6;4;8;0;8;2;15;0;14;5;16;0;5;0;5;10;0;7;1;0;7;2;2;0;14;5;1;285;fvr;Fusarium verticillioides 7600;;;;;6.33
;0;10;4;14;4;0;0;2;12;0;4;10;12;0;2;4;10;0;4;2;2;0;8;0;10;0;4;2;12;0;8;2;0;10;0;0;0;8;8;4;0;12;6;10;0;14;8;8;0;4;0;6;4;0;0;2;0;6;10;2;0;16;6;2;288;mfa*;Millerozyma farinosa CBS 7064;;;;;6.40
;0;11;2;3;13;0;2;5;13;0;2;6;19;0;2;3;11;0;2;2;10;0;3;2;11;0;4;3;14;0;4;2;0;8;0;0;0;7;5;7;0;9;3;16;0;14;5;19;0;5;1;4;10;0;9;1;0;8;2;2;0;14;6;1;305;fgr;Fusarium graminearum PH-1 NRRL 31084;;;;;6.76
;0;12;12;9;0;1;2;0;17;0;2;11;18;0;2;1;16;0;4;2;1;0;13;0;15;0;3;1;19;0;5;0;0;9;0;0;0;7;10;1;0;11;9;15;0;19;16;1;0;5;0;7;4;0;0;1;0;6;13;1;0;23;3;1;328;tbl;Tetrapisispora blattae CBS 6284;;;;;7.27
;0;12;1;5;17;0;2;6;17;1;1;17;19;0;2;4;14;0;3;4;11;0;4;4;12;0;3;3;19;0;3;5;0;10;0;0;0;9;3;11;0;12;2;24;0;18;5;24;0;7;0;7;21;0;2;3;0;6;5;5;0;26;4;3;396;ncr;Neurospora crassa OR74A;;;;;8.78
;0;17;1;3;21;0;2;13;26;0;1;18;24;0;2;8;21;0;2;4;21;0;3;2;22;0;3;2;30;0;4;2;0;14;0;0;0;12;3;15;0;16;4;34;0;28;6;27;0;8;0;13;1;0;25;0;0;6;4;1;0;30;11;0;510;yli;Yarrowia lipolytica CLIB122;;;;;11.33

Non champignons détail des introns[modifier | modifier le wikicode]

;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0; ;1; ;35;pfa;Plasmodium falciparum
;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;3;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;3;;82;lma;Leishmania major
;0;0;0;2;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;6;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;10;;155;mgp;Meleagris gallopavo (turkey) (TGC Turkey_2.01 Dec 2009)
;0;0;0;3;0;0;0;0;0;0;1;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;;12;;191;mun*;Melopsittacus undulatus (Budgerigar Sep. 2011 WUSTL v6.3/melUnd1)
;0;0;0;2;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;9;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;14;;203;gfr;Geospiza fortis (Medium ground finch Apr. 2012 GeoFor_1.0/geoFor1)
;0;0;0;2;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;6;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;;11;;211;acs;Anolis carolinensis (lizard) (Broad AnoCar2.0 May 2010)
;0;0;0;2;0;0;0;0;1;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;13;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;;18;;230;tgu;Taeniopygia guttata (Zebra finch Feb. 2013 WashU taeGut324/taeGut2)
;0;0;0;3;0;0;0;0;0;0;3;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;4;1;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;4;0;0;0;0;0;;21;;252;mlu*;Myotis lucifugus (Microbat Jul. 2010 Broad Institute Myoluc2.0/myoLuc2)
;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;10;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;15;;256;dsi;Drosophila simulans (D. simulans Apr. 2005 WUGSC mosaic 1.0)
;0;0;0;3;0;0;0;0;0;0;3;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;8;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;4;0;0;0;0;0;;18;;258;mmr*;Microcebus murinus (Mouse lemur) (Jun 2003)
;0;0;0;3;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;15;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;;22;;283;gga;Gallus gallus (galGal4 Nov 2011)
;0;0;0;4;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;9;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;15;;289;dme;Drosophila melanogaster (D. melanogaster Aug. 2014 BDGP Release 6 + ISO1 MT/dm6)
;1;0;0;5;0;0;0;0;3;9;10;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;8;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;3;0;0;0;0;0;;41;;326;oga*;Otolemur garnettii (Bushbaby Mar. 2011 Broad/otoGar3)
;0;0;0;4;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;9;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;15;;326;dya;Drosophila yakuba (D. yakuba Nov. 2005 WUGSC 7.1)
;0;0;0;6;1;0;0;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;8;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;;26;;334;sbq;Saimiri boliviensis (Squirrel monkey Oct. 2011 Broad/saiBol1)
;0;0;0;4;0;0;0;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;10;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;4;0;0;0;0;0;;22;;338;opr*;Ochotona princeps (Pika May 2012 OchPri3.0/ochPri3)
;0;0;0;7;0;0;0;0;0;0;6;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;8;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;4;0;0;0;0;0;;26;;353;meu*;Macropus eugenii (Wallaby Sep. 2009 TWGS Meug_1.1/macEug2)
;0;0;0;4;0;0;0;0;0;0;3;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;1;0;7;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;4;0;0;0;0;0;;22;;367;hgl;Heterocephalus glaber (Naked mole-rat Jan. 2012 Broad HetGla_female_1.0/hetGla2)
;0;0;1;4;0;0;0;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;7;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;4;0;0;0;0;0;;21;;373;lcm;Latimeria chalumnae (Coelacanth Aug. 2011 Broad/latCha1)
;0;0;0;4;0;0;0;1;0;0;4;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;9;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;4;0;0;0;0;0;;25;;374;san*;Sorex araneus (Shrew Aug. 2008 Broad/sorAra2)
;0;0;0;5;0;0;0;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;15;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;4;0;0;0;0;0;;28;;383;cpo*;Cavia porcellus (Guinea pig) (Broad Feb 2008)
;1;0;0;0;0;0;0;0;0;0;3;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;;15;;407;rno;Rattus norvegicus (rn5 Mar 2012)
;0;0;0;5;0;0;0;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;11;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;3;0;0;0;0;0;0;0;0;5;0;0;0;0;0;;29;;408;cjc;Callithrix jacchus (marmoset) (WUGSC 3.2 Mar 2009)
;0;0;0;7;0;0;0;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;15;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;;31;;411;pha*;Papio hamadryas (baboon) (Nov 2008)
;0;0;0;3;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;22;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;27;;414;aga;Anopheles gambiae
;0;0;0;0;0;0;0;0;0;0;0;11;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;8;0;1;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;21;;418;ppp;Physcomitrella patens 
;1;0;0;5;1;0;0;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;13;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;;31;;421;nle;Nomascus leucogenys (Gibbon Oct. 2012 GGSC Nleu3.0/nomLeu3)
;0;0;0;6;0;0;0;0;0;0;5;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0;0;2;0;0;0;0;1;13;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;4;0;0;0;0;0;;34;;435;ggo;Gorilla gorilla gorilla (gorilla) (gorGor3.1 May 2011)
;0;0;0;3;0;0;0;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;11;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;4;0;0;0;0;0;;22;;446;shr;Sarcophilus harrisii (Tasmanian devil Feb. 2011 WTSI Devil_ref v7.0/sarHar1)
;0;0;0;3;0;0;0;0;0;0;4;0;0;0;0;0;0;0;2;0;0;1;26;1;0;0;0;0;0;0;0;0;0;8;3;0;1;0;60;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;4;0;0;0;0;0;;114;;455;tsy*;Tarsius syrichta (Tarsier Sep. 2013 Tarsius_syrichta-2.0.1/tarSyr2)
;0;0;0;8;0;0;0;0;0;0;6;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;13;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;;34;;458;mcc;Macaca mulatta (Rhesus Oct. 2010 BGI CR_1.0/rheMac3)
;0;0;0;4;0;0;0;0;0;0;4;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;10;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;;25;;469;mmu;Mus musculus (mm10 Dec 2011)
;0;0;0;8;0;0;0;0;0;0;6;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;14;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;;35;;476;pan*;Papio anubis (Baboon Mar. 2012 Baylor Panu_2.0/papAnu2)
;0;0;0;4;0;0;0;0;0;0;6;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;14;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;;30;;481;mdo;Monodelphis domestica (opossum) (Broad Oct 2006)
;0;0;0;6;0;0;0;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;13;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;4;0;0;0;0;0;;30;;485;eeu*;Erinaceus europaeus (Hedgehog May 2012 EriEur2.0/eriEur2)
;0;0;0;6;0;0;0;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;14;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;;32;;494;ecb;Equus caballus (horse) (Sep 2007)
;0;0;0;4;0;0;0;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;11;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;4;0;0;0;0;0;;23;;498;cge;Cricetulus griseus cell line CHO-K1 (Chinese hamster ovary CriGri 1.0 Aug 2011)
;0;0;1;0;0;0;0;0;0;1;1;11;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;2;10;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;;32;;499;vvi;Vitis vinifera (Grapevine 12X)
;0;0;0;5;0;0;0;0;0;0;5;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0;0;1;0;0;0;0;1;13;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;5;0;0;0;0;0;;34;;503;ptr;Pan troglodytes (Chimp Feb. 2011 CSAC 2.1.4/panTro4)
;0;0;0;3;0;0;0;0;0;0;7;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;11;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;1;;27;;506;ocu;Oryctolagus cuniculus (rabbit) (Broad Apr 2009)
;0;0;0;5;1;0;0;0;0;0;6;0;0;0;0;0;0;1;0;0;1;0;0;0;0;0;0;1;0;0;0;0;1;15;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;7;0;0;0;0;0;;40;;517;ppy*;Pongo pygmaeus abelii (Orangutan July 2007 WUGSC 2.0.2/ponAbe2)
;0;0;0;6;0;0;0;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;11;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;;27;;518;csi*;Ceratotherium simum (White rhinoceros May 2012 CerSimSim1.0/cerSim1)
;0;0;1;7;0;0;0;0;0;0;5;0;0;0;0;1;0;20;0;0;0;0;0;0;0;0;0;0;0;0;0;0;3;11;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;8;0;0;0;0;0;;58;;540;tng;Tetraodon nigroviridis (tetraodon) (Genoscope 8.0 Mar 2007)
;0;0;0;7;0;0;0;0;0;1;12;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;10;0;0;0;0;0;;36;;554;cpic;Chrysemys picta bellii (Painted turtle Dec. 2011 v3.0.1/chrPic1)
;0;0;0;9;0;0;0;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;15;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;12;0;0;0;0;0;;43;;575;tru;Takifugu rubripes (Fugu Oct. 2011 FUGU5/fr3)
;0;0;0;0;0;0;0;1;0;0;0;17;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;1;12;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;32;;578;sbi;Sorghum bicolor (Version 1.0)
;0;0;2;0;0;0;0;0;0;0;4;13;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;1;9;0;0;0;0;2;0;1;0;2;0;0;0;3;0;0;0;1;0;0;0;0;0;0;1;0;0;0;0;0;0;;40;;582;mtr;Medicago truncatula (March 2009 Version 3.0)
;0;0;0;7;2;0;0;0;0;0;3;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;19;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;34;;596;cel;Caenorhabditis elegans (WS220 Oct 2010)
;6;0;0;0;35;1;0;1;0;0;1;13;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;17;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;74;;618;pop;Populus trichocarpa (Jan 2010 Version 2.0) 
;0;0;0;5;0;0;0;0;0;0;5;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;1;0;0;0;0;1;13;0;1;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;0;0;0;0;5;0;0;0;0;0;;34;;622;hsa;Homo sapiens (hg38 - GRCh38 Dec 2013)
;0;0;0;0;0;0;0;0;0;0;0;17;2;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;12;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;3;0;1;0;0;0;0;;36;;639;bdi;Brachypodium distachyon (JGI v1.0 8X)
;0;0;0;7;0;0;0;0;1;0;24;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;3;17;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;22;0;0;0;0;0;;76;;674;oni*;Oreochromis niloticus (Nile tilapia Jan. 2011 Broad oreNil1.1/oreNil2)
;0;0;0;0;0;0;0;0;0;2;0;11;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;70;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;83;;684;ath;Arabidopsis thaliana (TAIR10 Feb 2011)
;0;0;0;0;0;0;0;0;0;0;0;15;0;0;0;0;0;0;1;0;0;0;0;0;0;0;1;0;0;1;0;0;1;13;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;2;0;0;0;0;0;0;;36;;738;osa;Oryza sativa
;0;0;0;0;0;0;0;0;0;0;0;18;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;20;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;39;;738;gmx;Glycine max (soybean) (Wm82.a2)
;0;0;0;10;0;0;0;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;19;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;34;;743;cbr;Caenorhabditis briggsae (C. briggsae Jan. 2007 WUGSC 1.0/cb3)
;0;0;0;6;0;0;0;0;0;0;5;0;0;0;0;0;0;0;1;0;0;0;1;0;0;0;0;0;0;0;0;0;0;9;0;1;0;0;2;1;1;1;1;25;0;0;0;0;0;0;0;0;0;0;1;0;0;0;8;1;0;0;2;0;;66;;749;mpu*;Mustela putorius furo (Ferret Apr. 2011 MusPutFur1.0/musFur1)
;0;0;0;4;1;0;0;0;0;0;4;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;1;0;8;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;4;0;0;0;0;0;;24;;804;str*;Spermophilus tridecemlineatus (Squirrel Nov. 2011 Broad/speTri2)
;0;0;0;6;0;0;0;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;16;0;0;0;0;0;0;1;1;0;0;1;17;0;0;0;0;0;0;0;0;0;0;0;1;6;0;0;2;0;0;;56;;807;ssc;Sus scrofa (Pig Aug. 2011 SGSC Sscrofa10.2/susScr3)
;0;0;0;7;0;0;0;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;24;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;35;;827;cja*;Caenorhabditis japonica (WUGSC 3.0.2 Mar 2008)
;0;1;0;10;0;0;0;0;0;0;9;0;0;0;0;0;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;26;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;5;0;0;0;0;0;;54;;856;oaa;Ornithorhynchus anatinus (platypus) (WUGSC 5.0.1 Mar 2007)
;0;0;0;4;0;0;0;1;0;0;5;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;1;0;0;0;0;8;0;0;0;0;3;1;0;0;2;33;0;0;1;2;0;0;0;0;0;0;1;0;0;0;4;1;0;0;0;0;;68;;906;cfa;Canis familiaris (dog) (CanFam3.1 Sept 2011)
;0;0;0;0;0;0;0;0;0;0;13;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;24;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;;38;;1065;spu;Strongylocentrotus purpuratus (Sea urchin) 
;0;1;0;14;0;0;0;0;0;1;6;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;26;0;0;0;2;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;;52;;1095;cbr*;Caenorhabditis brenneri (WUGSC 6.0.1 Feb 2008)
;0;0;0;6;0;0;0;0;0;0;5;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;9;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;1;0;0;0;0;0;0;0;0;5;0;0;0;1;2;;31;;1119;dno*;Dasypus novemcinctus (Armadillo Dec. 2011 Baylor/dasNov3)
;0;0;0;4;1;0;0;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;8;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;4;0;0;3;0;2;;29;;1176;oas;Ovis aries (sheep) (Feb 2010)
;0;0;0;0;0;0;0;0;0;0;0;22;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;13;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;;37;;1198;zma;Zea mays (Version 5b.60)
;0;0;0;9;0;0;0;1;0;0;5;0;0;0;0;0;0;0;1;0;0;0;1;1;0;0;0;0;0;0;0;0;0;11;0;1;0;0;3;3;0;1;3;45;0;0;0;0;0;0;0;0;0;1;3;0;0;0;5;2;0;0;0;0;;96;;1463;aml;Ailuropoda melanoleuca (panda) (BGI-Shenzhen AilMel 1.0 Dec 2009)
;2;0;0;12;0;0;0;0;0;0;16;1;0;0;1;0;0;0;1;0;0;0;0;0;0;0;2;0;0;0;0;0;0;50;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;19;0;0;0;0;0;;105;;1492;gmo*;Gadus morhua (Atlantic cod May 2010 Genofisk GadMor_May2010/gadMor1)
;0;0;6;17;1;0;0;0;0;0;4;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;19;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;9;0;0;0;3;0;;60;;2002;lav;Loxodonta africana (elephant) (Broad/July 2009)
;0;0;0;8;1;0;0;0;0;0;7;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;14;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;7;0;0;1;3;0;;41;;2017;tma*;Trichechus manatus latirostris (Manatee Oct. 2011 Broad v1.0/triMan1)
;0;0;0;22;0;0;0;0;0;0;9;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;86;2;0;0;0;2;0;0;3;6;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;2;0;1;0;0;0;;133;;2485;pma*;Petromyzon marinus (Lamprey Sep. 2010 WUGSC 7.0/petMar2)
;0;0;3;5;0;0;0;0;0;0;58;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;17;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;62;0;0;0;0;0;;146;;2489;gac*;Gasterosteus aculeatus (stickleback) (Broad 1.0 Feb 2006)
;0;0;1;19;0;0;0;0;0;0;43;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;105;0;1;0;1;0;0;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;103;0;0;0;1;0;;275;;2639;xtr;Xenopus tropicalis (frog) (JGI 4.2 Nov 2009)
;0;0;3;7;0;0;0;0;0;0;6;0;0;0;0;0;0;0;4;0;0;1;7;1;0;0;0;1;0;0;1;1;0;10;3;4;0;2;75;7;1;2;4;214;0;0;0;7;0;0;2;2;0;0;102;2;0;0;5;9;1;0;2;1;;487;;3729;fca;Felis catus (cat) (Felis_catus-6.2 Sept 2011)
;0;0;0;6;1;0;1;0;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;1;1;0;0;0;0;17;0;0;0;0;1;1;0;0;0;1;0;0;1;1;0;2;0;1;0;0;0;0;0;0;6;0;2;1;3;5;;57;;4040;bta;Bos taurus (Cow Jun. 2014 Bos_taurus_UMD_3.1.1/bosTau8)
;0;0;0;5;0;0;0;1;0;0;5;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;17;0;0;0;0;0;0;0;0;0;0;0;1;7;1;0;0;0;0;0;0;0;0;0;0;5;0;0;0;3;2;;47;;5845;ttr*;Tursiops truncatus (Dolphin Oct. 2011 Baylor Ttru_1.4/turTru2)
;0;0;0;6;0;0;0;0;0;0;5;0;0;0;0;0;0;1;0;0;0;0;0;0;0;0;0;0;0;0;0;0;0;13;0;0;0;0;0;0;0;0;0;0;1;0;12;1;0;0;0;1;0;0;0;0;0;0;5;0;0;0;3;2;;50;;7080;bacu;Balaenoptera acutorostrata scammoni (Minke whale Oct. 2013 BalAcu1.0/balAcu1)
;0;0;0;9;0;0;1;1;0;0;17;0;0;0;1;1;0;0;0;0;12;3;13;8;3;0;0;0;0;0;0;1;1;34;0;0;0;0;0;0;0;0;35;0;0;0;2;0;1;0;0;0;0;0;22;0;0;0;12;0;0;0;0;0;;177;;13727;cmk;Callorhinchus milii (Elephant shark Dec. 2013 Callorhinchus_milii-6.1.3/calMil1)

Non champignons détail des tRNAs[modifier | modifier le wikicode]

;;Non champignons détail tRNAs;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
35;pfa;Plasmodium falciparum;;;0.78;0;1;1;1;1;0;1;1;1;0;1;2;1;0;1;1;1;0;1;1;1;0;1;1;0;0;1;1;1;0;1;1;0;1;0;0;0;0;1;1;0;1;0;0;0;1;1;1;0;0;0;0;0;0;1;0;0;1;1;0;0;0;1;0
82;lma;Leishmania major;;;1.82;0;2;1;1;3;0;1;2;3;0;1;4;2;0;1;2;1;0;1;1;2;0;1;2;3;0;1;2;2;0;1;2;0;3;0;0;0;2;1;3;0;3;1;3;0;3;1;2;0;1;0;1;4;0;1;1;0;2;1;1;0;4;1;1
155;mgp;Meleagris gallopavo (turkey) (TGC Turkey_2.01 Dec 2009);;;3.42;0;6;1;2;1;0;1;4;3;0;1;11;3;1;2;3;5;0;3;1;7;0;2;1;4;0;2;0;7;0;6;3;0;6;0;0;0;3;1;1;0;4;4;3;0;3;5;6;0;5;0;5;2;0;1;2;0;6;3;3;0;5;4;3
191;mun*;Melopsittacus undulatus (Budgerigar Sep. 2011 WUSTL v6.3/melUnd1);;;4.18;0;6;4;3;3;0;0;6;5;0;1;9;3;1;1;4;4;1;3;1;2;0;3;2;5;0;2;0;9;0;5;2;0;7;0;0;0;4;2;4;0;9;3;13;0;9;3;1;0;5;1;4;3;0;1;1;0;8;4;4;0;10;9;1
203;gfr;Geospiza fortis (Medium ground finch Apr. 2012 GeoFor_1.0/geoFor1);;;4.44;0;6;11;2;4;0;7;0;6;1;2;6;2;1;1;3;2;0;3;1;4;0;5;1;5;0;4;1;16;0;5;2;0;12;0;0;0;4;2;3;1;6;4;7;0;5;4;6;0;10;0;3;6;0;2;0;0;6;3;2;0;8;4;4
211;acs;Anolis carolinensis (lizard) (Broad AnoCar2.0 May 2010);;;4.64;0;5;2;2;4;0;3;4;6;0;1;12;5;0;2;3;5;0;1;2;3;1;3;2;4;0;3;1;12;0;6;3;0;6;0;0;0;5;3;5;0;10;5;6;0;8;7;5;0;12;1;7;4;0;3;1;0;5;3;3;0;7;8;2
230;tgu;Taeniopygia guttata (Zebra finch Feb. 2013 WashU taeGut324/taeGut2);;;4.87;0;10;4;4;1;0;1;7;21;2;1;5;3;2;1;1;3;0;2;1;6;0;1;2;8;1;4;2;18;0;7;3;0;13;0;0;0;5;1;6;2;8;4;5;0;7;2;3;1;9;1;3;6;0;2;0;1;5;3;2;1;8;7;4
252;mlu*;Myotis lucifugus (Microbat Jul. 2010 Broad Institute Myoluc2.0/myoLuc2);;;5.49;0;5;2;3;3;0;5;2;10;0;3;14;5;0;3;5;6;0;2;2;6;0;3;3;5;0;5;3;8;0;1;3;0;5;0;0;5;7;3;7;0;9;3;11;0;8;5;6;0;27;0;4;6;0;5;2;0;5;5;5;0;8;6;3
256;dsi;Drosophila simulans (D. simulans Apr. 2005 WUGSC mosaic 1.0);;;5.67;0;8;3;4;5;0;2;9;8;0;0;12;7;0;2;6;8;0;2;3;6;0;5;5;8;0;5;4;9;0;5;0;0;10;0;0;0;6;4;8;0;6;4;11;0;6;5;10;0;7;1;9;9;0;5;0;0;3;3;3;0;15;5;0
258;mmr*;Microcebus murinus (Mouse lemur) (Jun 2003);;;5.71;0;8;3;3;5;0;2;7;4;0;3;14;4;0;2;5;7;0;2;3;7;0;4;3;3;0;3;2;11;0;5;3;0;8;0;0;0;6;4;12;0;9;5;6;0;5;9;8;1;20;0;6;6;0;3;2;0;7;5;3;0;11;7;2
283;gga;Gallus gallus (galGal4 Nov 2011);;;6.24;0;10;3;3;3;0;2;7;7;0;2;14;7;1;3;7;9;0;4;2;7;0;4;3;4;0;4;2;24;0;7;4;0;16;0;0;0;6;2;5;0;11;6;6;0;10;9;7;0;11;1;6;8;0;2;2;0;7;4;3;0;7;7;4
289;dme;Drosophila melanogaster (D. melanogaster Aug. 2014 BDGP Release 6 + ISO1 MT/dm6);;;6.40;0;8;4;4;4;0;2;8;9;0;2;12;6;0;2;7;8;0;2;4;7;0;5;5;8;0;6;3;12;0;2;3;0;9;0;0;0;5;4;8;0;10;6;13;0;14;6;13;0;7;1;8;10;0;10;0;0;6;3;3;0;14;6;0
326;oga*;Otolemur garnettii (Bushbaby Mar. 2011 Broad/otoGar3);;;6.96;1;6;3;5;4;0;3;9;10;9;11;13;6;0;3;5;6;0;3;3;7;0;4;3;9;0;6;3;13;0;7;3;0;8;0;0;0;8;5;9;0;12;11;9;0;13;5;8;0;21;1;6;6;0;4;3;2;7;4;5;0;12;9;3
326;dya;Drosophila yakuba (D. yakuba Nov. 2005 WUGSC 7.1);;;7.22;0;9;5;4;5;0;2;8;10;0;2;15;7;0;2;10;9;0;2;5;6;0;8;5;8;0;6;5;18;0;2;5;0;9;0;0;0;5;4;8;0;11;6;16;0;15;7;14;0;8;1;8;12;0;7;0;0;6;3;4;0;16;7;1
334;sbq;Saimiri boliviensis (Squirrel monkey Oct. 2011 Broad/saiBol1);;;7.27;0;9;8;5;6;0;4;5;10;1;6;14;6;1;4;7;9;1;3;3;9;0;5;4;8;0;6;5;15;0;8;5;1;8;0;0;0;8;6;10;0;11;12;9;0;9;10;5;0;19;3;6;6;0;4;3;0;7;5;5;0;10;6;4
338;opr*;Ochotona princeps (Pika May 2012 OchPri3.0/ochPri3);;;7.49;0;10;3;4;5;0;5;11;8;0;4;15;7;0;4;7;7;0;3;4;8;0;4;4;7;0;6;7;15;0;7;4;0;10;0;0;0;5;5;12;0;14;9;11;0;14;7;11;0;10;1;6;7;0;6;4;0;7;5;6;0;17;7;5
353;meu*;Macropus eugenii (Wallaby Sep. 2009 TWGS Meug_1.1/macEug2);;;7.62;1;10;3;8;5;0;4;6;6;0;6;14;8;0;1;7;8;0;4;2;7;0;4;2;8;0;6;3;13;0;6;5;1;8;0;0;1;7;4;7;0;14;10;11;0;13;12;7;0;29;7;8;7;0;3;5;0;10;7;4;0;16;10;5
367;hgl;Heterocephalus glaber (Naked mole-rat Jan. 2012 Broad HetGla_female_1.0/hetGla2);;;7.62;0;6;4;5;5;0;5;5;8;0;3;14;12;1;4;6;7;0;3;3;13;0;5;3;15;2;4;4;46;6;5;6;0;7;0;0;0;7;3;6;0;9;8;15;2;10;6;4;0;23;7;6;5;0;4;4;2;7;6;5;4;10;4;3
373;lcm;Latimeria chalumnae (Coelacanth Aug. 2011 Broad/latCha1);;;7.96;0;7;11;4;4;0;5;8;7;0;7;11;3;0;7;4;3;0;6;3;12;0;10;4;11;0;9;2;5;0;20;3;2;8;0;0;0;5;10;9;3;9;20;13;1;19;11;8;5;17;4;15;4;0;1;4;0;8;9;8;0;7;5;2
374;san*;Sorex araneus (Shrew Aug. 2008 Broad/sorAra2);;;8.24;0;10;4;4;6;1;2;13;15;0;5;15;7;0;5;7;8;0;3;4;8;0;6;2;8;0;5;5;10;0;8;3;0;9;0;0;0;7;5;7;0;12;8;13;0;19;10;14;0;25;2;6;9;0;5;3;0;8;6;6;0;22;12;2
383;cpo*;Cavia porcellus (Guinea pig) (Broad Feb 2008);;;8.36;0;8;4;6;5;0;3;6;10;0;5;15;6;1;3;6;8;0;3;4;8;0;4;3;10;0;4;3;28;4;9;5;0;15;0;0;0;8;4;8;0;18;11;26;1;10;6;5;0;34;1;8;7;0;4;3;0;10;5;5;0;11;6;6
407;rno;Rattus norvegicus (rn5 Mar 2012);;;8.89;1;8;3;0;1;0;1;5;12;0;3;13;8;0;3;7;11;0;4;3;33;0;6;3;9;0;5;4;36;2;9;4;0;2;0;0;0;10;6;10;0;15;1;19;2;15;10;8;0;40;1;8;6;0;3;5;1;12;6;8;0;11;9;5
408;cjc;Callithrix jacchus (marmoset) (WUGSC 3.2 Mar 2009);;;8.80;0;8;9;6;7;0;3;11;9;2;5;19;6;1;4;10;9;0;5;4;7;0;6;4;9;1;6;4;15;1;5;4;0;19;0;0;1;8;4;12;0;23;14;11;1;13;11;12;0;30;2;6;6;3;4;3;0;8;5;5;0;14;9;4
411;pha*;Papio hamadryas (baboon) (Nov 2008);;;8.93;0;12;7;7;9;0;3;6;12;2;4;15;9;1;7;12;9;0;5;3;7;0;6;4;10;0;7;6;19;1;9;5;0;15;0;0;0;10;6;11;1;18;12;12;1;10;13;4;2;28;1;8;7;0;6;4;0;9;6;5;0;13;4;8
414;aga;Anopheles gambiae;;;9.20;0;9;2;3;5;0;3;10;12;0;2;18;31;0;3;29;6;0;2;8;7;0;8;13;8;0;2;5;17;0;3;6;0;22;0;0;0;21;4;11;0;11;8;17;0;20;11;15;0;5;0;6;10;0;8;0;0;6;2;2;0;15;8;0
418;ppp;Physcomitrella patens ;;;9.18;1;14;2;6;6;1;5;5;12;0;4;24;13;0;2;11;13;0;5;7;13;0;8;4;10;0;5;6;19;0;9;8;0;8;0;0;0;9;9;10;1;14;8;16;0;11;7;14;0;7;1;9;8;1;7;5;0;9;6;10;0;15;9;11
421;nle;Nomascus leucogenys (Gibbon Oct. 2012 GGSC Nleu3.0/nomLeu3);;;9.04;1;11;7;5;8;0;3;9;12;3;5;16;11;1;6;10;9;1;4;4;9;1;5;4;11;0;4;5;18;1;9;5;0;14;0;0;0;11;9;13;2;14;22;15;0;10;10;8;1;22;3;8;7;0;7;3;0;8;6;5;0;12;6;7
435;ggo;Gorilla gorilla gorilla (gorilla) (gorGor3.1 May 2011);;;9.42;0;12;8;7;8;0;4;5;11;2;6;17;9;1;8;10;10;1;4;5;8;0;7;4;9;0;6;6;22;2;6;4;1;16;0;0;0;7;7;14;1;24;13;14;0;15;14;7;0;28;3;8;7;0;6;5;0;8;5;6;0;12;3;9
446;shr;Sarcophilus harrisii (Tasmanian devil Feb. 2011 WTSI Devil_ref v7.0/sarHar1);;;9.87;0;13;6;3;9;0;4;9;11;0;4;22;8;0;4;10;10;0;5;3;10;0;6;3;9;0;7;2;18;0;7;4;0;11;0;0;0;9;45;10;0;13;14;32;0;19;15;10;0;8;2;8;4;0;5;3;0;8;5;4;0;19;9;6
455;tsy*;Tarsius syrichta (Tarsier Sep. 2013 Tarsius_syrichta-2.0.1/tarSyr2);;;9.25;0;6;#;4;6;0;5;7;8;0;4;12;6;0;4;6;7;0;5;3;7;1;32;4;9;0;4;4;12;0;4;3;0;10;0;0;1;10;64;6;1;15;10;7;1;13;9;10;1;25;1;6;6;0;5;3;0;9;6;4;0;14;6;7
458;mcc;Macaca mulatta (Rhesus Oct. 2010 BGI CR_1.0/rheMac3);;;9.80;0;9;15;8;9;0;5;6;10;5;7;18;10;3;6;11;9;2;6;4;8;0;8;3;9;0;5;4;21;1;10;5;1;23;0;0;0;14;10;12;2;19;16;13;1;14;11;6;0;27;2;8;6;0;5;4;0;8;6;7;0;14;4;8
469;mmu;Mus musculus (mm10 Dec 2011);;;10.13;0;7;7;4;5;0;4;10;12;1;5;19;8;1;3;12;10;1;3;3;8;1;8;3;11;0;4;4;23;4;11;10;0;11;0;0;1;10;7;12;0;13;14;26;0;16;8;14;1;60;1;8;6;0;5;3;0;8;6;5;2;15;8;7
476;pan*;Papio anubis (Baboon Mar. 2012 Baylor Panu_2.0/papAnu2);;;10.20;1;13;8;8;8;0;3;11;14;2;6;19;9;1;7;12;9;1;5;3;8;0;6;4;10;0;7;6;20;1;9;5;3;21;0;0;0;10;9;12;2;21;14;15;2;15;13;9;1;27;3;9;7;0;5;4;0;11;6;5;0;20;8;8
481;mdo;Monodelphis domestica (opossum) (Broad Oct 2006);;;10.58;0;12;2;4;8;0;6;11;13;0;7;25;9;0;5;9;12;0;6;3;11;0;8;3;12;0;7;3;15;0;9;6;0;15;0;0;0;9;7;11;0;13;13;19;1;24;14;13;4;46;0;9;5;0;5;4;0;9;6;5;0;24;11;8
485;eeu*;Erinaceus europaeus (Hedgehog May 2012 EriEur2.0/eriEur2);;;7.59;0;8;3;6;6;0;3;6;9;0;4;16;7;0;6;4;7;0;3;3;10;0;5;3;9;0;6;4;14;0;10;4;0;13;0;0;0;5;4;8;0;7;11;€;0;13;8;9;0;34;2;7;6;0;5;3;0;7;5;7;0;14;7;5
494;ecb;Equus caballus (horse) (Sep 2007);;;10.76;0;12;4;6;7;0;5;3;20;0;5;25;12;3;6;15;12;0;4;4;10;0;7;3;9;0;7;3;27;0;11;8;1;14;0;0;1;11;6;12;1;17;15;16;0;10;11;51;0;25;4;7;10;0;4;4;0;12;5;7;0;10;4;8
498;cge;Cricetulus griseus cell line CHO-K1 (Chinese hamster ovary CriGri 1.0 Aug 2011);;;10.96;0;8;4;4;5;0;4;10;13;0;5;16;13;0;5;9;6;0;3;3;7;0;6;3;8;1;4;4;22;1;15;6;0;11;0;0;0;14;5;11;0;17;15;86;0;15;7;20;0;41;2;6;6;0;6;3;0;9;5;6;1;14;6;7
499;vvi;Vitis vinifera (Grapevine 12X);;;10.89;0;14;7;13;10;0;9;7;13;1;7;25;14;0;5;9;13;1;7;3;13;0;16;4;10;2;6;3;11;0;28;5;1;17;0;0;1;12;9;10;1;18;11;13;1;18;14;21;0;11;1;10;8;0;5;4;0;9;6;7;0;17;12;6
503;ptr;Pan troglodytes (Chimp Feb. 2011 CSAC 2.1.4/panTro4);;;10.82;0;15;10;7;9;0;3;6;14;1;5;21;11;1;10;12;11;1;7;4;9;1;8;5;10;0;6;5;30;1;9;5;2;22;0;0;0;10;8;10;1;27;14;19;1;15;15;11;1;27;2;7;7;1;6;5;3;9;6;5;0;13;6;13
506;ocu;Oryctolagus cuniculus (rabbit) (Broad Apr 2009);;;10.67;0;14;6;3;5;0;4;16;11;1;7;18;12;0;8;14;10;0;4;5;9;0;5;4;8;1;7;5;21;0;9;4;0;12;0;0;0;9;5;15;1;26;12;29;1;23;18;19;0;25;1;10;7;0;4;5;0;10;6;6;21;0;14;16
517;ppy*;Pongo pygmaeus abelii (Orangutan July 2007 WUGSC 2.0.2/ponAbe2);;;11.18;0;13;6;6;10;0;3;11;14;4;6;20;10;1;7;18;10;1;6;5;10;0;7;5;12;0;4;7;22;1;9;4;1;19;0;0;0;10;7;13;2;33;20;22;1;13;22;8;0;30;3;6;7;0;6;7;0;8;8;7;0;14;8;10
518;csi*;Ceratotherium simum (White rhinoceros May 2012 CerSimSim1.0/cerSim1);;;11.40;0;13;5;6;6;0;4;4;13;0;5;26;11;1;7;15;13;0;5;4;10;0;7;4;10;0;8;5;23;0;13;6;0;11;0;0;0;10;5;12;2;14;15;22;1;13;11;77;0;24;1;8;10;0;5;4;0;13;6;7;0;10;4;9
540;tng;Tetraodon nigroviridis (tetraodon) (Genoscope 8.0 Mar 2007);;;11.91;1;17;5;7;15;0;6;32;16;0;5;20;10;0;4;15;12;1;7;2;11;1;11;4;26;0;10;13;20;0;10;4;0;13;0;0;0;12;9;18;0;17;9;20;0;18;15;13;0;15;1;10;14;0;6;2;0;11;9;9;0;14;14;6
554;cpic;Chrysemys picta bellii (Painted turtle Dec. 2011 v3.0.1/chrPic1);;;11.87;2;22;13;7;2;1;4;6;11;1;13;16;16;0;5;6;24;0;15;10;12;1;4;2;17;0;18;5;11;1;15;4;1;5;0;0;0;10;16;11;1;17;36;9;0;14;17;5;5;18;4;10;7;0;5;3;3;20;26;10;0;11;24;2
575;tru;Takifugu rubripes (Fugu Oct. 2011 FUGU5/fr3);;;12.64;1;18;6;9;10;0;4;21;11;0;6;35;19;0;8;25;11;0;7;3;10;0;7;6;18;0;7;7;10;0;8;6;1;13;0;0;1;19;8;12;0;20;19;19;1;22;13;20;0;15;1;16;16;1;7;4;0;17;13;10;0;18;12;4
578;sbi;Sorghum bicolor (Version 1.0);;;12.56;0;20;4;9;15;0;9;11;17;0;5;37;16;2;4;10;11;3;12;6;14;0;11;7;12;2;9;6;18;0;13;11;1;14;0;0;1;15;11;13;1;16;9;18;2;24;13;23;0;13;1;13;15;0;4;7;0;13;7;10;0;24;10;6
582;mtr;Medicago truncatula (March 2009 Version 3.0);;;12.47;0;26;7;14;9;0;10;4;19;0;10;40;17;3;7;7;12;2;8;2;7;0;11;1;10;4;10;1;25;0;16;3;1;12;0;0;0;17;17;5;9;28;18;16;0;28;19;11;0;10;1;14;12;0;5;3;0;15;8;6;1;23;15;3
596;cel;Caenorhabditis elegans (WS220 Oct 2010);;;13.18;0;15;4;7;20;0;3;5;21;0;7;19;19;0;5;6;15;0;9;6;6;0;31;4;17;0;11;7;22;0;9;4;0;19;0;0;0;19;20;7;0;20;14;30;0;27;17;24;0;13;2;12;18;0;8;1;1;9;8;4;0;14;34;3
618;pop;Populus trichocarpa (Jan 2010 Version 2.0) ;;;13.53;4;18;7;3;40;1;0;7;20;1;9;26;17;0;8;10;13;1;9;5;14;0;22;4;6;0;11;4;20;0;18;5;0;18;0;0;0;13;11;11;0;22;17;17;0;33;14;21;1;13;1;14;10;0;7;5;0;16;11;11;0;25;17;7
622;hsa;Homo sapiens (hg38 - GRCh38 Dec 2013);;;13.31;0;18;8;12;12;0;4;11;19;6;5;22;11;1;8;21;12;1;6;5;10;1;8;4;10;0;6;7;35;1;10;5;5;32;0;0;0;10;18;24;2;40;20;24;1;16;17;10;1;38;3;8;7;0;6;4;1;8;7;5;0;15;9;12
639;bdi;Brachypodium distachyon (JGI v1.0 8X);;;13.82;0;18;4;15;14;0;10;8;20;2;4;55;15;3;5;11;11;4;10;5;15;0;18;8;9;3;10;6;19;0;12;11;1;17;0;0;3;21;15;11;0;16;12;18;0;25;15;19;0;14;0;18;16;1;5;6;0;18;9;9;0;27;9;9
674;oni*;Oreochromis niloticus (Nile tilapia Jan. 2011 Broad oreNil1.1/oreNil2);;;14.80;0;23;12;7;14;0;7;16;25;0;25;27;8;0;9;9;10;0;10;6;14;0;11;4;18;1;25;8;18;0;11;12;3;18;0;0;0;23;6;11;0;9;16;43;0;10;14;15;1;42;1;12;16;0;7;6;2;10;27;18;0;13;12;9
684;ath;Arabidopsis thaliana (TAIR10 Feb 2011);;;15.00;0;17;6;12;12;1;11;3;17;2;5;32;14;2;7;8;37;3;12;7;15;0;47;5;10;1;9;5;16;0;10;7;0;83;0;0;0;12;10;9;0;19;15;17;0;29;14;13;0;17;0;16;11;0;6;4;0;16;10;8;0;25;12;5
738;osa;Oryza sativa;;;15.67;0;20;4;19;15;0;10;10;18;0;5;56;17;16;4;10;12;4;17;8;14;0;14;9;11;8;15;5;20;1;10;12;2;19;0;0;0;26;21;10;0;29;12;20;1;31;16;25;1;17;0;18;24;0;4;8;0;20;12;11;0;28;9;10
738;gmx;Glycine max (soybean) (Wm82.a2);;;16.31;0;22;9;18;16;0;10;7;31;0;8;36;22;1;9;13;15;0;11;6;21;0;27;5;9;1;10;4;24;0;17;8;0;21;0;0;0;18;13;13;2;22;20;22;0;33;16;24;0;14;0;18;13;0;9;5;0;28;18;13;0;29;18;9
743;cbr;Caenorhabditis briggsae (C. briggsae Jan. 2007 WUGSC 1.0/cb3);;;16.51;0;22;6;11;26;0;5;7;21;0;24;23;25;0;6;6;17;0;8;8;6;0;41;4;22;0;10;9;29;0;14;7;0;19;0;0;0;21;24;10;0;23;16;40;0;34;19;30;0;16;0;13;22;0;10;0;0;9;10;2;0;21;42;5
749;mpu*;Mustela putorius furo (Ferret Apr. 2011 MusPutFur1.0/musFur1);;;10.68;0;11;4;6;6;0;4;5;10;0;5;20;8;0;6;7;8;0;4;4;9;0;7;2;10;0;7;5;15;0;8;5;0;9;0;0;1;7;37;17;6;12;31;€;0;8;7;19;0;25;1;11;6;0;29;5;0;12;16;21;0;9;9;4
804;str*;Spermophilus tridecemlineatus (Squirrel Nov. 2011 Broad/speTri2);;;11.02;1;10;3;10;6;0;3;4;14;6;4;14;18;3;5;39;15;1;7;6;12;1;7;3;34;5;6;7;€;31;39;18;0;9;0;0;0;6;4;6;1;9;10;12;6;8;5;7;0;48;1;7;6;0;5;3;0;7;5;6;7;13;5;20
807;ssc;Sus scrofa (Pig Aug. 2011 SGSC Sscrofa10.2/susScr3);;;12.68;0;21;4;6;8;0;5;5;13;0;5;23;10;1;11;12;10;0;5;4;9;0;4;3;13;0;8;4;23;0;14;7;0;17;0;0;0;10;9;12;2;18;38;16;10;97;€;13;1;23;0;7;7;0;5;3;0;10;7;4;0;19;10;6
827;cja*;Caenorhabditis japonica (WUGSC 3.0.2 Mar 2008);;;18.33;1;24;5;7;26;0;6;12;26;0;7;30;23;0;7;13;19;0;7;15;9;0;43;8;24;0;12;11;31;0;11;8;0;24;0;0;0;17;14;16;0;23;30;37;0;41;20;40;0;15;1;18;21;0;11;1;0;15;12;3;0;34;47;2
856;oaa;Ornithorhynchus anatinus (platypus) (WUGSC 5.0.1 Mar 2007);;;18.56;1;24;10;10;8;0;7;18;27;0;10;32;23;1;15;10;16;4;6;8;19;4;12;7;23;1;18;10;83;0;17;11;0;28;0;0;1;24;11;19;0;21;32;25;0;27;16;27;0;37;5;14;12;0;7;14;2;18;6;9;2;40;15;9
906;cfa;Canis familiaris (dog) (CanFam3.1 Sept 2011);;;11.23;0;10;4;5;4;0;4;7;9;0;5;23;6;0;5;8;10;0;5;8;8;0;8;4;8;0;4;5;14;0;11;4;0;9;0;0;0;9;43;20;1;21;34;€;2;13;15;22;0;21;1;6;6;0;15;4;0;8;9;29;0;11;11;9
1065;spu;Strongylocentrotus purpuratus (Sea urchin) ;;;23.56;2;0;14;2;18;0;8;5;69;2;22;73;20;0;11;16;25;0;15;6;19;0;21;9;27;0;21;9;32;0;17;7;0;24;0;0;0;26;17;21;0;39;57;42;0;82;26;29;0;31;0;18;29;0;19;1;1;17;18;19;0;42;33;4
1095;cbr*;Caenorhabditis brenneri (WUGSC 6.0.1 Feb 2008);;;24.07;0;24;7;14;32;0;8;8;33;1;26;29;33;0;8;15;20;0;14;9;25;2;54;9;31;1;15;10;35;0;11;6;2;28;0;0;1;26;40;11;0;33;29;49;0;34;36;37;2;21;3;22;32;0;17;24;0;14;13;11;0;39;66;25
1119;dno*;Dasypus novemcinctus (Armadillo Dec. 2011 Baylor/dasNov3);;;15.86;0;12;8;8;5;0;3;10;12;1;6;30;12;1;16;#;10;0;6;6;7;0;7;4;11;0;8;7;23;2;66;17;0;14;0;0;1;10;5;10;0;23;18;43;0;21;20;45;0;22;1;15;10;0;8;5;0;10;9;47;24;19;€;34
1176;oas;Ovis aries (sheep) (Feb 2010);;;12.50;1;6;5;7;6;0;2;3;6;0;5;18;7;0;8;9;2;3;4;3;4;0;6;1;5;0;5;3;18;3;12;7;2;16;0;0;0;8;7;9;0;13;22;16;2;8;€;60;16;61;4;47;2;2;6;6;0;7;22;33;5;30;€;€
1198;zma;Zea mays (Version 5b.60);;;23.18;1;25;5;20;29;0;9;13;69;0;5;79;22;12;4;16;13;22;11;6;15;0;31;9;20;13;14;6;66;0;15;22;0;21;0;0;1;26;22;13;0;49;82;€;1;42;22;30;1;25;0;27;35;0;7;6;0;14;9;11;0;33;11;11
1463;aml;Ailuropoda melanoleuca (panda) (BGI-Shenzhen AilMel 1.0 Dec 2009);;;13.84;0;11;5;9;7;0;5;7;12;0;6;24;10;0;7;9;10;0;6;4;9;0;11;5;10;0;9;10;17;0;9;5;0;11;0;0;0;8;43;25;6;28;55;€;1;11;11;37;0;25;2;10;8;1;#;7;2;13;17;45;0;10;7;7
1492;gmo*;Gadus morhua (Atlantic cod May 2010 Genofisk GadMor_May2010/gadMor1);;;30.05;6;36;16;15;33;0;24;47;26;0;18;€;21;0;9;28;30;0;18;14;55;0;21;22;30;0;30;30;55;1;24;26;0;50;0;0;1;26;11;45;2;34;63;43;1;30;51;50;0;27;2;29;31;2;17;10;1;41;21;28;0;30;39;18
2002;lav;Loxodonta africana (elephant) (Broad/July 2009);;;25.95;1;32;15;17;22;0;11;10;43;0;7;50;41;1;50;35;29;0;7;4;16;0;14;3;14;1;22;10;54;0;53;15;1;19;0;0;3;27;14;28;4;51;60;36;0;20;€;24;1;28;24;23;14;0;18;3;3;76;#;16;4;33;€;#
2017;tma*;Trichechus manatus latirostris (Manatee Oct. 2011 Broad v1.0/triMan1);;;13.98;1;11;6;10;8;0;5;5;13;1;8;21;11;0;26;16;14;0;6;4;11;0;8;3;16;1;18;4;20;1;40;6;1;15;0;0;0;12;8;10;1;23;31;16;1;15;€;19;5;22;18;13;8;0;12;7;5;36;€;13;9;23;€;#
2485;pma*;Petromyzon marinus (Lamprey Sep. 2010 WUGSC 7.0/petMar2);;;34.89;2;57;5;#;€;0;40;#;€;0;10;€;€;1;26;#;22;0;20;35;54;0;43;21;62;19;19;23;€;0;31;24;0;90;0;0;1;27;44;€;0;€;24;23;2;90;12;11;0;68;1;9;85;1;26;10;0;65;18;50;1;54;17;6
2489;gac*;Gasterosteus aculeatus (stickleback) (Broad 1.0 Feb 2006);;;41.18;0;35;12;7;49;0;17;9;€;0;61;€;21;1;12;18;52;0;62;29;63;0;29;18;99;0;35;23;53;0;53;56;0;17;0;0;0;52;60;81;1;€;61;97;0;€;46;53;0;€;1;74;49;0;#;2;0;30;68;26;0;12;61;4
2639;xtr;Xenopus tropicalis (frog) (JGI 4.2 Nov 2009);;;50.41;2;58;#;22;38;2;25;32;63;5;51;€;55;0;36;53;40;3;41;23;60;1;53;36;€;0;91;29;67;0;47;36;0;€;0;0;1;42;28;40;1;47;72;97;0;59;84;51;2;92;1;33;33;3;33;8;0;99;€;27;0;85;80;€
3729;fca;Felis catus (cat) (Felis_catus-6.2 Sept 2011);;;19.40;1;12;19;8;6;0;33;5;10;0;9;24;8;0;6;9;8;1;14;5;8;1;68;7;9;0;13;9;18;1;10;7;0;10;0;0;2;16;€;47;5;28;50;€;1;9;15;44;1;32;18;23;9;9;€;24;2;12;54;53;2;10;48;6
4040;bta;Bos taurus (Cow Jun. 2014 Bos_taurus_UMD_3.1.1/bosTau8);;;22.58;6;30;10;14;11;0;5;6;18;0;8;35;20;0;21;39;13;32;7;7;13;0;9;4;14;1;10;7;31;2;35;16;11;39;0;0;4;19;20;40;0;30;78;40;6;42;€;€;143;€;29;€;13;7;12;16;4;19;44;€;20;63;€;€
5845;ttr*;Tursiops truncatus (Dolphin Oct. 2011 Baylor Ttru_1.4/turTru2);;;16.73;0;12;6;7;6;0;4;6;11;0;5;17;8;3;16;22;12;0;6;4;7;0;5;4;9;1;6;3;19;2;36;21;1;18;0;0;0;9;16;15;0;13;74;19;10;49;€;€;6;22;21;€;7;1;7;12;0;11;48;54;19;43;€;€
7080;bacu;Balaenoptera acutorostrata scammoni (Minke whale Oct. 2013 BalAcu1.0/balAcu1);;;18.77;0;13;13;8;6;0;4;7;12;1;8;21;14;1;18;32;10;1;5;4;7;0;5;4;13;0;8;4;20;0;42;20;0;14;0;0;0;11;10;20;0;24;86;29;20;45;€;€;2;24;17;€;9;0;9;21;0;13;55;#;12;64;€;€
13727;cmk;Callorhinchus milii (Elephant shark Dec. 2013 Callorhinchus_milii-6.1.3/calMil1);;;32.70;3;35;13;31;20;2;20;25;31;0;23;94;22;16;€;€;26;1;54;48;12;6;51;41;24;12;€;€;75;168;€;€;1;36;0;0;1;37;7;18;2;48;43;36;6;49;66;€;1;15;3;30;9;0;25;2;0;33;14;12;2;19;66;#
;;;total du diagramme;;;43;1,166;489;586;803;9;489;693;1,215;66;618;1,746;976;93;582;914;956;98;625;472;970;23;1,042;441;1,044;83;749;469;1,773;240;1,101;622;48;1,305;0;0;34;1,023;979;1,062;71;1,453;1,725;1,619;92;1,660;1,054;1,361;208;1,809;238;915;915;33;563;373;36;1,111;846;846;137;1,530;1,048;472
Codons forts;;;pente;;;;1.117;0.453;0.554;0.847;;0.513;0.635;1.291;;0.690;2.057;0.955;;0.608;0.932;0.907;;0.714;0.518;0.997;;1.066;0.485;1.153;;0.87;0.501;1.706;;1.101;0.695;;1.294;;;;0.992;0.923;1.08;;1.436;1.72;1.704;;1.663;1.232;1.361;;1.656;-;0.942;0.935;;0.607;0.325;;1.195;0.965;0.837;;1.415;1.298;0.498
;;;somme calculée;;;;-;27.0;19.3;29.5;;-;22.2;98.2;;-;149.5;21.2;;19.9;77.8;-;;-;-;-;;-;-;58.1;;16.4;55.8;50.5;;22.7;22.7;;65.2;;;;-;17.9;37.7;;109.2;-;146.4;;68.5;151.8;123.5;;105.6;-;54.7;-;;45.2;-;;-;87.2;34.6;;-;164.0;96.4
;;;Totaux + calculés;;;;1,166;516;605;833;;489;715;1,313;;618;1,895;997;;602;992;956;;625;472;970;;1,042;441;1,102;;765;525;1,824;;1,124;645;;1,370;0;0;;1,023;997;1,100;;1,562;1,725;1,765;;1,728;1,206;1,485;;1,915;238;970;915;;608;373;;1,111;933;881;;1,530;1,212;568
Codons faibles;;;c/t nombre >3;;;3;;;;;0;;;;6;;;;3;;;;5;;;;2;;;;6;;;;4;;;2;;;;2;;;;5;;;;6;;;;7;;;;;2;;;2;;;;9;;;
;;;c/t nombre >3, total;;;16;;;;;0;;;;35;;;;44;;;;66;;;;10;;;;61;;;;209;;;16;;;;9;;;;30;;;;58;;;;184;;;;;16;;;9;;;;120;;;
;;;reste calculé;;;30;;;;;9;;;;37;;;;52;;;;37;;;;15;;;;28;;;;35;;;34;;;;27;;;;46;;;;40;;;;31;;;;;19;;;29;;;;26;;;
;;;multiplicité X 100;;;38;;;;;11;;;;47;;;;66;;;;47;;;;19;;;;35;;;;44;;;43;;;;34;;;;58;;;;51;;;;39;;;;;24;;;37;;;;33;;;
;;;c/t nombre=3;;;1;;;;;0;;;;1;;;;6;;;;4;;;;0;;;;1;;;;1;;;2;;;;2;;;;1;;;;0;;;;0;;;;;2;;;3;;;;0;;;
Totaux des 121 réduits;;;;;46942;30;1,166;516;605;833;9;489;715;1,313;37;618;1,895;997;52;602;992;956;37;625;472;970;15;1,042;441;1,102;28;765;525;1,824;35;1,124;645;34;1,370;0;0;27;1,023;997;1,100;46;1,562;1,725;1,765;40;1,728;1,206;1,485;31;1,915;238;970;915;19;608;373;29;1,111;933;881;26;1,530;1,212;568
zéros tRNAs;;;;;;55;1;0;1;0;72;2;1;0;52;1;0;0;42;0;0;0;52;0;0;0;65;0;0;1;56;0;2;0;54;0;1;54;0;79;79;57;1;0;0;46;0;1;1;46;0;0;0;52;1;16;1;1;66;0;8;62;0;0;1;61;2;0;4
indices tRNAs;;;;;;0.38;14.76;6.53;7.66;10.54;0.11;6.19;9.05;16.62;0.47;7.82;23.99;12.62;0.66;7.62;12.55;12.10;0.47;7.91;5.97;12.28;0.19;13.19;5.58;13.95;0.35;9.69;6.64;23.08;0.44;14.22;8.16;0.43;17.34;0.00;0.00;0.34;12.95;12.62;13.92;0.58;19.78;21.84;22.35;0.51;21.88;15.26;18.79;0.39;24.24;3.01;12.27;11.58;0.24;7.70;4.72;0.37;14.06;11.81;11.15;0.33;19.37;15.34;7.20

Introns, Comparaison des introns[modifier | modifier le wikicode]

IV 1.79;Introns de tRNAs. 79− fungi;;;;;55 830;;;IV 1.42;Introns de tRNAs. 42 fungi;;;;;55 830;;;IV 1.79;Zintrons de tRNAs. 79− fungi;;;;;55 830;;;IV 1.42;Zintrons de tRNAs. 42 fungi;;;;;55 830;

Introns, Comparaison des tRNAs[modifier | modifier le wikicode]

IV 1.42;Indices de tRNAs. 42 fungi;;;;;55 830;;;IV 1.79;Indices de tRNAs. 79 −fungi;;;;;55 830;;;IV 1.79;Zindices de tRNAs. 79 −fungi;;;;;55 830;;;IV 1.42;Zindices de tRNAs. 42 fungi;;;;;55 830;

Introns, Comparaison des sensibilités relatives[modifier | modifier le wikicode]

IV 1.42;Indices de tRNAs. 42 fungi;;;;;55 830;;;I 1;Nombres de tRNAs. 4032 bactéries ;;;;;235027;
IV 1.4;Nombres de tRNAs. 121 eucaryotes;;;;;55 830;;;IV1.4b;Champigons/bactéries sensibiltés relatives;;;;;;
IV1.10;Nombres de tRNAs. 121 eucaryotes;;;;;55 830;;;IV1.10b;;Eucaryotes/bactéries sensibiltés relatives;;;;;
IV 1.79;Indices de tRNAs. 79 −fungi;;;;;55 830;;;I 1;Indices de tRNAs. 4032 bactéries ;;;;;235027;

Les modifications des tRNAs en 34 et 37.alpha[modifier | modifier le wikicode]

Compilation pour les bactéries.a[modifier | modifier le wikicode]


Compilation pour les eucaryotes.a[modifier | modifier le wikicode]

g;t;Inosine;;;A;;Inosine;;m1 Inosine;;;;;;;;;;;

Détails pour mcac lla eco hvo sce.a[modifier | modifier le wikicode]

;;mcac;30 tRNAs;;;;;;;;30 gènes tRNA de mcac;;;;;;;;%GC
;;lla;38 tRNAs;;;;;;;;63 gènes tRNA de lla;;;;;;;;%GC
;i;2 C;A;;;;;;;;i;;;;;;;;
;;E.coli;40 tRNAs;;strain unknown;;Liepzig*;;;;86 gènes tRNA de eco;;;;K12;;;;%GC
;a;G;msi6A;G;A;2 Q; msi6A;G;msi6A;;c;2;;2;;3;;1;
;a;G;t6A;2 G;m6t6A;Q;t6A;G;t6A;;c;3;;2;;4;;1;
g;t;2 C;A;;;;;;;;i;;;;;;;;
;a;2 G;A;G;A;GluQ;m2A;G;A;;c;2;;2;;3;;4;
;;hvo;41 tRNAs;;codons*;;;;;;53 gènes tRNA de lla;;;;;;;;%GC
;c;G;A;G;A;G;A;2 G;A;;c;2;;1;;2;;2;
;;sce;34 tRNAs;;;;;;;;275 gènes tRNA de sce;;;;;;;;%GC
t;t;;;2 Inosine; i6A;;;;;;t;;;11;;;;;
;c;2 Gm; yW;;;GPA;i6A;G;i6A;;c;10;;;;8;;4;
;c;;;;;2 G; m1G;;;;c;1;;;;7;;;
a;t;Inosine;t6A;2 Inosine; t6A;;;;;;t;13;;11;;;;;

Les modifications des tRNAs[modifier | modifier le wikicode]

Liste des short name trouvés en colonnes 38 et 41[modifier | modifier le wikicode]

::Eu et pro caryotes:::

Liste des tRNAs de la base gtRNAdb[modifier | modifier le wikicode]

1µµ6µµµµagaµUµArgµUCUµSaccharomyces cerevisiaeµcytosolic µ-GCUCGCGUKLCGUAAD--GGC--AACGCRPCUGACU1CU6APCAGAAG-------------------ADUAUGGGTPCG"CCCCCAUCGUGAGUGCCA 
Gµµ+µµµµtgcµGµCysµGCAµSaccharomyces cerevisiaeµcytosolic µ-GCUCGUAUGGCGCAGD--GGD--AGCGCAGCAGAPUGCA+APCUGUUG-------------------7D?CUUAGTPCG"UCCUGAGUGCGAGCUCCA 
Cµµ6µµµµtagµCµGlnµCUAµTetrahymena thermophilaµcytosolic µ-GGUUCUAUALUAPAGC--GCDD-AGUACUGGGGA<UCUA6APCCCUUG-------------------A-C?UGGGUPCG"AUCCCAGUAGGACCUCCA 
UµµEµµµµtaaµUµGlnµUUAµLupinus luteusµcytosolic µ-..CGUCUUAL...AGD--GG..-A...CR.C.UGBUUUAEACACG.UG-------------------7D?GUGGGTPCG"AUCCCACAGACGAGACCA 
3µµAµµµµgaaµUµGluµ3UCµSchizosaccharomyces pombeµcytosolic µ-UCCGUUGUKGUCCAAC--GGCD-AGGAUUCGUCGCU3UCACCGACGGG-------------------A-G?GGGGTPCGACUCCCCGCAACGGAGCCA 
Pµµ6µµµµataµUµIleµUAUµSaccharomyces cerevisiaeµcytosolic µ-GCUCGUGUALCUCAGD--GGDD-AGAGCUPCGUGCUPAP6ACGCGACC-------------------7D?GUGGGTPCA"UCCCCACCPCGAGCACCA 
Cµµ6µµµµatgµCµIniµCAUµDrosophila melanogasterµcytosolic µ-AGCAGAGUKLCGCAGU--GGA--AGCGULCUGGGCCCAU6ACCCAGAG-------------------7D?CGAGGAUCG"AACCUUGCUCUGCUACCA 
Cµµ6µµµµatgµCµIniµCAUµSaccharomyces cerevisiaeµcytosolic µ-AGCGCCGUKLCGCAGD--GGA--AGCGCRCAGGGCUCAU6ACCCUGAU-------------------7D??UCGGAUCG"AACCGˆGCGGCGCUACCA 
Cµµ6µµµµatgµCµIniµCAUµScenedesmus obliquusµcytosolic µ-AGCUGAGUKLCGCAGD--GGA--AGCGPLAPGGGCUCAU6ACCCAUAG-------------------7D?ACAGGAUCG"AACCU;UCUCAGCUACCA 
Cµµ+µµµµatgµCµIniµCAUµSchizosaccharomyces pombeµcytosolic µ-PGCGCGGUALGAGAGD--GGA--ACUCCRACGGGCUCAU+ACCCGUAG-------------------7UC?CAGGAUCG"AACCUGGCCGCGCAACCA 
Cµµ6µµµµatgµCµIniµCAUµTetrahymena thermophilaµcytosolic µ-AGCAGGGUKGCGAAAD--#GA--AUCGCGUPGGGCUCAU6ACPCAAAA-------------------7U?AGAGGAPCG"AACCUCUCUCUGCUACCA 
)µµ6µµµµaaaµUµLysµ)UUµDrosophila melanogasterµcytosolic µ-GCCCGGAUALCUCAGDC-GGD--AGAGCAPPGGACU)UU6APCCAAGG-------------------7D?CAGGG\PCA"GUCCCUGUUCGGGCGCCA 
3µµ[µµµµaaaµUµLysµ3UUµOryctolagus cuniculusµcytosolic µ-GCCCGGAUALCUCAGDC-GGD--AGAGCAPCAGACU3UU[APCUGAGG-------------------7D??AGGG\PCA"GUCCCUGUUCGGGCGCCA 
3µµ[µµµµaaaµUµLysµ3UUµRattus norvegicusµcytosolic µ-GCCCGLAUALCUCAGDC-GGD--AGAGCAPCAGACU3UU[APCUGAGG-------------------7D??AGGG\PCA"GUCCCUGUUCGGGCGCCA 
3µµ6µµµµaaaµUµLysµ3UUµSaccharomyces cerevisiaeµcytosolic µ-PCCUUGUUALCUCAGDD-GGD--AGAGCRPPCGGCU3UU6ACCGAAAU-------------------7D?AGGGGTPCG"GCCCCCUAPGAGGAGCCA 
Cµµ6µµµµatgµCµMetµCAUµSaccharomyces cerevisiaeµcytosolic µ-GCUUCAGUALCUCAGDA-GGA--AGAGCRPCAGPCUCAU6APCUGAAG-------------------7D?GAGAGTPCG"ACCUCUCCUGGAGCACCA 
#µµWµµµµttcµGµPheµ#AAµOryctolagus cuniculusµcytosolic µ-GCCGAAAUALCUC"GDD-GGG--AGAGCRPPAGABU#AAWAPCUAAAG-------------------7DC?CUGGTPCG"UCCCGGGUUUCGGCACCA 
#µµYµµµµttcµGµPheµ#AAµSchizosaccharomyces pombeµcytosolic µ-GUCGCAAU;LUGPAGDD-GGG--AGCAPLACAGABU#AAYAPCUGUUG-------------------7NCAUCGGTPCGAUCCCGGUUUGUGACACCA 
#µµYµµµµttcµGµPheµGAAµSaccharomyces cerevisiaeµcytosolic µ-GCGGAUUUALCUCAGDD-GGG--AGAGCRCCAGABU#AAYAP?UGGAG-------------------7UC?UGUGTPCG"UCCACAGAAUUCGCACCA 
#µµYµµµµttcµGµPheµGAAµSaccharomyces cerevisiaeµcytosolic µ-GCGGACUUALCUCAGDD-GGG--AGAGCRCCAGABU#AAYAP?UGGAG-------------------7UC?UGUGTPCG"UCCACAGAGUUCGCACCA 
Iµµ6µµµµactµAµThrµAGUµSaccharomyces cerevisiaeµcytosolic µ-GCUUCUAUGLCCAAGDD-GGD--AAGGCRCCACA'UIGU6APGUGGAG-------------------AD?AUCGGTPCA"AUCCGAUUGGAAGCACCA 
Iµµ6µµµµactµAµThrµAGUµSaccharomyces cerevisiaeµcytosolic µ-GCUUCUAUGLCCAAGDD-GGD--AAGGCRCCACA'UIGU6APGUGGAG-------------------AD?GUCGGTPCA"AUCCGACUGGAAGCACCA 
.µµAµµµµgt.µµValµ.ACµRattus norvegicusµcytosolic µ-GUUUCCGUAGUGPAGD--#GDD-AUCACLPUCGCCU.ACA?GCGAAAG-------------------7D??CCGGUPCG"AACCGGGCGGAAACACCA 
&µµAµµµµgtaµEucaryµValµUACµSaccharomyces cerevisiaeµcytosolic µ-GGUCCAAUGLUCCAGD--GGDDCAAGACRPCGCCPU&ACACGGCGAAG-------------------ADC?CGAGTPCG"ACCUCGGUUGGAUCACCA 
Gµµ6µµµµµmitoµAspµGUCµAedes albopictusµmitochondrial µ-AAAAAAUU"GUUUAAU--CA---AAAACCPPAGUAUGUC6AACUAAAA-------------------A-AAUUAGAUCAU--CUAAUAPPUUUUACCA 
Nµµ6µµµµµmitoµGluµNUCµAedes albopictusµmitochondrial µ-AUUUAUAU"GUUUAA---AU---AAAACAPPACAUUNUC6CUGUAAAA-------------------A-UAAAA-AUUUAU--UUUUPAUAAAUACCA 
UµµAµµµµµmitoµGlyµUCCµAedes albopictusµmitochondrial µ-AUUUAUAU"GUAUAUA--AU---UGUAUAPGN;ACUUCCAA]CACAAG-------------------G-ACUAA-AUAAUU--UUAGUAPAAAUACCA 
Gµµ6µµµµµmitoµIleµGAUµAedes albopictusµmitochondrial µ-AAUGAAUUKCCUGAU---AA---AAAGGAPPACCUUGAU6GGGUAAAU-------------------UAUAAAGAUUUAAU-ACUUPAPUCAUUACCA 
Cµµ6µµµµµmitoµLysµCUUµAedes albopictusµmitochondrial µ-CAUUAGAUKACUGAA---AG---CAAGUAAPGAUCUCUU6AAUCAUAA-------------------UAUAGUAAAUUAGC_UUACPPCUAAUGACCA 
Gµµ6µµµµµmitoµSerµGCUµAedes albopictusµmitochondrial µ-GAAAUAU--GUU-----GA--UC--AAG-AAAAGCUGCU6ABUPUUUCUU------------------UAAUGGUUUAAUUCCAUPAUAUUUCU-CCA 
Cµµ6µµµµµmitoµIniµCAUµAedes albopictusµmitochondrial µ-AAAAAGAU"AGCUAA---UU---AAGCUAPPGGGUUCAU6CCCCACUU-------------------A-UAAAGGUAAUAAUCCUUPPCUUUUUACCA 
GµµKµµµµµmitoµPheµGAAµAscaris suumµmitochondrial µ-ACUCUGUU"GUUUAUGU-UUU--AAAAPAPGACPPUGAAKAAGUUGGA-------------------A-AA----UG---------UUAGGAGUGCCA 
>µµAµµµµµmitoµMetµ>AUµAscaris suumµmitochondrial µ-AAPAAGAU"GGAUAA---GUUG-AGUCULPGAGGUU>AUACCCUCUUG-------------------G-UG----UUUUU------CUCUUAPUGCCA 
AµµKµµµµµmitoµArgµACGµAscaris suumµmitochondrial µ-GGACGUU""AUAGAU---AA---GCUAPGCCPAGPUACGKPCPGGGAA-------------------G-AG---------------AGUCGPCUUCCA 
Uµµ6µµµµµmitoµSerµUCUµAscaris suumµmitochondrial µ-GACAAAUG-----------------UUUPCAGGUCUUCU6AAPCUGUUUU--------------------GGA--GAAA-----UCCGPUUGUUUCCA 
!µµKµµµµµmitoµGluµ!UCµAscaris suumµmitochondrial µ-GAGAUAUU"GUAUAAAUUUUU--UGUAPAPUPCUPU!UCKAAGAAAAG-------------------G-U-----UUA---------UUAUCPUACCA 
!µµ6µµµµµmitoµLysµ!UUµAscaris suumµmitochondrial µ-GGGGUGUU"ACUUAAGUUU----AAAGPRPPAGAUU!UU6APCUGGAA-------------------A-UGG---GUUG------UCACAPCCUGCCA 
!µµKµµµµµmitoµGlnµ!UGµAscaris suumµmitochondrial µ-UAUACUUU"GUUUAGGA------AGAAUAPUUAPPU!UGKPGPAAAAG-------------------G-G-----UUG---------UAGUAPAGCCA 
$µµ*µµµµµmitoµTrpµ$CAµAscaris suumµmitochondrial µ-ACAGAUUU"AGUUAAGUUU----AAACUCPPGGPPU$CA*AACCAAAA-------------------A-U-----UUU---------ACUCPGUACCA 
$µµKµµµµµmitoµLeuµ$AAµAscaris suumµmitochondrial µ-GPUGUUAU"GCAUAAGA------AGUGCAPPUGPPU$AAKCGPAAAAG-------------------A-U-----AUG---------GGACAACUCCA 
QµµKµµµµµmitoµHisµQUGµAsterias amurensisµmitochondrial µGACUAAAGU"GUUUAAAU------AAAACCCPAAUPUQUGKPAUUAAAA--------------------UUAUCAGUPAA"AUCUGAUCUAUAGUCCCA 
Gµµ+µµµµµmitoµAsnµGUUµAsterias amurensisµmitochondrial µ-UGAGUUGU"LCCUAGU--GGA--AAGGCGPPUGGCCGPU+ACPAAAAG-------------------AUAGCAAGAUCA"UACUUGCCAGCUCAGCCA 
Gµµ6µµµµµmitoµAsnµGPUµAsterias amurensisµmitochondrial µ-UGGGUUGU"GCCUAAU--GGA--AAGGCAAPUGGCCGPU6ACCAGGAG-------------------AUAACAAGAUCA"UACUUGUCAACUCAGCCA 
Gµµ*µµµµµmitoµTyrµGUAµAsterias amurensisµmitochondrial µ-GGCAGGGUKGCAGAA"--GUD--AAUGCACPAAAPUGUA*AUPUAUAA--------------------AUAAAGGUPUAAUUCCUUUUCUUGCCACCA 
∃µµAµµµµµmitoµGluµ∃UCµBos taurusµmitochondrial µ-GUUCUUGU"GUUGAA---UG---ACAACLAPGGUUU∃UCAUAPCAUUA-------------------G-U?AUGGUPAG"UUCCAUGUAAGAAUACCA 
∃µµ6µµµµµmitoµLysµ∃UUµBos taurusµmitochondrial µ-CACUAAGA"LCUAU---------AUAGCACPAACCU∃UU6AGUUAGAG-------------------AUUGAGAGCCAU"UACUCUCCUUGGUGACCA 
Gµµ6µµµµµmitoµSerµGCUµBos taurusµmitochondrial µ-GAAAAAG-U----------------AUGCAAGAACUGCU6AUUC_UGCUC--------------------?CAUAUCUAAU_UAUGGCUUUUUCGCCA 
Uµµ6µµµµµmitoµThrµUGUµBos taurusµmitochondrial µ-GUCUUUGU"GUACAU---CU---AAUAUACUGGU'UUGU6AACCAGAG-------------------A-AGGAGAACAACU_CCUCCCPAAGA?UCCA 
ʵµ*µµµµµmitoµTrpµÊCAµBos taurusµmitochondrial µ-AGGAAUUU"LGUUAA---AC---AGACCAAGAGCCUÊCA*AGCCCUAA-------------------G-?AAGUACAAUU--UACUUAAUUCCUGCCA 
Gµµ+µµµµµmitoµCysµGCAµBos taurusµmitochondrial µ-AGCCCUGUKGUGAAUU-------UACACGPPGAAPUGCA+APUCAGAG-------------------A-AGCAGCUUCA"U-UCUGCCGGGGCUUCCA 
QµµAµµµµµmitoµAspµQUCµDidelphis virginianaµmitochondrial µ-AAGAUAUU"LUAAAA---UUC--AUUACAPAACUPUQUCAUAGUUAAA-------------------U-UAUAGGUPUAACUCCUAUAUAUCUUACCA 
ʵµAµµµµµmitoµGlyµÊCUµHalocynthia roretziµmitochondrial µ-GCGUULAU"GUUUAA---GU---AAAAUAGAUUCUUÊCUAGGPAUAAG---------------------UUAGGGUUGG---UCCCUUUGAUGCACCA 
UµµAµµµµµmitoµGlyµUCCµHalocynthia roretziµmitochondrial µ-GCUGUGUU"GUAUAAA--GU---AAUAPAPGUGAPUUCCAAPCAUGGG---------------------AUCCUU-------UAGGGACGUAGUACCA 
GµµAµµµµµmitoµSerµGCUµHalocynthia roretziµmitochondrial µ-AAGGGUGAUUAGGAA---------UGUUAGAAAGPUGCUAPPUUUUUG-------------------AUAUPGAGUUCGAAUCUCGAGGCUCUUGCCA 
ʵµUµµµµµmitoµMetµÊAUµHalocynthia roretziµmitochondrial µ-GGUAAUAU"LGUUAAUA--U---AAACCAGAAAGUUÊAUUPCUUUCUA-------------------A-UAACGAA-------UGPUUAUUACUUCCA 
ʵµ*µµµµµmitoµTrpµÊCAµHalocynthia roretziµmitochondrial µ-AGGAGAUU"LUUUAAGU--U---AAAUCAAUUGUUUÊCA*AACAGUAG-------------------U-UAUAUAGAAUGAUUAUAUAUUUCCUGCCA 
Gµµ6µµµµµmitoµSerµGCUµHomo sapiensµmitochondrial µ-GAGAAAG-C----------------UCACAAGAACUGCU6ACUCAUGCCC--------------------CCAUGUCUA"C_CAUGGCUUUCUCACCA 
∃µµ6µµµµµmitoµLysµ∃UUµHomo sapiensµmitochondrial µ-CACUGUAA"LCUAAC--------UUAGCAPPAACCU∃UU6AGUUAAAG-------------------AUUAAGAGAACCAA_CUCUUUACAGUGACCA 
>µµAµµµµµmitoµMetµµHomo sapiensµmitochondrial µ-AGUAAGGUCAGCUAAAU------AAGCUAPCGGGCC>AUACCCCGAAA-------------------A-UGPUGGUUAUAC-CCUUCCCGUACUACCA 
.µµ.µµµµµmitoµLysµ.UUµLoligo bleekeriµmitochondrial µ-GCCUCCAUALCUCAGDC-GGU--AGAGCAPCAGACU.UU.ANCUGAGG-------------------7D?UGGGGUPCG"GUCCCCAULUGGG?UCCA 
.µµAµµµµµmitoµLysµ.UUµLoligo bleekeriµmitochondrial µ-GCCUUCAUALCUCAGDC-GGU--AGAGCAPCAGACU.UUAANCUGAGG-------------------7D?UGGGGTPCG"GUCCCCAULCGGG?UCCA 
7µµ6µµµµµmitoµSerµ7CUµLoligo bleekeriµmitochondrial µ-AAAGGUAAUUAGGAA---------UAAAAPAAAGCU7CU6ACPUUAUU------------------UUGAGCAACUCAAAACUGUUCUACCUUUUCCA 
GµµAµµµµµmitoµAspµGUCµMesocricetus auratusµmitochondrial µ-AAGAUAUU"GUAAAA---UC---AUUACAPAACUUUGUCAGAGUUAAA-------------------U-UAUAGACUAAUC-UCUAUAUAUCUUACCA 
Nµµ6µµµµµmitoµLysµNUUµMesocricetus auratusµmitochondrial µ-CACUAUGA"LCUC----------AGAGCLPUAACCUNUU6AGUUAAAA-------------------U-UGAGAGACUUCUAGUCUCCAUGGUGACCA 
UµµAµµµµµmitoµArgµUCGµMesocricetus auratusµmitochondrial µ-UGGUGAUU"GUUUAA---CU---AAAAUUAAUGAPUUCGACPCAUUAG-------------------A-UUAUGACAUAUC-UCAUAAUCACCAACCA 
Gµµ6µµµµµmitoµSerµGCUµMesocricetus auratusµmitochondrial µ-GAGAAUG-U----------------AUGCAAGAGCUGCU6ACUCCUGCUA--------------------CCAUGUAUAAU_CAUGGCUUUCUUACCA 
QµµAµµµµµmitoµAspµQUCµRattus norvegicusµmitochondrial µ-GAGAUAUU"GUAAAA---UA---AUUACAPAACCUUQUCAAGGUUAAG-------------------U-UAUAGACUUAAA-UCUAUAUAUCUUACCA 
Gµµ*µµµµµmitoµPheµGAAµRattus norvegicusµmitochondrial µAGUUAAUGU"GCUUAUA--AU---AAAGCAAAGCACUGAA*APGCUUAG-------------------A-UGGAU-UCAAAA--AUCCCAUAAACACCA 
Nµµ6µµµµµmitoµLysµNUUµRattus norvegicusµmitochondrial µ-CAUUGCGA"LCUU----------AGAGCLPUAACCUNUU6AGUUAAAG-------------------UUAGAGA-CAACAAA-UCUCCACAAUGACCA 
UµµAµµµµµmitoµValµUACµRattus norvegicusµmitochondrial µ-CAUAGUGU"LCUUAAUC-AC---AAAGCAPCUGGCCUACACCCAGAAG-------------------A-AUUCA-UAAAAA--UGAACACUUUGACCA 
Nµµ*µµµµµmitoµTrpµNCAµRattus norvegicusµmitochondrial µAAGAAGUUU"GGAUAU---AC---AGUCCAAGAGCCUNCA*AGCCCUUA-------------------G-AAAAC-AAACAA--GUUUAACUUCUGCCA 
Gµµ6µµµµµmitoµIleµGAUµSaccharomyces cerevisiaeµmitochondrial µ-GAAACUAUAAUUCAADD-GGDU-AGAAUAGUAUPUUGAU6AGGUACAA-------------------A-UAUAGGTPCAAUCCCUGUUAGUUUCACCA 
$µµ6µµµµµmitoµLysµ$UUµSaccharomyces cerevisiaeµmitochondrial µ-GAGAAUAUUGUUUAAD--GGD--AAAACAGPUGPCU$UU6AGCAACCC-------------------A-UGC_GGTPCAACUCCAGCUAUUCUCACCA 
GµµKµµµµµmitoµPheµGAAµSaccharomyces cerevisiaeµmitochondrial µ-GCUUUUAUAGCUUAGD--GGD--AAAGCRAUAAAPUGAAKAPUUAUUU-------------------A-CAU_AGUPCGAUUCUCAUUAAGGGCACCA 
Nµµ+µµµµµmitoµGlyµNCCµSaccharomyces cerevisiaeµmitochondrial µ-AUAGAUAUAAGUUAAUD-GGD--AAACURGAUGPCUNCC+AACAUUGA-------------------A-UGCGAGTPCGAUUCUCGCUAUCUAUACCA 
AµµAµµµµµmitoµArgµACGµSaccharomyces cerevisiaeµmitochondrial µ-AUAUCUUUAAUUUAAD--GGD--AAAAUAPUAGAAUACGAAPCUAAUU-------------------A-UAUAGGTPCAAAUCCUAUAAGAUAUUCCA 
Nµµ6µµµµµmitoµArgµNCUµSaccharomyces cerevisiaeµmitochondrial µ-GCUCUCUUAGCUUAAD--GGDU-AAAGCAPAAUACUNCU6APAUUAAU-------------------AUUCCAUGTPCAAAUCAUGGAGAGAGUACCA 
UµµKµµµµµmitoµThrµUAGµSaccharomyces cerevisiaeµmitochondrial µ-GUAAAUAUAAUUUAAD--GGD--AAAAULPAUGP_UUAGKPGCAUAUU-------------------A-UCUAAGTPCAAAUCUUAGUAUUUACACCA 
!µµHµµµµµmitoµTrpµ!CAµSaccharomyces cerevisiaeµmitochondrial µ-AAGGAUAUAGUUUAAD--GGD--AAAACAGUUGAPU!CAHAPCAAUCA-------------------U-UAGGAGTPCGAAUCUCUUUAUCCUUGCCA 
CµµPµµµµµmitoµMetµCAUµTetrahymena pyriformisµmitochondrial µ-GCUGCUU--GAA--U---GGD----UUC_GUGGGCUCAUPPCCCAUUA-------------------CUAUAAAGTPCGAUUCUUUAAAGCGGCCCCA 
!µµ+µµµµµmitoµTrpµ!CAµTetrahymena thermophilaµmitochondrial µ-GGGGGAAUALUUUAAU--GGD--AGAACAACGGUCU!CA+AAPCGUUA-------------------G-CGUGGGUUCGAUUCCUGCUUCUCUCGCCA 
<µµ6µµµµµmitoµIleµµSpinacia oleraceaµplastidic µ-GCAUCCAUGGCUGAAU--#GDD-AAAGCRCCCAACU<AU6APPG_GAA-------------------UUCGUAGGTPCAAUUCCUACUGGAUGCACCA 
CµµAµµµµgcgµBacterµAlaµCGCµStreptomyces griseusµprokaryotic cytosol µ-GGGCCUGUGGCGCAGUCUGGD-DAGCGCACCUCGUUCGCAUCGAGGGG-------------------GUCUGGGGUUCA"AUCCCCACAGGUCCA--- 
GµµAµµµµgccµGµAlaµGGCµStreptomyces griseusµprokaryotic cytosol µ-GGGGCUAUAGCUBAGUDDGGD-DAGAGCGCCUGCAUGGCAUGCAGGAG-------------------7UCAGGAGUUCA"UUCUCCUUAGCUCCA--- 
5µµ=µµµµgcaµUµAlaµUGCµBacillus subtilisµprokaryotic cytosol µ-GGAGCCUUAGCUCAGCD-GGG--AGAGCGCCUGCUU5GC=CGCAGGAG-------------------7UCAGCGGTPCGAUCCCGCUAGGCUCCACCA 
5µµ6µµµµgcaµUµAlaµUGCµLactococcus lactisµprokaryotic cytosol µ-GGGGCCU4AGCUCAGCU-GGG--AGAGCGCCUGCUU5GC6CGCAGGAG-------------------7UCAGCGGUUCGAUCCCGCUAGGCUCCA--- 
Uµµ=µµµµgcaµUµAlaµUGCµMycoplasma capricolumµprokaryotic cytosol µ-GGGCCCU4AGCUCAGCD-GGG--AGAGCACCUGCCUUGC=CGCAGGGG-------------------7UCGACGGUPCGAUCCCGUUAGGGUCCACCA 
Uµµ=µµµµgcaµUµAlaµUGCµMycoplasma mycoidesµprokaryotic cytosol µ-GGGCCCUUAGCUCAGCD-GGG--AGAGCACCUGCCUUGC=CGCAGGGG-------------------7UCGACGGUUCGAUCCCGUUAGGGUCCACCA 
CµµGµµµµgcaµUµAlaµUGCµStreptomyces griseusµprokaryotic cytosol µ-GGGGCCUUAGCUBAGUDGGDA-GAGCGCUGCCUUUGCAAGGCAGAU---------------------GUCAGGAGUUCGAAUCUCCUAGGCUCCA--- 
!µµ6µµµµagaµUµArgµ!CUµMycoplasma capricolumµprokaryotic cytosol µ-GCCCAUGUAGCUCAGUA-GGAD-AGAGCACGCGCCU!CU6AGCGUGAG-------------------7UCGGAAGUPCGAGCCUUCUCGUGGGCACCA 
IµµKµµµµcgtµAµArgµACGµStreptomyces griseusµprokaryotic cytosol µ-GCACUCGUAGCUJAAC--GGADDAGAGCAUCUGACUICGKAUCAGAAG-------------------7UUGCAGGUUCG"AUCCUGCCGAGUGCA--- 
CµµKµµµµcggµCµArgµCCGµStreptomyces griseusµprokaryotic cytosol µ-GCCCCCGUAGCUBAG#-#GGADDAGAGCAUCGGCCUCCGKAGCCGGGU--------------------GCGCAGGUUCG"AUCCUGCCGGGGGCA--- 
Cµµ6µµµµaggµCµArgµCCUµStreptomyces griseusµprokaryotic cytosol µ-GCCUUCGUAGCUBAG#-#GGADDAGAGCACCGCUCUCCU6AAGCGGGU-------------------GUCGCAGGUUCG"AUCCUGCCGGGGGCA--- 
Iµµ/µµµµcgtµAµArgµICGµEscherichia coliµprokaryotic cytosol µ-GCAUCCG4AGCUCAGCD-GGAD-AGAGUACUCGG%UICG/ACCGAGCG-------------------7XCGGAGGTPCGAAUCCUCCCGGAUGCACCA 
{µµ6µµµµagaµUµArgµUCUµEscherichia coliµprokaryotic cytosol µ-GCGCCCUUAGCUCAGUU-GGAU-AGAGCAACGAC%U{CU6AGPCGUGG-------------------GCCGCAGGTPCGAAUCCUGCAGGGCGCGCCA 
UµµAµµµµagaµUµArgµUCUµStreptomyces griseusµprokaryotic cytosol µ-GCCCCCGUAGCUBAGU--GGADDAGAGCAGGCGCCUUCUAAGCGCUUG-------------------GcCGCAGGUUCGAGUCCUGCCGGGGGCG--- 
Qµµ6µµµµaacµGµAsnµGUUµEscherichia coliµprokaryotic cytosol µ-UCCUCUG4AGUUCAGDC-GGD--AGAACGGCGGACUQUU6APCCGUAU-------------------7UCACUGGTPCGAGUCCAGUCAGAGGAGCCA 
Gµµ6µµµµaacµGµAsnµGUUµLactococcus lactisµprokaryotic cytosol µ-UGCGGAU4AGCUCAGUU-GGUA-GUAGCGCAUGACUGUU6AUCAUGAU-------------------7UCGUCAGUUCGAGUCUGACAUCCGCAG--- 
Gµµ6µµµµaacµGµAsnµGUUµMycoplasma capricolumµprokaryotic cytosol µ-GGCUUUU4AGCUCAGCA-GGD--AGAGCAACCGGCUGUU6ACCGGUUU-------------------7UCACAGGUPCGAGCCCUGUAAAAGCCGCCA 
Gµµ6µµµµaacµGµAsnµGUUµStreptomyces griseusµprokaryotic cytosol µ-UCCCCUGUAGCUBAAU--DGGC-AGAGCAGCCGGCUGUU6ACCGGCAG-------------------7UUACUGGUUCGAGUCCAGUCGGGGGAG--- 
Gµµ6µµµµaacµGµAsnµGUUµStreptomyces griseusµprokaryotic cytosol µ-UCCCCUGUAGCUBAAU--DGGC-AGAGCAUUCGGCUGUU6ACCGGAGG-------------------7UUACUGGUUCGAGUCCAGUCGGGGGAG--- 
Qµµ6µµµµaacµGµAsnµQUUµAzospirillum lipoferumµprokaryotic cytosol µ-UUCACAGUAGCUCAGU--GGD--AGAGCUAUCGGCUQUU6ACCGAUCG-------------------AUCGUAGGTPCGAGUCCUACCUGUGAAUCCA 
Qµµ6µµµµaacµGµAsnµQUUµAzospirillum lipoferumµprokaryotic cytosol µ-UUCACAGUCGCUCAGU--GGD--AGAGCUAUCGGCUQUU6ACCGAUCG-------------------AUCGUAGGTPCGAGUCCUACCUGUGAAUCCA 
⊄µµ/µµµµgacµGµAspµ⊄UCµEscherichia coliµprokaryotic cytosol µ-GGAGCGG4AGUUCAGDC-GGDD-AGAAUACCUGCCU⊄UC/CGCAGGGG-------------------7UCGCGGGTPCGAGUCCCGPCCGUUCCGCCA 
GµµAµµµµgacµGµAspµGUCµThermus thermophilusµprokaryotic cytosol µ-GGCCCCG4GGUGPAGUU-#GDD-AACACACCCGCCUGUCACGPGGGAG-------------------AUCGCGGGFPCG"GUCCCGUCGGGGCCGCCA 
Gµµ*µµµµtgcµGµCysµGCAµEscherichia coliµprokaryotic cytosol µ-GGCGCGU4AACAAAGC--GGD--DAUGUAGCGGAPUGCA*APCCGUCU-------------------A-GUCCGGTPCGACUCCGGAACGCGCCUCCA 
Gµµ=µµµµtgcµGµCysµGCAµMycoplasma capricolumµprokaryotic cytosol µ-GGCAACA4GGCCAAGC--GGCD-A"GGCAUGGGUCUGCA=CACCCUGA-------------------U-CAUCGGUPCGAAUCCGAUUGUUGCCUCCA 
GµµAµµµµtgcµGµCysµGCAµStreptomyces griseusµprokaryotic cytosol µ-GACCGUGUGCCCGAGA--GGCU-BAGGGGCUCGABUGCAACUCGAGUU-----------------ACACCGGUUCG""UCCGGUCACGGUCUCCG--- 
Gµµ*µµµµtgcµGµCysµGCAµStreptomyces griseusµprokaryotic cytosol µ-GGUGGAGUGGCCKAGA--GGC--GAGGCAACGGCCUGCA*AGCCGUCU-------------------A-CACGGGUUCAAAUCCCGUCUCCACCUCCA 
Gµµ≠µµµµtgcµGµCysµGCAµStreptomyces griseusµprokaryotic cytosol µ-GGUGGAGUGGCCKAGA--GGC--GAGGCAACGGCCUGCA≠AGCCGUCU-------------------A-CACGGGUUCAAAUCCCGUCUCCACCUCCA 
$µµ=µµµµcaaµUµGlnµ$UGµMycoplasma capricolumµprokaryotic cytosol µ-UGGGCUA4AGCCAAGC--GGD--A"GGCAAGGGACU$UG=CUCCCUCA-------------------UGCGCCGGUPCGAAUCCUGCUAGCCCAACCA 
Cµµ/µµµµcagµCµGlnµCUGµEscherichia coliµprokaryotic cytosol µ-UGGGGUA4CGCCAAGC--#GD--AAGGCACCGGAJUCUG/PPCCGGCA-------------------UUCCGAGGTPCGAAUCCUCGUACCCCAGCCA 
CµµGµµµµcagµCµGlnµCUGµStreptomyces griseusµprokaryotic cytosol µ-UGGGCUAUGBUGUAAUDDGGC--AACACUACGGUUUCUGGUACCGUCA-------------------U-UCUAGGUUCGAGUCCUGGUAGCCCAG--- 
$µµ/µµµµcaaµUµGlnµUUGµEscherichia coliµprokaryotic cytosol µ-UGGGGUA4CGCCAAGC--#GD--AAGGCACCGGUJU$UG/PACCGGCA-------------------UUCCCUGGTPCGAAUCCAGGUACCCCAGCCA 
UµµAµµµµcaaµUµGlnµUUGµLactococcus lactisµprokaryotic cytosol µ-UGGGGUA4AGCCAAGCG-GDA--AGGCAAGGGACUSUUGACUCCCUCA-------------------UGCGUUGGUUCGAAUCCAGCUACCCCAG--- 
UµµGµµµµcaaµUµGlnµUUGµStreptomyces griseusµprokaryotic cytosol µ-UCCCCCAUGKUGUAAUCAGGC--AGCACUGCGGUUUUUGGUACCGUCU-------------------G-UUCAGGUUCA"AUCCUGAUGGGGGAG--- 
Sµµ/µµµµgaaµUµGluµ{UCµEscherichia coliµprokaryotic cytosol µ-GUCCCCU4CGUCPAGA--GGCCCAGGACACCGCCCUSUC/CGGCGGUA-------------------A-CAGGGGTPCGAAUCCCCUAGGGGACGCCA 
$µµAµµµµgaaµUµGluµ$UCµMycoplasma capricolumµprokaryotic cytosol µ-GGCCUGUUGGUGAAGC--GGDD-A"CACACACGGUU$UCAUCCGUGGA-------------------CACACGGGUPCGAACCCCGUACAGGCUACCA 
CµµAµµµµgagµCµGluµCUCµStreptomyces griseusµprokaryotic cytosol µ-GCCCCCGUUGUGJAGC--GGCCUAGCACGCUGCCCUCUCACGGCAGUA-------------------G-CGCCGGUUCG""UCCGGUCGGGGGUACAA 
CµµAµµµµgagµCµGluµCUCµStreptomyces griseusµprokaryotic cytosol µ-GCCCCCGUUGUGJAGC--GGCCUAGCACGCUGCCCUCUCACGGCAGUA-------------------G-CGCCGGUUCG""UCCGGUCGGGGGUA--- 
UµµAµµµµgaaµUµGluµUUCµLactococcus lactisµprokaryotic cytosol µ-GGUCCGUUGGUC"AGG--GGUU-AAGACACCGCCUUUUCACGGCGGUA-------------------A-CACGGGUUCGAAUCCCGUACGGACUA--- 
!µµAµµµµggaµUµGlyµ!CCµBacillus subtilisµprokaryotic cytosol µ-GCGGGUGUAGUUUAGU--GGD--AAAACCUCAGCCU!CCAAGCUGAUG-------------------U-CGUGAGTPCGAUUCUCAUCACCCGCUCCA 
{µµAµµµµggaµUµGlyµ{CCµEscherichia coliµprokaryotic cytosol µ-GCGGGCAUCGUAUAAU--GGCU-AUUACCUCAGCCU{CCAAGCUGAUG-------------------A-UGCGGGTPCGAUUCCCGCUGCCCGCUCCA 
Uµµ=µµµµggaµUµGlyµ{CCµMycoplasma capricolumµprokaryotic cytosol µ-GCAGGUG4AGUUUAAU--GGD--AGAACUUCAGCCUUCC=AGCUGAUU-------------------G-UGAGGGUPCGAUUCCCUUCACCUGCUCCA 
Uµµ=µµµµggaµUµGlyµ{CCµMycoplasma mycoidesµprokaryotic cytosol µ-GCAGGUG4AGUUUAAU--GGC--AGAACUUCAGCCUUCC=AGCUGAUU-------------------G-UGAGGGUPCGAUUCCCUUCACCUGCUCCA 
UµµCµµµµggaµUµGlyµ{CCµStaphylococcus epidermidisµprokaryotic cytosol µ-GCGGGAG4AUUUCAACU-UUD--AGAAUACGUUCCUUCCCGGAACGAG-------------------A-UAUAGGUGCAAAUCCUAUCUUCCGCUCCA 
UµµCµµµµggaµUµGlyµ{CCµStaphylococcus epidermidisµprokaryotic cytosol µ-GCGGGAG4AGUUCAAU--UUD--AGAACACAUUCCUUCCCGGAAUGAG-------------------G-UAUAGGUGCAAGUCCUAUCUUCCGCUCCA 
CµµAµµµµgggµCµGlyµCCCµSalmonella typhimuriumµprokaryotic cytosol µ-GCGGGCGUAGUUCAAU--#GD--AGAACGAGAGCUUCCCAAGCUCUAU-------------------A-CGAGGGTPCGAUUCCCUUCGCCCGCUCCA 
CµµAµµµµgggµCµGlyµCCCµStreptomyces coelicolor A3(2)µprokaryotic cytosol µ-GCGGGUGUAGUUCAAU--GGD--AGAACAUCAGCUUCCCAAGCUGAGA-------------------G-CGCGAGTPCGAUUCUCGUCACCCGCUCCA 
CµµAµµµµgggµCµGlyµCCCµStreptomyces griseusµprokaryotic cytosol µ-GCGGKUGUAGUUUAAU--GGD-DAGAACAUGAGCUUCCCAAGCUCAGA-------------------G-CGCGAGUUCGAUUCUCGUCACCCGCU--- 
GµµAµµµµggcµGµGlyµGCCµLactococcus lactisµprokaryotic cytosol µ-GCGAACGUAGUUCAGG--GGU--AGAACACAACCUUGCCAUGGUUGGG-------------------7UCGCGAGUUCGAAUCUCGUCGUUCGCU--- 
NµµAµµµµggaµUµGlyµNCCµSalmonella typhimuriumµprokaryotic cytosol µ-GCGGGCAUCGUAUAAU--GGCU-AUUACCUCAGCCUNCCAAGCUGAUG-------------------A-UGCGGGTPCGAUUCCCGCUGCCCGCUCCA 
Uµµ=µµµµggaµUµGlyµUCCµLactococcus lactisµprokaryotic cytosol µ-GCGGAUGUAGUUUAAU--GGU--AGAACCCCAGCCUUCC=AGCUGGCU-------------------A-CGCGAGUUCGAUUCUCGUCAUCCGCU--- 
5µµ=µµµµggaµUµGlyµUCCµLactococcus lactisµprokaryotic cytosol µ-GCGGAUGUAGUUUAAU--GGU--AGAACCCCAGCCU5CC=AGCUGGCU-------------------A-CGCGAGUUCGAUUCUCGUCAUCCGCU--- 
UµµAµµµµggaµUµGlyµUCCµStreptomyces griseusµprokaryotic cytosol µ-GCGGGCGUAGCUCAAU--GGD-DAGAGCCCUAGUCUUCCAAACUAGCU-------------------A-CGCGGGUUCG"UUCCCGUCGCCCGCUCCA 
GµµKµµµµcacµGµHisµGUGµStreptomyces griseusµprokaryotic cytosol µ-GUGGGUAUAGCUBAGCU-GGC--AGAGCACCUGGUUGUGKUUCAGGAU-------------------7UCGCGGGUUCA"GUCCCGUUACUCACC--- 
Qµµ/µµµµcacµGµHisµQUGµSalmonella typhimuriumµprokaryotic cytosol µGGUGGCUA4AGCUCAGDD-GGD--AGAGCCCUGGAUUQUG/PPCCAGUU-------------------7UCGUGGGTPCGAAUCCCAUUAGCCACCCCA 
}µµ6µµµµatcµGµIleµ}AUµBacillus subtilisµprokaryotic cytosol µ-GGACCUUUAGCUCAGUU-GGUU-AGAGCAGACGGCU}AU6ACCGUCCG-------------------7UCGUAGGTPCGAGUCCUACAAGGUCCACCA 
}µµ=µµµµatcµGµIleµ}AUµMycoplasma capricolumµprokaryotic cytosol µ-GGACCUU4AGCUCAGUD-GGDD-AGAGCAUCCGGCU}AU=ACCGGACG-------------------7UCAUUGGUPCAAGUCCAAUAAGGUCCACCA 
}µµ6µµµµatgµCµIleµCAUµEscherichia coliµprokaryotic cytosol µ-GGCCCCU4AGCUCAGU--#GDD-AGAGCAGGCGACU}AU6APCGCUUG-------------------7XCGCUGGTPCAAGUCCAGCAGGGGCCACCA 
Gµµ6µµµµatcµGµIleµGAUµLactococcus lactisµprokaryotic cytosol µ-GGGAGUU4AGCUCAGUU-GGDDDAGAGCACUGUGUUGAU6ACGCAGGG-------------------7UCCCAGGUUCGAAUCCUGGAAUUCCCA--- 
Gµµ6µµµµatcµGµIleµGAUµMycoplasma capricolumµprokaryotic cytosol µ-CGGAAUAUAGCUCAGCD-GGDD-AGAGCAUUCCGCUGAU6ACGGAGAG-------------------7UCGUUGGUPCAAGUCCAAUUAUUCCGACCA 
Gµµ6µµµµatcµGµIleµGAUµMycoplasma mycoidesµprokaryotic cytosol µ-CGGAAUA4AGCUCAGCD-GGDD-AGAGCAUUCCGCUGAU6ACGGAGAG-------------------7UCGUUGGUPCAAGUCCAAUUAUUCCGACCA 
Gµµ6µµµµatcµGµIleµGAUµStreptomyces griseusµprokaryotic cytosol µ-GGGGCUAUAGCUBAGUDDGGDDDAGAGCGCAUCCCUGAU6AGGAUGAG-------------------------GGUUCA"AUCCUGUUAGCCCCACCA 
Gµµ6µµµµatcµGµIleµGAUµThermus thermophilusµprokaryotic cytosol µ-GGGCGAUUAGCUCAGCU-#GUD-AGAGCGCACGCCUGAU6AGCGUGAG-------------------7UCGGUGGFPCA"GUCCACCAUCGCCCACCA 
CµµAµµµµatgµCµIniµCAUµMycobacterium smegmatisµprokaryotic cytosol µ-CGCGGGGUGGAGCAGCUCGGD--AGCUCGCUGGGCUCAUAACCCAGAG-------------------7UCGCAGGUPCG"AUCCUGUCCCCGCUACCA 
CµµAµµµµatgµCµIniµCAUµSynechococcus elongatus PCC 6301µprokaryotic cytosol µ-CGCGGGGUAGAGCAGCCUGGD--AGCUCGUCGGGBUCAUAACCCGAAG-------------------7UCAGAGGTPCAAAUCCUCUCCCCGCCACCA 
CµµAµµµµatgµCµIniµCAUµThermus thermophilusµprokaryotic cytosol µ-CGCGGGG4GGAGCAGCCU#GD--AGCUCGUCGGGBUCAUAACCCGAAG-------------------7UCGCCGGFPCA"AUCCGGCCCCCGCAACCA 
CµµAµµµµatgµCµIniµCAUµThermus thermophilusµprokaryotic cytosol µ-CGCGGGG4GGAGCAGCCU#GD--AGCUCGUCGGGBUCAUAACCCGAAG-------------------7UCGCGGGFPCA"AUCCCGCCCCCGCAACCA 
$µµ[µµµµaaaµUµLysµ$UUµBacillus subtilisµprokaryotic cytosol µ-GAGCCAUUAGCUCAGUD-GGD--AGAGCAUCUGACU$UU[APCAGAGG-------------------7UCGAAGGTPCGAGUCCUUCAUGGCUCACCA 
$µµ6µµµµaaaµUµLysµ$UUµMycoplasma capricolumµprokaryotic cytosol µ-GACUCGUUAGCUCAGCC-GGD--AGAGCAACUGGCU$UU6ACCAGUGG-------------------7UCCGGGGUPCGAAUCCCCGACGAGUCACCA 
Cµµ6µµµµaagµCµLysµCUUµLactococcus lactisµprokaryotic cytosol µ-GGCCCGGUAGCUCAGUU-GGU--AGAGCAGUAGACUCUU6AUCUAUGG-------------------7UCCAGGGUUCGAGCCCCUGCCGAGCCA--- 
Cµµ6µµµµaagµCµLysµCUUµMycoplasma capricolumµprokaryotic cytosol µ-GUCUGAUUAGCGCAACD-GGC--AGAGCAACUGACUCUU6APCAGUGG-------------------7UUGUGGGUPCGAUUCCCACAUCAGGCACCA 
Cµµ6µµµµaagµCµLysµCUUµStreptomyces griseusµprokaryotic cytosol µ-GCGCCKUUAGCUBAGUDDGGDDDAGAGCAGCUGACUCUU6AUCAGCGG-------------------7UCCGGGGUUCGAGUCCCUGACGGCGCA--- 
$µµ6µµµµaaaµUµLysµUUUµLactococcus lactisµprokaryotic cytosol µ-GACUCGU4AGCUCAGUU-GGU--AGAGCAUUUGACU$UU6AUCAAAGG-------------------7UCGCUGGUUCGAGCCCAGC=CGGGUCACUA 
$µµ6µµµµaaaµUµLysµUUUµLactococcus lactisµprokaryotic cytosol µ-GACUCGU4AGCUCAGUU-GGU--AGAGCAUUUGACU$UU6AUCAAAGG-------------------7UCGCUGGUUCGAGCCCAGC=CGGGUCA--- 
}µµ=µµµµatgµCµMetµCAUµLactococcus lactisµprokaryotic cytosol µ-GGAUCUUUAGCUCAGUU-GGDDDAGAGCUAUCGGCU}AU=ACCGAUCG-------------------7UCGCUGGUUCGAAUCCAGCAAGAUCCA--- 
Mµµ=µµµµatgµCµMetµCAUµLactococcus lactisµprokaryotic cytosol µ-GGCGGUGUAGCUCAGCU-GGCU-AGAGCGUUCGGUUMAU=CCCGAGAG-------------------7UCGGGGGUUCGAUCCCCUUCGCCGCUA--- 
CµµAµµµµatgµCµMetµCAUµLactococcus lactisµprokaryotic cytosol µ-CGCGGGAUGGAGCAGCU-AGGU-AGCUCGUCGGGCUCAUAACCCGAAG-------------------7UCAUAGGTUCAAAUCCUAUUCCCGCAA--- 
CµµAµµµµatgµCµMetµCAUµStreptomyces griseusµprokaryotic cytosol µ-CGCGGGGUGGAGCAGCU-CGGDDAGCUCGCUGGGCUCAUAACCCAGAG-------------------GUCGCAGGUUCA"AUCCUGUCCCCGCUA--- 
Cµµ6µµµµatgµCµMetµCAUµStreptomyces griseusµprokaryotic cytosol µ-AGCGGUGUAGCUBAGUC-GGD-DAGAGCAAGCGGCUCAU6AUCGCUGU-------------------7UCACCGGUUCA"GUCCGGUCACCGCUACUA 
CµµAµµµµatgµCµMetµCAUµThermus thermophilusµprokaryotic cytosol µ-CGCGGGG4GGAGCAGCCU#GD--AGCUCGUCGGGBUCAUAACCCGAAG-------------------7UCGCGGGFPCA"AUCCCGCCCCCGCAACCA 
Mµµ6µµµµatgµCµMetµMAUµEscherichia coliµprokaryotic cytosol µ-GGCUACG4AGCUCAGDD-#GDD-AGAGCACAUCACUMAU6APGAUGGG-------------------7XCACAGGTPCGAAUCCCGUCGUAGCCACCA 
#µµ*µµµµttcµGµPheµ#AAµBacillus subtilisµprokaryotic cytosol µ-GGCUCGGUAGCUCAGUD-GGD--AGAGCAACGGACU#AA*APCCGUGU-------------------7UCGGCGGTPCGAUUCCGUCCCGAGCCACCA 
#µµ*µµµµttcµGµPheµ#AAµGeobacillus stearothermophilusµprokaryotic cytosol µ-GGCUCGG4AGCUCAGUC-GGD--AGAGCAAAGGACU#AA*APCCUUGU-------------------7UCGGCGGTPCGAUUCCGUCCCGAGCCACCA 
Gµµ*µµµµttcµGµPheµGAAµEscherichia coliµprokaryotic cytosol µ-GCCCGGA4AGCUCAGDC-GGD--AGAGCAGGGGAPUGAA*APCCCCGU-------------------7XCCUUGGTPCGAUUCCGAGUCCGGGCACCA 
GµµGµµµµttcµGµPheµGAAµLactococcus lactisµprokaryotic cytosol µ-GGCUCGGUAGCUCAGUU-GGU--AGAGCAAUGGAUUGAAGCUCCAUGU-------------------7UCGGCGGUUCGAUUCCGUCUCGCGCCA--- 
Gµµ*µµµµttcµGµPheµGAAµRhodospirillum rubrumµprokaryotic cytosol µ-GCCCGGGUAGCUCAGCD-GGD--AGAGCACGUGACUGAA*APCACGGU-------------------7UCGGUGGTPCGACUCCGCCCCCGGGCACCA 
Gµµ*µµµµttcµGµPheµGAAµSynechococcus sp. PCC 7002µprokaryotic cytosol µ-GCCAGGAUAGCNCAGUD-#GD--AGAGCAGAGGACUGAA*APCCUCGU-------------------7UCGGCGGTPCAAUUCCGCCUCCCGGCACCA 
Gµµ+µµµµttcµGµPheµGAAµThermus thermophilusµprokaryotic cytosol µ-GCCGALG4AGCUCAGUU-#GD--AGAGCAUGCGACUGAA+APCGCAGU-------------------7UCGGCGGTPCGAUUCCGCUCCUCGGCACCA 
CµµKµµµµccgµCµProµCGGµSalmonella typhimuriumµprokaryotic cytosol µ-CGGUGAU4GGCGCAGCCUGGD--AGCGCACUUCGJUCGGKACGAAGGG-------------------7UCGGAGGTPCGAAUCCUCUAUCACCGACCA 
CµµKµµµµccgµCµProµCGGµStreptomyces griseusµprokaryotic cytosol µ-CGGGGUGUAGCGCAGCUUGGC--AGCGCGCUUCGUUCGGKACGAAGAG-------------------GUCGUGGGUUCAAAUCCCGCCACCCCGA--- 
GµµKµµµµcccµGµProµGGGµSalmonella typhimuriumµprokaryotic cytosol µ-CGGCACG4AGCGCAGCCUGGD--AGCGCACCGUCBUGGGKUPGCGGGG-------------------7UCGGAGGTPCAAAUCCUCUCGUGCCGACCA 
GµµGµµµµcccµGµProµGGGµStreptomyces griseusµprokaryotic cytosol µ-CGGGACGUGGCGCAGCUUGGD-DAGCGCACUUGABUGGGGGUCAAGGG-------------------GUCGCAGGUUCA"AUCCUGUCGUCCCGA--- 
5µµKµµµµccaµUµProµUGGµLactococcus lactisµprokaryotic cytosol µ-CGGGAAGUAGCUCAGCUUGGU--AGAGUACUUGGUU5GGKACCAAGGU-------------------7UCGCAGGUUCGAAUCCUGUCUUCCCGA--- 
VµµKµµµµccaµUµProµVGGµSalmonella typhimuriumµprokaryotic cytosol µ-CGGCGAG4AGCGCAGCUUGGD--AGCGCAACUGGJUVGGKACCAGUGG-------------------7UCGGAGGTPCGAAUCCUCPCUCGCCGACCA 
5µµ6µµµµacaµUµThrµ5GUµBacillus subtilisµprokaryotic cytosol µ-GCCGGUGUAGCUCAAUD-GGD--AGAGCAACUGACU5GU6APCAGUAG-------------------7UUGGGGGTPCAAGUCCUCUUGCCGGCACCA 
Aµµ6µµµµactµAµThrµAGUµMycoplasma capricolumµprokaryotic cytosol µ-GCUGACU4AGCUCAGUD-GGD--AGAGCAAUUGACUAGU6APCAAUAG-------------------7UCGAAGGUPCAAAUCCUUUAGUCAGCACCA 
Cµµ6µµµµacgµCµThrµCGUµLactococcus lactisµprokaryotic cytosol µ-GCCGAGU4AGCUCAGUC-GGU--AGAGCACUUCACUCGU6ACGAAGGG-------------------GUCACAGGUUCGAUUCCUGCACUCGGCA--- 
Cµµ6µµµµacgµCµThrµCGUµStreptomyces griseusµprokaryotic cytosol µ-GCCGCCUUAGCUBAGUDDGGCC-AGAGCAACGCACUCGU6AUGCGUAG-------------------7UCUCGGGUUCGAAUCCCGAAGGCGGCU--- 
GµµAµµµµaccµGµThrµGGUµLactococcus lactisµprokaryotic cytosol µ-GCCGUUGUAGCUCAGUC-GGU--AGAGCAGCACCAUGGUAAGGUGAAG-------------------7UCGACAGUUCGAUUCUGUUCAAUGGCA--- 
Gµµ6µµµµaccµGµThrµGGUµStreptomyces griseusµprokaryotic cytosol µ-GCCCCAAUAGCUBAGUC-GGD-DAGAGCGUCUCCAUGGU6AGGAGAAG-------------------GUCUGCGGUUCG"UUCCGCAUUGGGGCU--- 
5µµ6µµµµacaµUµThrµUGUµLactococcus lactisµprokaryotic cytosol µ-GCCGACU4AGCUCAGUU-GGU--AGAGCAUCUGAUU5GU6AUCAGAGG-------------------7UCGCGUGUUCGAAUCAUGUAGUCGGCA--- 
Uµµ6µµµµacaµUµThrµUGUµMycoplasma capricolumµprokaryotic cytosol µ-GCUGACU4AGCUCAGCA-GGC--AGAGCAACUGACUUGU6APCAGUAG-------------------7UCGUAGGUPCGAUUCCUAUAGUCAGCACCA 
UµµAµµµµacaµUµThrµUGUµStreptomyces griseusµprokaryotic cytosol µ-GCCUCCUUAGCUBAGUCCGGCCCAGAGCGAUGUACUUGUAAUACAUAG-------------------GUCGUCGGUUCG""UCCGACAGGAGGCU--- 
)µµ=µµµµtgaµUµTrpµ)CAµMycoplasma capricolumµprokaryotic cytosol µ-AGGGGCAUAGUUCAGUA-GGD--AGAACAUCGGUCU)CA=AACCGAGU-------------------7UCACGAGUPCGAGUCUUGUUGCCCCUGCCA 
Bµµ=µµµµtggµCµTrpµBCAµMycoplasma capricolumµprokaryotic cytosol µ-AGGAGAGUAGUUCAAU--GGD--AGAACGUCGGUCUBCA=AACCGAGC-------------------7UUGAGGGUPCGAUUCCUUUCUCUCCUGCCA 
Cµµ*µµµµtggµCµTrpµCCAµEscherichia coliµprokaryotic cytosol µ-AGGGGCG4AGUUCAADD-GGD--AGAGCACCGGUBUCCA*AACCGGGU-------------------7UUGGGAGTPCGAGUCUCUCCGCCCCUGCCA 
Cµµ+µµµµtggµCµTrpµCCAµBacillus subtilisµprokaryotic cytosol µ-AGGGGCAUAGUUUAAC--GGD--AGAACAGAGGPCUCCA+AACCUCCG-------------------G-UGUGGGTPCGAUUCCUACUGCCCCUGCCA 
Cµµ≠µµµµtggµCµTrpµCCAµStreptomyces griseusµprokaryotic cytosol µ-AGGGGCGUAGCUBAGCG-GCC--AGAGCGGCGGUCUCCA≠AAUCGUAU-------------------7UCGCAGGUUCGAUUCCUGCCGCCCCUGCCG 
Cµµ*µµµµtggµCµTrpµCCAµStreptomyces griseusµprokaryotic cytosol µ-AGGGGCGUAGCUBAGCG-GCC--AGAGCGGCGGUCUCCA*AAUCGUAU-------------------7UCGCAGGUUCGAUUCCUGCCGCCCCUGCCG 
5µµ=µµµµgtaµUµValµ5ACµBacillus subtilisµprokaryotic cytosol µ-GGAGGAUUAGCUCAGCD-GGG--AGAGCAUCUGCCU5AC=AGCAGAGG-------------------7UCGGCGGTPCGAGCCCGUCAUCCUCCACCA 
CµµAµµµµgtgµCµValµCACµStreptomyces griseusµprokaryotic cytosol µ-GGGCGAUUAGCUBAGU--G#G--AGAGCGCUUCGUUCACACCGAAGAG-------------------7UCACUGGUUCGAACCCAGUAUCGCCCACCG 
Gµµ=µµµµgtcµGµValµGACµGeobacillus stearothermophilusµprokaryotic cytosol µ-GAUUCCGUAGCUCAGCD-GGG--AGAGCGCCACCUUGAC=GGGUGGAG-------------------7UCGCUGGTPCGAGCCCAGUCGGAAUCACCA 
GµµAµµµµgtcµGµValµGACµStreptomyces griseusµprokaryotic cytosol µ-GCGCGAUUAGCUBAGC--G#G--AGAGCGCUUCCCUGACACGGAAGAG-------------------7UCACUGGUUCAAUCCCAGUAUCGCGCACCA 
GµµAµµµµgtcµGµValµGACµStreptomyces griseusµprokaryotic cytosol µ-GCGCGAUUAGCUBAGC--G#G--AGAGCGCUUCCCUGACACGGAAGAG-------------------7UCACUGGUUCAAUCCCAGUAUCGCGCA--- 
GµµAµµµµgtcµGµValµGACµStreptomyces griseusµprokaryotic cytosol µ-GGACGAUUAGCUBAGC--G#G--AGAGCGCUUCCCUGACACGGAAGAG-------------------7UCACUGGUUCAAUCCCAGUAUCGUCCA--- 
5µµ=µµµµgtaµUµValµUACµLactococcus lactisµprokaryotic cytosol µ-GGGAGUU4AGCUCAGCU-GGG--AGAGCAUCUGCCU5AC=AGCAGAGG-------------------7UCAGCGGUUCGAUCCCGUUAACUCCCA--- 
Uµµ=µµµµgtaµUµValµUACµMycoplasma capricolumµprokaryotic cytosol µ-GGAGUGUUAGCUCAGCD-GGG--AGAGCUCCUGCCUUAC=AGCAGGCG-------------------7UCAUAGGUPCAAGUCCUAUACACUCCACCA 
Uµµ=µµµµgtaµUµValµUACµMycoplasma mycoidesµprokaryotic cytosol µ-GGAGUGU4AGCUCAGCD-GGG--AGAGCUCCUGCCUUAC=AGCAGGCG-------------------GUCAUAGGUUCAAGUCCUAUACACUCCACCA 
UµµAµµµµgtaµBacterµValµUACµStreptomyces griseusµprokaryotic cytosol µ-GGGUGCGUAGCUBAGG--#GD-DAGAGCGCUGCUCUUACAAAGCAGAU-------------------7UCGGCGGUUCGAAACCGUCCGCGCCCA--- 
Vµµ=µµµµgtaµUµValµVACµEscherichia coliµprokaryotic cytosol µ-GGGUGAU4AGCUCAGCD-GGG--AGAGCACCUCCCUVAC=AGGAGGGG-------------------7UCGGCGGTPCGAUCCCGUCAUCACCCACCA 
CµµAµµµµgcgµarchéeµAlaµCGCµHalobacterium salinarumµprokaryotic cytosol µ-GGGCUCGUAGAUCAGC--GGU--AGAUCRCUUCCUUCGCAAGGAAGAG-------------------GCC?UGGG]PBOAAUCCCAGCGAGUCCACCA 
CµµAµµµµgcgµCµAlaµCGCµHaloferax volcaniiµprokaryotic cytosol µ-GGGCUCGUAGAUCAGU--GGC--AGAUCRCUUCCUUCGCAAGGAAGAG-------------------GC??GGGG]PBOAAUCCCCGCGAGUCCACCA 
GµµAµµµµgccµGµAlaµGGCµHaloferax volcaniiµprokaryotic cytosol µ-GGGCUCGUAGAUCAGG--GGU--AGAUCACUCCCUUGGCAUGGGAGAG-------------------GC??CGGG]PBOAAUCCCGGCGAGUCCACCA 
UµµAµµµµgcaµUµAlaµUGCµHaloferax volcaniiµprokaryotic cytosol µ-GGGCCCAUAGCUCAGU--GGU--AGAGULCCUCCUUUGCAAGGAGGAU-------------------GC??AGGG]PBGAAUCCCUGUGGGUCCACCA 
CµµKµµµµcggµCµArgµCCGµHaloferax volcaniiµprokaryotic cytosol µ-GGGCCCGUAGCUCA(U--GGAC-AGAGURCUUGGUUCCGKACCAAGAU-------------------GC?GCGGG]PBOAAUCCCGUCGGGUCCGCCA 
GµµKµµµµcgcµGµArgµGCGµHalobacterium salinarumµprokaryotic cytosol µ-GUCCGGAUARGGPAGU--GGACUAUCCUCUUGGCUUGCGKAGCCAGGG-------------------A-CCGG?G]PBOAAUCGCCGUCCGGACGCCA 
;µµ6µµµµaacµGµAsnµ;UUµMethanobacterium thermaggregansµprokaryotic cytosol µ-GCGCCGGUGGCUCA;CCUGGUU-AGAGCUCACGGCU;UU6ACCGUGAG-------------------GCCGCGGGPPBOAAUCCCGCCCGGCGCACCA 
Gµµ6µµµµaacµGµAsnµGUUµHalobacterium salinarumµprokaryotic cytosol µ-GCCGCCAUAGCUCAGUU-GGU--AGAGCACGUGGUUGUU6CCCACGUU-------------------GU?CCAGG]PBGGACCCUGGUGGCGGCGAAC 
Gµµ6µµµµaacµGµAsnµGUUµHaloferax volcaniiµprokaryotic cytosol µ-GCCGCCGUAGCUCA(UU-GGU--AGAGCACCUCGCUGUU6ACGAGGUU-------------------GU??CAGG]PBGAGUCCUGGCGGUGGCGCCA 
CµµKµµµµcagµCµGlnµCUGµHalobacterium salinarumµprokaryotic cytosol µ-AGUCCCGU.RGGPAGU--GGCCAAUCCUGAAGCCUUCUGKGGGCUUCG-------------------A-CGGAAGPPBGAAUCUUCCCGGGACUACCA 
CµµAµµµµgggµCµGlyµCCCµHaloferax volcaniiµprokaryotic cytosol µ-GCGCCGAUGLUCCAGU--GGU--AGGACACGAGCUUCCCAAGCUCGGA-------------------G-C?CGGG]PBOAUUCCCGGUCGGCGCACCA 
GµµAµµµµggcµGµGlyµGCCµHalobacterium salinarumµprokaryotic cytosol µ-GCGCUGGUALUGPAGU--GGU--AUCACGUGACCUUGCCAUGGUCACA-------------------A-??UGGG]PBOAAUCCCAGCCAGCGCACCA 
GµµAµµµµggcµGµGlyµGCCµHaloferax volcaniiµprokaryotic cytosol µ-GCGUCGGUALUGPAGU--GGU--AUCACGUGACCUUGCCAUGGUCACA-------------------A-C?UGGG]PBOAAUCCCAGCCGACGCACCA 
GµµAµµµµggcµGµGlyµGCCµHaloferax volcaniiµprokaryotic cytosol µ-GCGCUGGUALUGPAGU--GGU--AUCACGUGACCUUGCCAUGGUCACA-------------------A-C?UGGG]PBOAAUCCCAGCCAGCGCACCA 
GµµAµµµµggcµGµGlyµGCCµMethanobacterium thermaggregansµprokaryotic cytosol µ-GCGGCGUUAGUCCA;CU-GGU-UAAGACACUGGCCUGCCACGCCAGCG-------------------U-CCCGGGPPBOAAUCCCGGACGCCGCACCA 
NµµAµµµµggaµUµGlyµNCCµHaloferax volcaniiµprokaryotic cytosol µ-GCACCGGUGLUCUAAU--GGU--AAGACAUUGGCCUNCCAAGCCAAUU-------------------A-U?UGGG]PBGAUUCCCAGCCGGUGCACCA 
GµµKµµµµcacµGµHisµGUGµHalobacterium salinarumµprokaryotic cytosol µGUCCGGGCU.RGGPAGU--GGACUAUCCUUCAGCCUUGUGKAGGCUGAG-------------------A-CGCGGG]PBGAUUCUCGCGCCUGGACCCA 
Gµµ6µµµµatcµGµIleµGAUµHaloferax volcaniiµprokaryotic cytosol µ-GGGCCAAUAGCUCAGUCAGGUU--GAGCRCPCGGCUGAU6AC?GGGAG-------------------GCC?GCGG]PBOAAUCCGCGUUGGCCCACCA 
Nµµ6µµµµataµUµIleµNAUµHaloferax volcaniiµprokaryotic cytosol µ-GGGCCCCUAGCUCA(UCUGGUC-AGAGCRCUCGGCUNAU6ACCGGGUG-------------------GU?AUGGG]PBGAACCCCAUGGGGCCCACCA 
CµµAµµµµatgµCµIniµCAUµSulfolobus acidocaldariusµprokaryotic cytosol µ-AGCGGCGU.LGGAACUG-GGAGUAUCCC|CA#GGBUCAUAACCCUGAG-------------------GU?CCUGGJUBO"AUCCAGGCGCCGCUACCA 
CµµAµµµµatgµCµIniµCAUµThermoplasma acidophilumµprokaryotic cytosol µ-AGCGGGGUGGGGPAGUCAGGA--AAUCCLAUGGGBUCAUAACCCGUAG-------------------AUCGAUGGPPBH"AUCCAUCCCCCGCUACCA 
Mµµ6µµµµaagµCµLysµMUUµHaloferax volcaniiµprokaryotic cytosol µ-GGGCCGGUAGCUCA(UUAGGC--AGAGCRUCUGABUMUU6APCAGACG-------------------GU?GCGPG]PBOAAUCGCGUCCGGCCCACCA 
Nµµ6µµµµaaaµUµLysµNUUµHaloferax volcaniiµprokaryotic cytosol µ-GGGCUGGUAGCUCA(UUAGGC--AGAGCRUCUGGBUNUU6ACCAGACG-------------------GU?GGGGG]PBOAGUCCCUCCCAGCCCGCCA 
Bµµ6µµµµatgµCµMetµBAUµHaloferax volcaniiµprokaryotic cytosol µ-GCCCGGGUGGCUPA(CU-GGAC-APAGCGCCGCACUBAU6APGCGGAG-------------------AU?GUGGG]PBGGAGCCCACCCCGGGCACCA 
Cµµ6µµµµatgµCµMetµCAUµThermoplasma acidophilumµprokaryotic cytosol µ-GCCGGGG4GGCUCA(CU-GGA--GGAGCRCCGGABUCAU6AUCCGGAG-------------------GUCUCGGGPPBGAUCCCCGAUCCCGGCACCA 
GµµKµµµµcccµGµProµGGGµHaloferax volcaniiµprokaryotic cytosol µ-GGGACCGUGRGGPAGU--GGU--AUCCUCUGCCGAUGGGKUCGGUAGG-------------------A-C?UGAG]PBGACUCUCAGCGGUCCCACCA 
MµµKµµµµccgµCµProµMGGµHaloferax volcaniiµprokaryotic cytosol µ-GGGCCGGUGRGGPA(CUUGGU--AUCCUUCGGCCUUMGGKPGGCCGUA-------------------A-??UCAG]PBGAAUCUGAGCCGGCCCACCA 
UµµKµµµµccaµUµProµUGGµHaloferax volcaniiµprokaryotic cytosol µ-GGGACCGUGRGUPA(CCUGGU--AUACUUCGGGCCUUGGKUGCCCGUG-------------------A-??CCGG]PBOAAUCCGGGCGGUCCCACCA 
CµµAµµµµtagµCµPyrµCUAµMethanosarcina barkeriµprokaryotic cytosol µ-GGAAACC4-GAUCA-U--G-U--AGAUCG_UGGACUCUAAAUCCG_CA---------------------GCCGGG]UAGAUUCCCGGGGUUUCCGCCA 
Cµµ6µµµµacgµCµThrµCGUµHaloferax volcaniiµprokaryotic cytosol µ-GCCGGUGUAGCUCA(UU-GGC--AGAGCRAUUCCUUCGU6AGGAAUAG-------------------GC?GAGGG]PBOAAUCCCUCCACCGGCUCCA 
Gµµ6µµµµaccµGµThrµGGUµHalobacterium salinarumµprokaryotic cytosol µ-GCCUGGGUAGCUPAGC--GGU--AAAGCRCGUCCUUGGU6AGGACGAG-------------------ACC??GGA]PBOAAUUCCGGCCUAGGCUCCA 
Gµµ6µµµµaccµGµThrµGGUµHaloferax volcaniiµprokaryotic cytosol µ-GCCUGGGUAGCUPA(C--GGU--AAAGCRCGUCCUUGGU6AGGACGAG-------------------AC??CGGG]PBOAAUCCCGGCCUAGGCUCCA 
GµµAµµµµgtcµarchéeµValµGACµHaloferax volcaniiµprokaryotic cytosol µ-GGGUUGGUGGUCPAGUCUGGUU-AUGACACCUCCUUGACAUGGAGGAG-------------------GC?GGCAG]PBOAAUCUGCCCCAACCCACCA 
Bµµ6µµµµµvirusµMetµBAUµAvian myeloblastosis virusµprokaryotic cytosol µ-GCCUCCUUALCGCAGDA-GGN--AGCGCRPCAGPCUBAU6APCUGAAG-------------------7D??UGAGTPCG"ACCUCAGAGGGGGCACCA 
BµµKµµµµµvirusµTrpµBCAµAvian myeloblastosis virusµprokaryotic cytosol µ-GACCUCGUKLCGCAAC--#GD--AGCGCRPCUGABUBCAKAZCAGAAG-------------------7CUGCGUGPPCG"AUCACGUCGGGGUCACCA 
NµµAµµµµµvirusµGlyµNCCµEnterobacteria phage T4µprokaryotic cytosol µ-GCGGAUAUCGUAUAAU--#GD--AUUACCUCAGACUNCCAAPCUGAUG-------------------A-UGUGAGTPCGAUUCUCAUUAUCCGCUCCA 
.µµHµµµµµvirusµIleµ.AUµEnterobacteria phage T4µprokaryotic cytosol µ-GGCCCUGUAGCUCAAU--#GDDAGCAGCAGUCCCCU.AUHAGGGAAAG-------------------7UUACCAGTPCAAAUCUGGUCUGGGUCACCA 
NµµKµµµµµvirusµProµNGGµEnterobacteria phage T4µprokaryotic cytosol µ-CUCCGUG4AGCUCAGUUUGGD--AGAGCGCCUGAJUNGGKAPCAGGAG-------------------7UCCAAGGTPCAAAUCCUUGUAUGGAGACCA 
Nµµ/µµµµµvirusµGlnµNUGµEnterobacteria phage T4µprokaryotic cytosol µ-UGGGAAU4AGCCAAGDD-GGD--AAGGCAUAGCACUNUG/CPGCUAGA-------------------UGCAAAGGTPCGAGUCCUUUAUUCCCAGCCA 
NµµAµµµµµvirusµArgµNCUµEnterobacteria phage T4µprokaryotic cytosol µ-GUCCCGCUGGUGUAAU--#GAD-AGCAUACGAUCCUNCUAAGPUUGCG-------------------G-UCCUGGTPCGAUCCCAGGGCGGGAUACCA 
NµµHµµµµµvirusµThrµNGUµEnterobacteria phage T4µprokaryotic cytosol µ-GCUGAUUUAGCUCAGDA-GGD--AGAGCACCUCACUNGUHAPGAGGAU-------------------7UCGGCGGTPCGAUUCCGUCAAUCAGCACCA 
GµµHµµµµµvirusµAsnµGUUµEnterobacteria phage T5µprokaryotic cytosol µ-GGUUCCUUAGCUCUAAU-GGDU-AGAGCCGCAUCUUGUUHAGPUGAGG-------------------7UUGCUGGTPCGAAUCCAGCAGGAACCGCCA 
UµµKµµµµµvirusµProµUGGµEnterobacteria phage T5µprokaryotic cytosol µ-CUCCGAUUAGCUCAAUU-GGCD-AGAGUACACCGUUUGGKGCGGUGGG-------------------7UUGAAGGTPCGAGUCCUUCAUUGGAGACCA 
IµµKµµµµµvirusµProµIGGµMoloney murine leukemia virusµprokaryotic cytosol µ-GGCJCLUUKGUCPAGG--GGD--AUGAUUCUCGCJUIGGKPGCGAGAG-------------------7D??CGGGPPCA"AUCCCGGACGAGCCCCCA 
NµµKµµµµµvirusµProµNGGµMoloney murine leukemia virusµprokaryotic cytosol µ-GGCJCLUUKGUCPAGG--GGD--AUGAUUCUCGCPUNGGKPGCGAGAG-------------------7D??CGGGPPCA"AUCCCGGACGAGCCCCCA 

Compilation des tRNAs des bactéries[modifier | modifier le wikicode]

t:t: : : : ::Inosine::`+::: : : : :: : : : 
:: : : : ::9::9::: : : : :: : : : 
74:c:#:G:KWY::: :::::9Q:G:K+::::G:K+:
40::22:1:23::: :::::5:9:14::::2:2:
28:a:~.N:U:K:::&:U:`+H:A:: :::::1N:U:+:
26::7:1:8:::3:2:4:1:: :::::5:1:6:
:g:B°?<::K ;::::Cleu:`+:Aleu:: :::::B::K:A
::6::6::::6:5:1:: :::::5::4:1
c:t:Inosine::K:G::Inosine: :K: :: : : : ::Inosine::K/:A
::7::6:1::1::1::: : : : ::4::3:1
24:c: ::::: :::::Q:G:K:G:: :::
6:: ::::: :::::1:5:5:1:: :::
34:a::U:K:::&N::K:::NJ:Utaa:E6 /:A:::::
:g::C.:K::: ::::::Ctag:6tag:A:::C:K:
:::4:4::: ::::::4:1:3:::2:2:
a:t:Inosine::t6A:::Inosine: :t6A: :: : : : :: : : : 
::5::5:::3::3::: : : : :: : : : 
60:c: ::::: :::::Q:G:t6A::::G:6E+:
6:: ::::: :::::4:2:6::::5:5:
44:a:PAP::t6A::: :::::N)3::[6H:::3 1::t6A:
16::1::1::: :::::6::6:::2::2:
:g: ::::: ::::::C:6H::::C:t6A:
:: ::::: ::::::10:10::::1:1:
:Met:B:C:6E::: ::::: ::::: :::
::5:1:6::: ::::: ::::: :::
:ini::C:+6::: ::::: ::::: :::
:::18:18::: ::::: ::::: :::
g:t:Inosine:: :A::Inosine: :O: :: : : : :: : : : 
::7:::7::6::6::: : : : :: : : : 
26:c: ::::: :::::manQ:G:K:A:::G::A
12:: ::::: :::::4:3:1:6:::5::5
32:a:&N:::A:: :::::3 2:U::A::,N:::A
16::2:::2:: :::::4:1::5::2:::2
:g::C.::A:: ::::::C::A:::C::A
:::4::4:: ::::::4::4:::1::1

Compilation des tRNAs des eucaryotes[modifier | modifier le wikicode]

t:t: : : : ::Inosine::`+::: : : : :: : : : 
:: : : : ::9::9::: : : : :: : : : 
74:c:#:G:KWY::: :::::9Q:G:K+::::G:K+:
40::22:1:23::: :::::5:9:14::::2:2:
28:a:~.N:U:K:::&:U:`+H:A:: :::::1N:U:+:
26::7:1:8:::3:2:4:1:: :::::5:1:6:
:g:B°?<::K ;::::Cleu:`+:Aleu:: :::::B::K:A
::6::6::::6:5:1:: :::::5::4:1
c:t:Inosine::K:G::Inosine: :K: :: : : : ::Inosine::K/:A
::7::6:1::1::1::: : : : ::4::3:1
24:c: ::::: :::::Q:G:K:G:: :::
6:: ::::: :::::1:5:5:1:: :::
:g::C.:K::: ::::::Ctag:6tag:A:::C:K:
:::4:4::: ::::::4:1:3:::2:2:
a:t:Inosine::t6A:::Inosine: :t6A: :: : : : :: : : : 
::5::5:::3::3::: : : : :: : : : 
60:c: ::::: :::::Q:G:t6A::::G:6E+:
6:: ::::: :::::4:2:6::::5:5:
44:a:PAP::t6A::: :::::3N)::6[H:::3 1::t6A:
16::1::1::: :::::6::6:::2::2:
:g: ::::: ::::::C:6H::::C:t6A:
:: ::::: ::::::10:10::::1:1:
:Met:B:C:6E::: ::::: ::::: :::
::5:1:6::: ::::: ::::: :::
:ini::C:6+::: ::::: ::::: :::
:::18:18::: ::::: ::::: :::
g:t:Inosine:: :A::Inosine: :O: :: : : : :: : : : 
::7:::7::6::6::: : : : :: : : : 
26:c: ::::: :::::manQ:G:K:A:::G::A
12:: ::::: :::::4:3:1:6:::5::5
32:a:&N:::A:: :::::3 2:U::A::,N:::A
16::2:::2:: :::::4:1::5::2:::2
:g::C.::A:: ::::::C::A:::C::A
:::4::4:: ::::::4::4:::1::1

Compilation des tRNAs des archées[modifier | modifier le wikicode]

t:t: : : : :: : : : :: : : : :: : : : 
:: : : : :: : : : :: : : : :: : : : 
4:a::U:K::: ::::: ::::: :::
4:::1:1::: ::::: ::::: :::
c:t: : : : :: : : : :: : : : :: : : : 
:: : : : :: : : : :: : : : :: : : : 
8:a:5&::K::::U:K::: :::::N::K:
8::2::2::::1:1::: :::::1::1:
a:t: : : : :: : : : :: : : : :: : : : 
:: : : : :: : : : :: : : : :: : : : 
10:a:N::t6A::: :::::N::t6A::: :::
2::1::1::: :::::1::1::: :::
:g: ::::::C:t6A:::M::t6A::: :::
:: ::::::1:1:::1::1::: :::
:Met:B:C:t6A::: ::::: ::::: :::
::1:1:2::: ::::: ::::: :::
:ini::C::A:: ::::: ::::: :::
:::5::5:: ::::: ::::: :::
g:t: : : : :: : : : :: : : : :: : : : 
:: : : : :: : : : :: : : : :: : : : 
6:a: ::::::U::A::N::K:::N:::A
12:: ::::::1::1::1::1:::1:::1

Détails pour mcac lla eco hvo sce[modifier | modifier le wikicode]

;;mcac;30 tRNAs;;;;;;;;30 gènes tRNA de mcac;;;;;;;;%GC
;;lla;26tRNAs;;;;;;;;63 gènes tRNA de lla;;;;;;;;%GC
;a;k2C;m6A;mo5U;t6A;cmnm5s2U; 2 t6A;U;C;;a;;;2;;3;;1;
;a;mo5U;m6A;mo5U;t6A;U;A;U mo5U;2 m6A;;a;3;;6;;2;;2;
;;E.coli;43 tRNAs;;strain unknown;;Liepzig*;;;;86 gènes tRNA de eco;;;;K12;;;;%GC
;c;G;ms2i6A;G;A;2 QtRNA;msi6A;G;ms2i6A;;c;2;;2;;3;;1;
;c;G;t6A;2 G;m6t6A;QtRNA;t6A;G;t6A;;c;3;;2;;4;;1;
g;i;2 C;A;;;;;;;;i;;;;;;;;
;c;2 G;A;G;A;gluQtRNA;m2A;G;A;;c;2;;2;;3;;4;
;a;cmo5U;m6A;cmo5U;A;mnm5s2U;2 m2A;mnm5U;A;;a;5;;3;;4;;1;
;;hvo;41 tRNAs;;codons*;;;;;;53 gènes tRNA de lla;;;;;;;;%GC
;c;G;A;G;A;G;A;2 G;A;;c;2;;1;;2;;2;
;;sce;35 tRNAs;;;;;;;;275 gènes tRNA de sce;;;;;;;;%GC
t;t;;;2 Inosine; i6A;;;;;;t;;;11;;;;;
;c;2 Gm; yW;;;GPA;i6A;G;i6A;;c;10;;;;8;;4;
;c;;;;;2 G; m1G;;;;c;1;;;;7;;;
a;t;Inosine;t6A;2 Inosine; t6A;;;;;;t;13;;11;;;;;